CRISPR / Cas9 gene editing vector targeting wheat TaSnRK1alpha gene and application of CRISPR / Cas9 gene editing vector

By constructing a CRISPR/Cas9 gene editing vector and precisely knocking out the wheat TaSnRK1α gene using a specific sgRNA target, the problem of regulating the high molecular weight glutenin content in wheat grains was solved, enabling targeted improvement of wheat quality and creation of new germplasm materials.

CN121737191APending Publication Date: 2026-03-27YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511862602.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-11
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing technologies struggle to efficiently regulate the content of high molecular weight glutenin in wheat grains, affecting dough elasticity and processing characteristics, and there is a lack of effective gene-editing tools for targeted breeding.

Method used

We designed specific sgRNA targets, constructed a CRISPR/Cas9 gene editing vector, and used the pBUE414 backbone vector to achieve precise knockout of the wheat TaSnRK1α gene, thereby reducing the HMW-GS content in mature grains.

Benefits of technology

Significantly reducing the high molecular weight glutenin content in wheat grains provides a new pathway for quality improvement and offers technical support for creating new wheat germplasm materials with specific quality traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 (CRISPR associated protein 9) gene editing vector targeting a wheat TaSnRK1 alpha gene and application of the CRISPR / Cas9 gene editing vector. PBUE414 is used as a skeleton vector of the vector, and the vector comprises a Cas9 expression cassette and an sgRNA (single guide ribonucleic acid) expression cassette; the Cas9 expression cassette is an expression cassette for regulating and controlling Cas9 expression by a Ubi promoter, and the sgRNA expression cassette sequentially comprises the following elements from upstream to downstream: a TaU3 promoter, sgRNA1 of TaSnRK1 alpha, a terminator OsU3t, a TaU3 promoter, sgRNA2 of TaSnRK1 alpha and a terminator TaU3t. The vector is suitable for reducing the high-molecular-weight glutelin content of wheat mature grains through a gene knockout technology, and a new technical means and germplasm resources are provided for wheat quality improvement.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology and molecular breeding, specifically relating to a key gene that targets and regulates the high molecular weight glutenin content in wheat grains. TaSnRK1a Gene editing vectors and their application in creating new weak-gluten wheat germplasm with high molecular weight gluten content. Background Technology

[0002] wheat( Triticum aestivum Wheat gluten (L.) is one of the most important food crops worldwide, and its grain quality, especially its processing quality, is mainly determined by the composition and content of storage proteins. High molecular weight glutenin subunits (HMW-GS) are key components of gluten protein, and their content and proportion directly affect the elasticity and processing characteristics of dough.

[0003] SnRK protein kinases play a central role in plant energy metabolism and stress response. Previous studies have found that its family members... TaSnRK1a It participates in regulating the synthesis of starch and storage proteins in wheat grains. Due to its high efficiency and precision, CRISPR / Cas9 gene editing technology has become a powerful tool for crop gene function verification and targeted breeding. Development targeting... TaSnRK1a Gene editing tools not only help to deeply analyze the biological functions of genes, but also provide technical support for the direct creation of new wheat germplasm materials with specific quality traits. Summary of the Invention

[0004] This invention provides a method for efficiently and specifically knocking out wheat. TaSnRK1a CRISPR / Cas9 editing vectors for wheat genes and their application in regulating wheat grain storage protein content and improving quality. This study describes the design of specific sgRNA targets and the construction of efficient CRISPR / Cas9 editing vectors to achieve the desired effects on wheat grain storage protein content and quality improvement. TaSnRK1a Precise gene knockout reduces the HMW-GS content in mature grains, providing a new technical pathway and germplasm material for targeted improvement of wheat quality.

[0005] To achieve the above objectives, the present invention provides, in one aspect, a wheat TaSnRK1a A CRISPR / Cas9 gene editing vector, using pBUE414 as its backbone, contains a Cas9 expression cassette and an sgRNA expression cassette. The Cas9 expression cassette is the expression cassette for Cas9 expression regulated by the Ubi promoter. The sgRNA expression cassette includes, from upstream to downstream, the following elements: TaU3 promoter, ... TaSnRK1a sgRNA1, terminator OsU3t, TaU3 promoter, TaSnRK1a sgRNA2, terminator TaU3t, wherein TaSnRK1aThe sequence of sgRNA1 is shown in SEQ ID NO.1. TaSnRK1a The sequence of sgRNA2 is shown in SEQ ID NO.2.

