Use of a nuclear receptor target gene in preparation of a biological agent for blocking activation of diapause larvae

Abstract

The application discloses an application of a nuclear receptor target gene in preparation of a biological preparation for blocking activation of diapause larvae, and relates to the field of biotechnology and parasite prevention and control. According to two nuclear receptor targets of Haemonchus contortus HCON_00101910 (regulating activity of worms) and HCON_00023750 (regulating development of larvae), the two nuclear receptor targets are combined with host progesterone and estradiol and are activated, constitute a key signal path in the spring activation process of diapause larvae, and have no homologous genes in mammals, and the safety is excellent. By constructing specific shRNA lentivirus vectors (the silencing efficiency is all greater than or equal to 60%) targeting the two genes, single target or double target synergistic intervention is realized, and the activity-development double key links of worms in the host body can be specifically blocked. The application provides a new paradigm of preventive prevention and control with high specificity and green safety, and provides core technical support for solving the seasonal epidemic problem of blood fluke disease.

Description

Technical Field

[0001] This invention relates to the field of parasite control, and more particularly to the application of a nuclear receptor target gene in the preparation of a biological agent that blocks the activation of diapause larvae. Background Technology

[0002] Parasitic diseases are one of the most serious challenges facing the global livestock industry, causing economic losses of up to billions of dollars annually. These diseases not only directly lead to animal death, but more commonly cause subclinical infections, resulting in reduced feed conversion rates, stunted growth, decreased milk production and fur quality, and impaired reproductive capacity, thus severely eroding the economic benefits of the livestock industry. Among many parasites, Haemaphysema contortus is considered the most destructive pathogen due to its potent pathogenicity and wide geographical distribution. As a blood-sucking nematode, it parasitizes the abomasum of ruminants. Massive blood-sucking can cause acute anemia and mandibular edema in the host, and even lead to the death of lambs and high-producing ewes in a short period of time. Its prominent epidemiological feature of a "spring peak" (also known as the peripartum peak because it often overlaps with the peripartum period of sheep) often brings seasonal devastation to farms. The root cause of this phenomenon is that a large number of infective third-stage larvae (L3s) invade the host in the fall and hibernate in the host's body (in the abomasal mucosa) in the form of early fourth-stage larvae (L4s). When the following spring arrives and the external environment becomes suitable, these diapause larvae are simultaneously activated, rapidly maturing into adults and beginning to lay eggs in large numbers, thus creating enormous infection pressure in the pasture environment and leading to the "spring peak" phenomenon. Therefore, effectively blocking the activation of diapause larvae is key to controlling the seasonal epidemic of schistosomiasis.

[0003] Currently, the global control of Haemaphysema contortus and other major gastrointestinal nematodes relies almost entirely on chemical anthelmintics, such as benzimidazoles, macrolides, and levamisoles. Winter anthelmintics are often used to prevent the "spring / perinatal peak" of Haemaphysema infection.

[0004] To overcome this challenge, the scientific community has turned its attention to novel intervention strategies based on specific molecular targets. Among these, lentivirus-mediated RNA interference (RNAi) technology has shown great potential due to its high sequence specificity, programmability, and ability to achieve long-term, stable gene silencing. This technology integrates short hairpin RNA (shRNA) expression cassettes targeting specific genes into lentiviral vectors, which are then used to infect target cells, thereby stably integrating and continuously expressing shRNA in the host genome. These shRNA molecules are then processed into functional small interfering RNAs, guiding the RNA-induced silencing complex to precisely degrade the messenger RNA of the target gene, thus achieving long-term, efficient gene expression inhibition. Theoretically, this offers the possibility of achieving "long-term, precise strikes" against parasites at the molecular level while avoiding non-specific damage to the host. However, the core bottleneck to the successful application of this technology also lies in identifying the true "Achilles' heel"—that is, the key gene that plays a decisive role in the survival, development, invasion, or reproduction of the parasite, has no significant homology with the host gene, has a function that is difficult to replace, and is suitable for regulation through such long-term interference methods.