[0006] The SnRK family transcription factors involved in this invention TaSnRK1a This gene can regulate the synthesis of high molecular weight gluten in wheat. In the knockout transgenic lines, the content of high molecular weight gluten in mature grains is significantly reduced.

[0007] A second aspect of the present invention provides the application of the above-described gene editing vector in reducing the high molecular weight glutenin content of wheat.

[0008] A third aspect of this invention provides a method for preparing wheat with reduced high molecular weight glutenin content, which uses a CRISPR / Cas9 gene editing vector to knock out wheat. TaSnRK1a Gene; the CRISPR / Cas9 gene editing vector is the CRISPR / Cas9 gene editing vector described above.

[0009] A third aspect of the present invention provides a method for constructing the above-mentioned gene editing vector, comprising the following steps: (1) Primer and target design: Design TaSnRK1a Primers were designed to amplify the target sgRNA1 and sgRNA2 of the gene and to amplify the backbone sequences of the terminator OsU3t and the promoter TaU3. The sgRNA1 and sgRNA2 sequences were respectively ligated to the 5' end of the amplification primers. The amplification primers are TaSnRK1α-gR1-F0 as shown in SEQ ID NO.3 and TaSnRK1α-gR2-R0 as shown in SEQ ID NO.4. (2) Obtaining the target fragment: Design primers for amplifying the PCR product of step (1), and connect the BsaI restriction site sequence to the 5' end of the primers. The amplification primers are TaSnRK1α-gR1-F as shown in SEQ ID NO.5 and TaSnRK1α-gR2-R as shown in SEQ ID NO.6. (3) The two primer pairs TaSnRK1α-gR1-F0, TaSnRK1α-gR2-R0, TaSnRK1α-gR1-F and TaSnRK1α-gR2-R were mixed and amplified to obtain the PCR product shown in SEQ ID NO.7. The above four primer mixture system was as follows: the final concentration of TaSnRK1α-gR1-F0 and TaSnRK1α-gR1-R0 was 0.5 μmol / L, and the final concentration of TaSnRK1α-gR1-F and TaSnRK1α-gR2-R was 10 μmol / L. (4) The PCR product obtained in step (3) is mixed with restriction endonuclease BsaI, restriction endonuclease buffer, pBUE414 vector plasmid, T4 ligase and 10×NEB T4 Buffer to carry out vector digestion and ligation reaction to obtain the vector.

[0010] The above ligation system was transformed into E. coli competent cells DH5α, positive clones were screened, and the correctly sequenced single clones were propagated, plasmids were extracted, and transformed into EHA105 Agrobacterium competent cells.

[0011] The fifth aspect of the present invention provides targeted wheat TaSnRK1a The sgRNA combinations of the gene are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0012] Through the above technical solution, the present invention achieves the following beneficial effects: 1) Utilizing the invention provided TaSnRK1a Gene knockout vectors can rapidly knock out genes in wheat. TaSnRK1a This invention provides an effective method for gene knockout; the two sgRNAs provided in this invention are for knocking out genes in wheat. TaSnRK1a Key sites of genes; 2) This invention constructs a method for knockout TaSnRK1a The CRISPR / Cas9 gene editing vector was used to inject genes into wheat materials via Agrobacterium-mediated transformation. TaSnRK1a The gene was successfully knocked out, and the content of high molecular weight gluten in the wheat grains of the resulting wheat material was significantly reduced. Attached Figure Description

[0013] Figure 1 for TaSnRK1a Partial homologous gene sequence alignment results, where the red boxes mark the locations of gene knockout target sites sgRNA1 and sgRNA2; Figure 2 for TaSnRK1a Image showing positive colony detection of gene knockout vector construction; lanes 1-18, except for the marker, contain PCR amplification products of E. coli culture. Figure 3 for TaSnRK1a Schematic diagram of sequence variation in gene knockout transgenic lines; sequences shown in boxes are unmutated amino acid sequences, arrows represent frameshift mutation sequences, and asterisks represent sequences that have terminated translation. Figure 4 for TaSnRK1a Gel graph of high molecular weight gluten content in gene knockout transgenic lines. Detailed Implementation