[0005] Nuclear receptor gene families, as ligand-activated transcription factors, play a crucial "master switch" role in regulating core life processes such as development, metabolism, reproduction, and stress response. In the model organism *Caenorhabditis elegans*, members of the nuclear receptor gene family have been shown to be widely involved in key decisions related to environmental adaptation, such as lifespan regulation and diapause formation. *Haemaphysalis contortus* possesses a large nuclear receptor gene family, suggesting its central role in adapting to the complex environment of its parasitic life history. Recently, we conducted the first genome-wide identification and functional screening of 63 nuclear receptor genes from *Haemaphysalis contortus*. This study found that HCON_00101910 and HCON_00023750 are involved in the regulation of worm activity and development in early fourth-stage larvae (L4s) of *Haemaphysalis contortus* cultured in vitro, suggesting a key role in the "diapause-activation" process of fourth-stage larvae in the host, and may be potential intervention targets for blocking the "spring peak / perinatal peak" of *Haemaphysalis contortus* disease in ruminants.

[0006] In terms of existing patented technologies, there are numerous attempts to control parasites using RNAi. For example, Chinese patent CN201410571940 (An interfering RNA for inhibiting and treating Echinococcus granulosus and its application) discloses siRNA targeting the GRP78 gene of Echinococcus granulosus, which can induce protoscolex apoptosis in vitro; CN202510962517 (A vector, kit and application for long-term gene knockdown in animal parasitic nematodes) discloses lentiviral RNAi technology for long-term silencing of parasite genes. Although these existing technologies have demonstrated the general feasibility of RNAi in the field of parasite control, they still have obvious limitations: First, most of these patents remain at the level of in vitro effects and do not involve specific technical solutions and verification data for directly administering RNAi molecules in ruminants to treat or prevent gastrointestinal nematode infections; second, these technologies cannot target the specific biological and epidemiological phenomenon of the "spring peak" of Haemaphysalis nematode disease, and they have not revealed the technical path of dual-target synergistic regulation of diapause activation.

[0007] In summary, a clear gap exists in the existing technology: while HCON_00101910 and HCON_00023750 are known to be important for the activity and development of Haemonchus contortus larvae in vitro, and RNAi technology is known to be used to control other parasites, the existing technology completely lacks the crucial link from "in vitro target" to "in vivo therapy." Furthermore, it fails to disclose the ligand binding mechanism of HCON_00023750 with estradiol, its developmental regulatory function, and its in vivo intervention effects, nor does it reveal a technical solution for the synergistic blocking of "diapause-activation" by the two targets. Specifically, the existing technology completely fails to reveal any molecular targets that can be used to intervene in the specific epidemiological phenomenon of "spring peak / perinatal peak," and it provides no technical solution for blocking the infection peak by regulating diapause-activation. This invention aims to fill this critical gap from basic discovery to application development.

[0008] The main drawbacks of current mainstream antiparasitic regimens and related research lie in drug resistance and target conservation. Furthermore, none of them have provided effective solutions for the specific epidemiological phenomena of "activation of diapause stage IV" and "spring peak / perinatal peak" of schistosomiasis.

[0009] Although "winter deworming" is often used to prevent the large-scale activation of diapause larvae in spring, deworming drugs have limited effect on diapause (resistant phenotype) larvae and cannot fundamentally block their synchronous activation in spring or perinatal period, thus making it difficult to effectively curb the occurrence of "spring peak / perinatal peak".

[0010] Currently available patents or solutions for controlling parasites using RNAi technology (such as those targeting the GRP78 gene of *Echinococcus granulosus*) face risks related to target conservation and safety. Some disclosed targets are relatively conserved in sequence and function with homologous genes in the host, posing potential off-target risks and unpredictable side effects to the host, thus limiting their application safety. Furthermore, these existing RNAi technologies do not involve the regulation of parasite diapause; their application targets remain traditionally insecticidal or oviposition-inhibiting methods, failing to meet the strategic needs of seasonal control. The purpose of this invention is to provide a small-molecule intervention strategy based on the HCON_00101910 and HCON_00023750 genes. These genes do not have homologous genes in mammals and can specifically address the need for defense against seasonal infections. By targeting and regulating the HCON_00101910 and HCON_00023750 genes, as well as the signaling cascade related to activity and developmental processes in *Haemaphysalis contortus*, this approach specifically interferes with the developmental capacity of the worm within the host animal, blocking its transformation from diapause to mature adulthood. This provides a green and innovative biotechnology solution that can curb the activation of diapause larvae at the source. This strategy does not rely on chemical anthelmintics, avoiding the risks of drug resistance and toxicity. It is characterized by high specificity, safety, and environmental friendliness, being harmless to livestock, poultry, and humans. It aligns with green ecological principles and provides a green and innovative biotechnology solution for the control of *Haemaphysalis contortus* disease during its spring / perinatal peak. Summary of the Invention

[0011] The purpose of this invention is to address the shortcomings of existing technologies by proposing the application of nuclear receptor target genes in the preparation of biological agents that block the activation of diapause larvae. Based on the fundamental defects of existing antiparasitic technologies, this invention provides a novel solution, specifically addressing the following key technical issues:

[0012] This research aims to address the issues of drug resistance and environmental residues in chemical anthelmintics by providing a novel antiparasitic strategy that does not rely on traditional chemical drugs. This strategy fundamentally avoids cross-resistance with existing drugs and eliminates the risks posed by drug residues to animal product safety and the ecological environment.

[0013] To overcome the safety risks posed by the conservatism of existing RNAi technologies, this study provides a highly specific intervention approach that is homologous to mammalian hosts. By specifically targeting the HCON_00101910 and HCON_00023750 genes, which exist only in parasites, the study completely eliminates potential off-target effects and accidental harm to the host caused by target conservatism, ensuring the safety of the intervention.

[0014] A precise regulatory strategy based on specific signaling pathways was established, providing an intervention process targeting the unique signaling cascade of "HCON_00101910 / HCON_00023750 genes, activity development, and diapause larval activation" in Haemonchus contortus. By disrupting this signaling pathway, the activity of the parasite and its ability to invade the host were specifically inhibited, achieving a control effect of blocking its parasitic process at its source.

[0015] We provide a source control program targeting the "spring peak / perinatal peak" of schistosomiasis. By intervening in the HCON_00101910 / HCON_00023750 gene interaction network, we force the parasite to remain in a diapause state or lose its ability to reactivate in spring. This effectively reduces the number of adult worms and the peak of egg release in the following spring at the epidemiological level, fundamentally reducing the risk of an outbreak.

[0016] This invention provides a green, safe, and environmentally compatible biotechnology solution for parasite control. This solution is harmless to livestock, humans, and the ecological environment, and meets the requirements of sustainable development in modern animal husbandry and the concept of green ecology.

[0017] The objective of this invention is achieved through the following technical solution: Firstly, this invention provides the application of a nuclear receptor target gene in the preparation of a biological agent that blocks the activation of diapause larvae. The target gene is the *Haemaphysalis* HCON_00101910 gene and / or the HCON_00023750 gene. A single-target intervention agent or a dual-target synergistic intervention agent is prepared using the target gene as the target. Silencing HCON_00101910 can significantly inhibit the activity of the parasite. Specifically, silencing the HCON_00101910 gene can significantly inhibit the activity of the parasite, and silencing the HCON_00023750 gene can significantly block the larval development process, making them key targets with equal potential.

[0018] Furthermore, the HCON_00101910 gene can specifically bind to progesterone (binding energy -49 kcal / mol), and progesterone, as a ligand of the HCON_00101910 gene, activates the gene expression and significantly enhances parasite activity; the HCON_00023750 gene can specifically bind to estradiol (binding energy -36.17 kcal / mol), and estradiol, as a ligand of the HCON_00023750 gene, activates the gene expression and significantly promotes larval development.

[0019] Furthermore, the biological agent contains a progesterone synthesis inhibitor or an anti-progesterone neutralizing antibody, which reduces the effective concentration of progesterone in the host or in the microenvironment surrounding the parasite, and indirectly inhibits the activation of the HCON_00101910 signaling pathway.

[0020] Furthermore, the biological agent contains an estradiol synthesis inhibitor, an estradiol competitive antagonist, or an anti-estradiol neutralizing antibody, which reduces the effective concentration of estradiol in the host or the microenvironment surrounding the parasite, and indirectly inhibits the activation of the HCON_00023750 signaling pathway.

[0021] Furthermore, the downstream target gene network directly regulated by the nuclear receptor target genes (HCON_00101910 and / or HCON_00023750) was identified using ChIP-seq technology. The biological agent contains a lentivirus-mediated gene silencing agent of key effector genes in this network for RNAi targeted intervention, mimicking the functional phenotype of interfering with the target genes (such as disrupting the developmental cycle or inhibiting larval development rate). For example, the downstream target gene network directly regulated by HCON_00101910 has been successfully identified using ChIP-seq technology, and RNAi intervention targeting its key genes has been verified to effectively mimic the phenotype of HCON_00101910 silencing.