[0014] The present invention will be further described below with reference to specific implementation examples, but the scope of protection of the present invention is not limited to the following. Unless otherwise specified in the present invention, all technical terms involved in the present invention should be interpreted according to their ordinary meaning by those skilled in the art. Various methods and steps not described in detail in the implementation examples are considered standard methods well known to those skilled in the art, and the materials and reagents used, unless otherwise specified, can be purchased through conventional commercial channels. The wheat germplasm resources used in this study were all provided by the College of Agriculture of Yangzhou University - Jiangsu Provincial Crop Germplasm Resource Bank, and those skilled in the art can publicly obtain and use the above materials.

[0015] Example 1 TaSnRK1a Design of target sgRNA knockout Wheat was obtained by searching the Ensembl Plants database. TaSnRK1a The CDS sequences of the three homologous genes were compared using DNAMAN to screen for two target sites located in the conserved region of the second exon, as shown in SEQ ID NO.1 and SEQ ID NO.2. Simultaneously, the specificity of the editing (e.g., ...) was ensured. Figure 1 ).

[0016] Example 2 Construction TaSnRK1a Knockout of transgenic vectors 1. Obtaining the target fragment: Two pairs of primers, TaSnRK1α-gR1-F0, TaSnRK1α-gR2-R0, TaSnRK1α-gR1-F, and TaSnRK1α-gR2-R, were designed as shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6. After mixing, the terminator OsU3t and promoter TaU3 backbone sequences were amplified from MT1T2 to obtain the PCR product shown in SEQ ID NO.7. The product was then extracted using an agarose gel DNA extraction kit (TIANGEN, DP219-03).

[0017] The above four primer mixture system is as follows: the final concentrations of TaSnRK1α-gR1-F0 and TaSnRK1α-gR1-R0 are 0.5 μmol / L, and the final concentrations of TaSnRK1α-gR1-F and TaSnRK1α-gR2-R are 10 μmol / L; The components, amounts, and specific amplification procedures for the above PCR amplification reaction system are as follows: 2×Phanta mix reaction system

[0018] 2×Phanta mix amplification program

[0019] 2. Enzyme digestion and ligation: The enzyme digestion and ligation system is shown below. The reaction conditions for the ligation system are 37℃ for 5 h. Then, inactivation is performed: 50℃ for 5 min; 80℃ for 10 min.

[0020] TaSnRK1a - The CRISPR vector construction system is as follows

[0021] 3. Transform Escherichia coli and perform plate screening: Add the above recombinant system to 50 μL of DH5α Escherichia coli competent cells, place on ice for 30 min, heat shock at 42 ℃ for 90 s, cool on ice for 2 min, add 500 μL of non-resistant LB, activate on a shaker at 37 ℃ for 45 min, and plate on kanamycin-resistant LB agar plates.

[0022] 4. Screening and sequencing of positive clones: Single clones were picked and cultured in 200 μL of liquid culture medium. Using the selected bacterial culture as a template, amplification was performed using the vector primers 414F (SEQ ID NO. 23) and 414R (SEQ ID NO. 24). After agarose gel electrophoresis, the clones were identified as follows: Figure 2 As shown, except for the marker lane, the other lanes contain PCR amplification products of the above bacterial solutions. The screened positive bacterial solutions were sent to Nanjing Qingke Company for sequencing, and the sequences were compared using DNAMAN. Bacterial solutions with sequencing sequences consistent with the target sequence were selected, expanded for culture, and plasmids were extracted using the Tiangen Company Plasmid Mini-Prep Kit (DP103-03).

[0023] 5. Transformation into Agrobacterium (EHA105): Add 1 μg of plasmid to 100 μL of EHA105 competent E. coli cells, mix well, and place on ice for 30 min; freeze in liquid nitrogen for 5 min; heat shock at 37 ℃ for 5 min; cool on ice for 2 min; add 500 μL of antibiotic-free LB agar, shake on a shaker at 28 ℃ for 2-3 h; centrifuge at 3500 rpm for 5 min, discard part of the supernatant, mix the remaining supernatant with the precipitate by pipetting, spread on antibiotic-resistant LB agar plates, incubate for about 2 days, pick spots and expand the culture.