[0022] Furthermore, the biological agent, by intervening in parasite activity-related proteins or development-related proteins, enables the parasite to maintain a diapause state within the host, thereby blocking the spring / perinatal peak of schistosomiasis.

[0023] Furthermore, the biological agent is a lentivirus-mediated gene silencing agent.

[0024] Furthermore, the specific process by which nuclear receptor target genes block the activation of diapause larvae is as follows:

[0025] (1) Based on the mRNA sequences of the HCON_00101910 and / or HCON_00023750 genes of Haemaphysalis contortus, tool molecules that specifically target and effectively silence the expression of these genes were screened.

[0026] (2) The specific gene silencing tools selected in step (1) are constructed into a lentiviral expression vector to obtain a recombinant lentiviral transfer vector that can efficiently and stably express the gene silencing tools.

[0027] (3) High-titer recombinant lentivirus particles are produced by packaging the recombinant lentivirus vector obtained in step (2), and the virus particles are introduced into the fourth stage (L4) larvae of Haemaphysema contortus through lentivirus transduction technology, so that the gene silencing tool is stably integrated and expressed for a long time, thereby achieving specific and long-term silencing of the target gene (HCON_00101910 or HCON_00023750), ultimately inhibiting the parasite's activity, blocking its development process, and reducing the source of parasites during the spring / perinatal period peak.

[0028] Furthermore, the gene silencing tool is selected from shRNA, siRNA, dsRNA, antisense oligonucleotides (ASO), or CRISPR interference molecules, targeting the promoter or coding region of the target gene to inhibit gene transcription or expression; wherein, the shRNA sequence targeting the HCON_00101910 gene is shown in SEQ ID NO.1: GTTTCTTCATGCAAGAGTACTCGAGTACTCTTGCATGAAGAAACTTTTT (silencing efficiency ≥60% verified in vitro);

[0029] The shRNA sequence targeting the HCON_00023750 gene is shown in SEQ ID NO.2: GATCCGAGACTGTATAATTGACAATTCAAGAGATTGTCAATTATACAGTCTCTTTTTT (silencing efficiency ≥60% as verified in vitro).

[0030] Further, in step (2), the gene silencing tool is cloned into a lentiviral transfer plasmid containing the U6 promoter, and a marker plasmid expressing green fluorescent protein GFP is constructed for transduction efficiency monitoring.

[0031] Further, in step (3), the lentivirus packaging system is a three-plasmid system, including a transfer plasmid, a packaging plasmid psPAX2, and an envelope plasmid pMD2.G, which are packaged in HEK-293T cells; the viral supernatant is concentrated by ultracentrifugation, and the viral titer is determined by qPCR, ultimately obtaining a titer of not less than 1×10⁻⁶. 8 Recombinant lentiviral particles with a concentration of TU / mL.

[0032] Furthermore, a dual-target synergistic intervention approach is adopted, simultaneously targeting the HCON_00101910 and HCON_00023750 genes to achieve a synergistic effect of activity inhibition combined with developmental blocking, thereby more thoroughly blocking the parasite's developmental pathway and enhancing the control effect.

[0033] Furthermore, the dual-target synergistic intervention formulation showed significantly better control effects than the single-target formulation, reducing fecal egg count (EPG) by more than 90% and increasing the proportion of diapause larvae to more than four times that of the control group.

[0034] The beneficial effects of this invention: This invention provides a biotechnological solution that specifically blocks the activity and infection process of *Haemaphysalis contortus* without relying on traditional chemical anthelmintics. The core innovation lies in the first-ever revelation of a dual-target synergistic regulatory mechanism: two key signaling pathways in *Haemaphysalis contortus*, namely "progesterone-HCON_00101910-activity" and "estradiol-HCON_00023750-development rate," are utilized. By employing shRNA interference technology targeting these two genes, highly efficient synergistic intervention on parasite vitality and development is achieved in vitro, while simultaneously exhibiting a highly effective cessation effect on parasite diapause in the host, demonstrating high targeting and biosafety. This lays a crucial theoretical foundation and points to a clear direction for developing next-generation, highly efficient joint control strategies.

[0035] Specifically, the present invention has the following outstanding advantages:

[0036] With dual-target synergy and complementary mechanisms of action, this invention discloses for the first time the synergistic effect of HCON_00101910 (regulating activity) and HCON_00023750 (regulating development rate). The two targets two key links in the parasite's "diapause-activation" process, and the combined intervention can form a dual barrier of "activity inhibition + development blockade". The control effect is significantly better than that of a single target (EPG reduction rate increased from 70% of the single target to 90% of the dual targets, and the proportion of diapause larvae increased from 2 times to 4 times).

[0037] With a novel mechanism of action, this invention completely avoids cross-resistance. Unlike existing chemical anthelmintics that target conservative targets such as the neuromuscular system, this invention uses a dual target of nuclear receptors as its core. Its mechanism of action is different from all commercially available drugs, which can fundamentally avoid the generation of cross-resistance and provide a new path to solve the drug resistance problem.

[0038] With highly specific targets and excellent safety, the HCON_00101910 and HCON_00023750 targets of this invention have no homologous genes in mammals (including ruminants such as sheep) (evolutionary analysis confirms that they only bind to the receptor binding domain of the receptor gene in humans and sheep), fundamentally eliminating the off-target risk and potential toxic side effects to the host caused by target conservation. Its safety is far superior to existing RNAi protocols targeting conserved genes such as GRP78.

[0039] The intervention is precise and has both therapeutic and preventative potential. By specifically interfering with two targets in vitro, it can achieve multiple prevention and control effects simultaneously.

[0040] It effectively inhibits reproduction. In animal infection models, dual-target intervention reduced the peak fecal egg count (EPG) of parasites by about 90%, effectively cutting off the transmission chain in the environment.

[0041] By precisely regulating development and blocking the peak at its source, this invention, through synergistic intervention targeting two points, significantly increases the proportion of diapause larvae in the abomasum to more than four times that of the control group, while significantly reducing the proportion of mature adults. This demonstrates that the invention can "lock" parasites into a non-pathogenic, non-reproductive dormant state, thereby reducing the number of worms that can mature and lay eggs the following spring, achieving preventative blocking of the "spring peak / perinatal peak."

[0042] By blocking the spring peak at its source, this invention offers a new paradigm for seasonal disease control. Unlike existing technologies that only treat after an outbreak, this invention targets the root cause of schistosomiasis outbreaks—the "spring peak / perinatal peak." Through synergistic intervention targeting two targets, it allows for early intervention during the infection season, preventing invading larvae from activating in spring. This significantly reduces the peak number of eggs and the risk of outbreaks in spring. This represents a paradigm shift from "passive treatment" to "proactive prevention and source control," providing an unprecedented technological means to solve this seasonal challenge.

[0043] With clearly defined signaling pathways, this invention provides new targets for combined interventions. It not only identified dual-target genes but also confirmed, through Schrödinger molecular docking (HCON_00101910 binds to progesterone at -49 kcal / mol, HCON_00023750 binds to estradiol at -36.17 kcal / mol) and functional experiments, that progesterone and estradiol are their natural activating ligands. Furthermore, its downstream regulatory networks were mapped using ChIP-seq / transcriptome sequencing. This lays a solid theoretical foundation for developing diversified intervention strategies, such as small molecule inhibitors and antibody drugs targeting both pathways.

[0044] Environmentally friendly and in line with green ecological requirements, the core component of this solution is RNA interference molecules, which can be naturally degraded in the environment without the risk of chemical drug residues or pollution, meeting the urgent needs of modern animal husbandry for green and safe prevention and control technologies. Attached Figure Description

[0045] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0046] Figure 1 This is a schematic diagram illustrating the evolutionary conservation of HCON_00101910 with progesterone-binding protein (PGR) and / HCON_00023750 with estrogen-binding protein (ER).

[0047] Figure 2 These are schematic diagrams showing the docking and binding energy between HCON_00101910 and progesterone molecules, and the docking and binding energy between HCON_00023750 and estradiol molecules.

[0048] Figure 3 The diagrams show the results of adding progesterone to HCON_00101910 via qPCR and the resulting parasite viability, and the results of adding estradiol to HCON_00023750 via qPCR and the resulting parasite development rate.

[0049] Figure 4 This is a schematic diagram of HCON_00101910 chromatin immunoprecipitation and downstream pathway enrichment after transcriptome sequencing.

[0050] Figure 5 It is the interference effect of HCON_00101910 and HCON_00023750.

[0051] Figure 6 This is a schematic diagram showing the number of eggs per gram of feces infecting the host after shRNA interference with HCON_00101910 and combined interference with two targets.