[0024] 6. Screening positive clones and sequencing: Same as step (4). The correctly sequenced clones were sent to the Jiangsu Academy of Agricultural Sciences for genetic transformation, with the recipient being the wheat variety Fielder.

[0025] Example 3 TaSnRK1a Identification of knockout transgenic lines First, DNA was extracted from leaves of wild-type and knockout transgenic lines. Three pairs of specific primers were designed to amplify some homologous genes located on wheat chromosomes 1A, 1B, and 1D. TaSnRK1α-A , TaSnRK1α-B , TaSnRK1α-D The primers are shown in SEQ ID NO. 8 and SEQ ID NO. 9, SEQ ID NO. 10 and SEQ ID NO. 11, and SEQ ID NO. 12 and SEQ ID NO. 13, respectively. The amplified products were sent to a sequencing company for Sanger sequencing. The sequencing results were compared with the wild-type sequence to obtain... TaSnRK1α-A Variation type TaSnRK1α-B Variation type TaSnRK1α-D The mutation types. Results showed that mutations occurred in all three partial homologous genes of the knockout transgenic lines (KO-1, KO-6): KO-1 line TaSnRK1α-A A 1bp deletion near the target point TaSnRK1α-B 4bp missing near the target TaSnRK1α-D A 5bp deletion was found near the target site; the KO-6 strain exhibited varying degrees of frameshift mutations. TaSnRK1α-A A 1bp deletion near the target point TaSnRK1α-B A 1bp deletion near the target point TaSnRK1α-D A 1bp loss near the target site; all resulted in TaSnRK1a Loss of gene function.

[0026] Obtained from the above TaSnRK1a Mutants that terminate prematurely due to frameshift mutations in some homologous genes (see reference) Figure 3 ). in wild type TaSnRK1α-A The sequence is shown in SEQ ID NO.14, in mutant KO-1. TaSnRK1α-A The sequence is shown in SEQ ID NO. 15, in mutant KO-6 TaSnRK1α-A The sequence is shown in SEQ ID NO.16; wild type TaSnRK1α-B The sequence is shown in SEQ ID NO.17, in mutant KO-1. TaSnRK1α-B The sequence is shown in SEQ ID NO.18, in mutant KO-6. TaSnRK1α-B The sequence is shown in SEQ ID NO.19; wild type TaSnRK1α-D The sequence is shown in SEQ ID NO.20, in mutant KO-1. TaSnRK1α-D The sequence is shown in SEQ ID NO.21, and the TaSnRK1α-D sequence in mutant KO-6 is shown in SEQ ID NO.22.

[0027] Example 4 TaSnRK1a Application of knockout transgenic lines in downregulating high molecular weight glutenin content in wheat 1. The preparation of the experimental reagents involved in the above wheat gluten extraction is as follows: 1) Gluten extract A: 7.5 mL isopropanol, 4.5 g sodium iodide, ddH2O to bring the total to 100 mL; 2) Gluten extract solution B (prepared fresh): 25 mL isopropanol, 4 mL Tris-HCl (1 M, pH 8.0), 10 g SDS, 2 g DTT, ddH2O to bring the total to 100 mL; 3) Gluten extract C (prepared fresh): 25 mL isopropanol, 4 mL Tris-HCl (1M, pH 8.0), 10 g SDS, 1.4 mL VP, ddH2O to bring the total to 100 mL; 4) Gluten extract D: 62.5 mL Tris-HCl (1 M, pH 6.8), 5 mL β-mercaptoethanol, 20 mL glycerol, 2 g SDS, 0.2 g bromophenol blue, ddH2O to bring the total to 100 mL.

[0028] 2. The gluten extraction process for the above-mentioned wild-type (WT), KO-1, and KO-6 strains is as follows: (1) Grind wheat grains. Take two grains, grind them, and weigh out 0.05 g of wheat grain powder. Transfer the powder to a 2.0 mL centrifuge tube. Add 800 μL of extraction solution A, shake thoroughly to form a suspension. Place the centrifuge tube at 65℃ for 1 h of extraction. Shake the tube every 10 min. After the extraction is complete, centrifuge at 10000 rpm for 3 min and discard the supernatant. (2) Repeat step (1); (3) Add 200 μL of extraction solution B to the above precipitate and vortex thoroughly. Then place the centrifuge tube at 65 °C for 1 h of extraction, vortexing once every 10 min; (4) Add 200 μL of extraction solution C, then vortex to mix, place the centrifuge tube at 65℃ for 30 min, and then centrifuge at 10000 rpm for 5 min. (5) Take 400 μL of the supernatant from the above extraction process and transfer it to another clean centrifuge tube; (6) Add 200 μL of extract D and vortex mix. Then let stand for 30 min and heat-treat in boiling water at 100℃ for 5 min; (7) After natural cooling, the solution is the gluten extract, which can be analyzed by electrophoresis.

[0029] 3. SDS-PAGE electrophoresis detection: The results are as follows Figure 4 As shown, compared with wild-type WT, the HMW-GS (Dx2, Bx14, Bx15, Dy12) bands of transgenic lines KO-1 and KO-6 were significantly lighter, and the content of high molecular weight glutenin was significantly reduced, confirming... TaSnRK1a The content of high molecular weight gluten in mature grains of knockout transgenic lines was significantly reduced.

[0030] The specific sequence is shown below: SEQ ID NO.1:ATCGCCGAGCATATAATTA SEQ ID NO.2:TTGGTAAGGTGAAGATCGC SEQ ID NO.3:gATCGCCGAGCATATAATTAgttttagagctagaaatagc SEQ ID NO.4: TTGGTAAGGTGAAGATCGCCGCTTCTTGGTGCC SEQ ID NO.5:aataatggtctcAGGCgATCGCCGAGCATATAATTA SEQ ID NO.6:ATTATTGGTCTCTAAACTTGGTAAGGTGAAGATCGC SEQ ID NO.7: AATAATGGTCTCAGGCGATCGCCGAGCATATAATTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTTTCGTTTTGCATTGAGTTTTCTCCGTCGCATGTTTGCAGTTTTATTTTCCGTTTTGCATTGAAATTTCTCCGTCTCATGTTTGCAGCGTGTTCAAAAAGTACGCAGCTGTATTTCACTTATTTACGGCGCCACATTTTCATGCCGTTTGTGCCAACTATCCCGAGCTAGTGAATACAGCTTGGCTTCACACAACACTGGTGACCCGCTGACCTGCTCGTACCTCGTACCGTCGTACGGCACAGCATTTGGAATTAAAGGGTGTGATCGATACTGCTTGCTGCTCATGAATCCAAACCACACGGAGTTCAAATTCCCACAGATTAAGGCTCGTCCGTCGCACAAGGTAATGTGTGAATATTATATCTGTCGTGCAAAATTGCCTGGCCTGCACAATTGCTGTTATAGTTGGCGGCAGGGAGAGTTTTAACATTGACTAGCGTGCTGATAATTTGTGAGAAATAATAATTGACAAGTAGATACTGACATTTGAGAAGAGCTTCTGAACTGTTATTAGTAACAAAAATGGAAAGCTGATGCACGGAAAAAGGAAAGAAAAAGCCATACTTTTTTTTAGGTAGGAAAAGAAAAAGCCATACGAGACTGATGTCTCTCAGATGGGCCGGGATCTGTCTATCTAGCAGGCAGCAGCCCACCAACCTCACGGGCCAGCAATTACGAGTCCTTCTAAAAGCTCCCGCCGAGGGGCGCTGGCGCTGCTGTGCAGCAGCACGTCTAACATTAGTCCCACCTCGCCAGTTTACAGGGAGCAGAACCAGCTTATAAGCGGAGGCGCGGCACCAAGAAGCGTTGGTAAGGTGAAGATCGCGTTTAGAGACCAATAAT SEQ ID NO.8:TGAGCTGGTGATAATACTGTAG SEQ ID NO.9:TTTCACGAGA CCTCAACACA ACAC SEQ ID NO.10:CGCTTGGCTGTGATTTATTTTAGG SEQ ID NO.11:TAGGAGGGAT TTTTGCTCGT TAAG SEQ ID NO.12:AATCGCGCCGGATTGTTTTTCGTG SEQ ID NO.13: TTAACGAGTT TCACGAGCAG CTC SEQ ID NO.14: SEQ ID NO.15: SEQ ID NO.16: SEQ ID NO.17: CGCTTGGCTGTGATTTATTTTAGGTCGACGATGGACGCAGCAGGCAGAGATGCCAACCCGCTGGCCGGCTACCGGATAGGCAAAACCCTCGGCATCGGGTCCTTTGGTAAGGTGAAGATCGCCGAGCATATAATTACGGGCCACAAGGTCGCAATCAAGATCCTCAATCGCCGTAAGATCAAGAGCATGGAGATGGAAGAGAAAGGTTGGTCATCGCTCATTCTGTTCAGAAAGCTTGTTTCTGTTTCTGGAGTACCTACAGTGTACATAGATTTGCGCCCGTTGAGAAAAGCTCATCAGAGGGCCATCTGCGTGTTTCTGCTGTAAGGTAGAAAGTAGAAACTGTCAAACACTTCATCCTTATTTCTGTTATAATCCTGTGATGCTTTAGCAATCAACTTGCAAGTTTTCATTTGGCTGTTGTCGATATCTAGTTTAAGTATGAGAATTGTCCATCCATAGTTTCTTGAATTTGTTATGTTAGAAGTTCCTGTTTGTGACTTCCCTGATCAACATGTACCCGTACTTTTCCCACTTTTGCTGTTTTGTACTTTGTAAAATCTCAGTTTTTTTTTGCTATTTTACAGCAAAAAGAAAAACCAGTATACTAAGATTATTTATGCATCCTCATATCATACGGTATTATGAGGTCATACATACCCCAGTGGATATTTATGTTGCTATGGAGGGGTGGATGAACGAGCTGCTCGTTAAGCTCGTGCTCATTAAGACTCGGGTCGTTAAGCTTAACGAGCAAAAATCCCTCCTA SEQ ID NO.18: CGCTTGGCTGTGATTTATTTTAGGTCGACGATGGACGCAGCAGGCAGAGATGCCAACCCGCTGGCCGGCTACCGGATAGGCAAAACCCTCGGCATCGGGTCCTTTGGGTGAAGATCGCCGAGCATATAATTACGGGCCACAAGGTCGCAATCAAGATCCTCAATCGCCGTAAGATCAAGAGCATGGAGATGGAAGAGAAAGGTTGGTCATCGCTCATTCTGTTCAGAAAGCTTGTTTCTGTTTCTGGAGTACCTACAGTGTACATAGATTTGCGCCCGTTGAGAAAAGCTCATCAGAGGGCCATCTGCGTGTTTCTGCTGTAAGGTAGAAAGTAGAAACTGTCAAACACTTCATCCTTATTTCTGTTATAATCCTGTGATGCTTTAGCAATCAACTTGCAAGTTTTCATTTGGCTGTTGTCGATATCTAGTTTAAGTATGAGAATTGTCCATCCATAGTTTCTTGAATTTGTTATGTTAGAAGTTCCTGTTTGTGACTTCCCTGATCAACATGTACCCGTACTTTTCCCACTTTTGCTGTTTTGTACTTTGTAAAATCTCAGTTTTTTTTTGCTATTTTACAGCAAAAAGAAAAACCAGTATACTAAGATTATTTATGCATCCTCATATCATACGGTATTATGAGGTCATACATACCCCAGTGGATATTTATGTTGCTATGGAGGGGTGGATGAACGAGCTGCTCGTTAAGCTCGTGCTCATTAAGACTCGGGTCGTTAAGCTTAACGAGCAAAAATCCCTCCTA SEQ ID NO.19: CGCTTGGCTGTGATTTATTTTAGGTCGACGATGGACGCAGCAGGCAGAGATGCCAACCCGCTGGCCGGCTACCGGATAGGCAAAACCCTCGGCATCGGGTCCTTTGTAAGGTGAAGATCGCCGAGCATATAATTACGGGCCACAAGGTCGCAATCAAGATCCTCAATCGCCGTAAGATCAAGAGCATGGAGATGGAAGAGAAAGGTTGGTCATCGCTCATTCTGTTCAGAAAGCTTGTTTCTGTTTCTGGAGTACCTACAGTGTACATAGATTTGCGCCCGTTGAGAAAAGCTCATCAGAGGGCCATCTGCGTGTTTCTGCTGTAAGGTAGAAAGTAGAAACTGTCAAACACTTCATCCTTATTTCTGTTATAATCCTGTGATGCTTTAGCAATCAACTTGCAAGTTTTCATTTGGCTGTTGTCGATATCTAGTTTAAGTATGAGAATTGTCCATCCATAGTTTCTTGAATTTGTTATGTTAGAAGTTCCTGTTTGTGACTTCCCTGATCAACATGTACCCGTACTTTTCCCACTTTTGCTGTTTTGTACTTTGTAAAATCTCAGTTTTTTTTTGCTATTTTACAGCAAAAAGAAAAACCAGTATACTAAGATTATTTATGCATCCTCATATCATACGGTATTATGAGGTCATACATACCCCAGTGGATATTTATGTTGCTATGGAGGGGTGGATGAACGAGCTGCTCGTTAAGCTCGTGCTCATTAAGACTCGGGTCGTTAAGCTTAACGAGCAAAAATCCCTCCTA SEQ ID NO.20: SEQ ID NO.21: SEQ ID NO.22: SEQ ID NO.23: TTTCCCAGTCACGACGTTGT SEQ ID NO. 24: ATCTCTAGAGAGGGGCACGA.

[0031] Furthermore, any equivalent changes and modifications made based on the core concept of this invention should be covered within the scope of the claims of this invention. The technical features in the various embodiments of this invention can be combined with each other to form new technical solutions, provided there are no structural or logical conflicts. These implementation schemes based on feature combinations are all considered to be the content explicitly disclosed in this invention. The overall technical solutions of different embodiments can also be integrated and adjusted according to actual needs.

Claims

1. A targeted wheat TaSnRK1α CRISPR / Cas9 gene editing vectors for genes, characterized in that, The vector uses pBUE414 as its backbone and contains a Cas9 expression cassette and an sgRNA expression cassette. The Cas9 expression cassette is the expression cassette for Cas9 expression regulated by the Ubi promoter, and the sgRNA expression cassette includes the following elements from upstream to downstream: TaU3 promoter, TaSnRK1α sgRNA1, terminator OsU3t, TaU3 promoter, TaSnRK1α sgRNA2, terminator TaU3t, wherein TaSnRK1α The sequence of sgRNA1 is shown in SEQ ID NO.

1. TaSnRK1α The sequence of sgRNA2 is shown in SEQ ID NO.

2.

2. The application of the gene editing vector according to claim 1 in reducing the high molecular weight glutenin content of wheat.

3. A method for preparing wheat with reduced high molecular weight glutenin content, characterized in that, Including the use of the CRISPR / Cas9 gene editing vector described in claim 1 to knock out wheat TaSnRK1α The steps of gene generation.

4. The method for constructing the gene editing vector according to claim 1, characterized in that, Includes the following steps: (1) Primer and target design: Design TaSnRK1α Primers were designed to amplify the target sgRNA1 and sgRNA2 of the gene and to amplify the backbone sequences of the terminator OsU3t and the promoter TaU3. The sgRNA1 and sgRNA2 sequences were respectively ligated to the 5' end of the amplification primers. The amplification primers are TaSnRK1α-gR1-F0 as shown in SEQ ID NO.3 and TaSnRK1α-gR2-R0 as shown in SEQ ID NO.

4. (2) Obtaining the target fragment: Design primers for amplifying the PCR product of step (1), and connect the BsaI restriction site sequence to the 5' end of the primers. The amplification primers are TaSnRK1α-gR1-F as shown in SEQ ID NO.5 and TaSnRK1α-gR2-R as shown in SEQ ID NO.

6. (3) The two pairs of primers TaSnRK1α-gR1-F0, TaSnRK1α-gR2-R0, TaSnRK1α-gR1-F and TaSnRK1α-gR2-R were mixed and then the terminator OsU3t and the promoter TaU3 backbone sequence were amplified to obtain the PCR product shown in SEQ ID NO.7; (4) The PCR product obtained in step (3) is mixed with restriction endonuclease BsaI, restriction endonuclease buffer, pBUE414 vector plasmid, T4 ligase and 10×NEB T4 Buffer to carry out vector digestion and ligation reaction to obtain the vector.

5. Targeted wheat TaSnRK1α The sgRNA combination of genes is characterized by, The sequences are shown as SEQ ID NO.1 and SEQ ID NO.2, respectively.