[0052] Figure 7 This is a schematic diagram showing a significant increase in the proportion of diapause larvae of Haemaphysalis contortus after targeted interference with HCON_00101910 and combined interference with two targets. Detailed Implementation

[0053] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described below with reference to the accompanying drawings and examples. It should be understood that the specific examples described herein are merely illustrative and not intended to limit the invention.

[0054] The core of this invention lies in providing two highly specific and functionally complementary nuclear receptor targets—HCON_00101910 and HCON_00023750—to block the diapause activation and spring climax of *Haemaphysalis contortus*. HCON_00101910 primarily regulates the parasite's "motility," with progesterone as its ligand; HCON_00023750 primarily regulates the parasite's "development rate," with estradiol as its ligand. Research targeting these two targets follows the same technical paradigm: 1) Bioinformatics and evolutionary analysis confirm target specificity; 2) Molecular docking and ligand addition experiments verify ligand-receptor interactions and functions; 3) Gene silencing tools are constructed to verify loss of function; 4) Animal infection models are used to assess the control effect. The specific research pathways and data for these two targets, as well as the verification results of the synergistic effect of the two targets, will be described below.

[0055] 1. Discovery, mechanism and validation of target HCON_00101910

[0056] like Figure 1 As shown, this invention provides a nuclear receptor target, intervention measures, and their application for blocking the activation of diapause larvae and the spring peak of Haemonchus nematode disease. The core of this invention lies in providing a specific intervention strategy based on the HCON_00101910 gene, a nuclear receptor that regulates the activity of larvae during the parasitic stage of Haemonchus contortus, aiming to block the activation of diapause larvae and the spring peak of Haemonchus nematode disease at its source. The core concept of this strategy is to reduce larval activity by using interventions targeting the HCON_00101910 gene during the infection season (e.g., autumn), thereby reducing their ability to establish infection and their ability to activate after diapause, thus significantly reducing the number of adult worms and the peak of egg release in spring or during the perinatal period, fundamentally blocking the formation of the spring peak. To achieve the above objectives, the specific technical solution of this invention is carried out through the following steps:

[0057] First, based on the systematic identification of the Haemonchus contortus nuclear receptor family, this invention discovered that the key member, the HCON_00101910 gene, is transcribed at high levels primarily in infective and parasitic larvae. By specifically knocking down the expression of the HCON_00101910 gene using lentivirus-mediated RNA interference, the activity of larvae in the treated group was significantly reduced compared to the control group. This result is the first to confirm the crucial role of HCON_00101910 in regulating the vitality of Haemonchus contortus, suggesting its potential involvement in regulating developmental state transitions closely related to vitality, such as the maintenance and release of diapause, thus establishing it as an ideal intervention target.

[0058] Secondly, after clarifying the target function, this invention conducted a phylogenetic analysis of HCON_00101910's sequence to explore its evolutionary conservation among different parasites. HCON_00101910 gene sequences from various representative nematodes and other parasites were obtained from the public database (Wormbase), and a phylogenetic tree was constructed using the neighbor-joining method with MEGA software. The analysis results showed that *Haemaphysalis contortus* HCON_00101910 is distantly related to known NHR members of free-living nematodes (such as *C. elegans*) on the phylogenetic tree, forming a branch mainly composed of homologous sequences from parasitic nematodes. More importantly, no direct homologs of this gene were found in mammalian hosts. This finding, from an evolutionary perspective, confirms the high specificity and safety of HCON_00101910 as a drug target and suggests that its intervention strategy may also have potential utility for other closely related parasitic nematodes. Figure 1 ).

[0059] Based on this, the present invention further explored its upstream regulatory mechanism. Using the Schrödinger small molecule docking software, three-dimensional prediction of the HCON_00101910 protein from *Haemaphysalis contortus* was performed using AlphaFold 3. The interaction between vitamin D and its receptor binding site was simulated, and a compound library including vitamin D was screened. The docking results showed that the HCON_00101910 protein has a high affinity for progesterone (Compound CID: 5994) (binding energy -49 kcal / mol), indicating that progesterone can bind to the HCON_00101910 protein with high affinity. Figure 2 This further reveals that parasites may regulate the activity of diapause larvae by sensing endogenous hormone signals (progesterone) in the host, playing a role in the activation of diapause larvae and the spring / perinatal peak.

[0060] Based on this, a progesterone addition experiment was designed. Fourth-stage larvae cultured in vitro were treated with 4 μg / ml progesterone. Compared with the control group, the expression level of the HCON_00101910 gene in *Haemaphysema contortus* treated with progesterone was detected using qPCR. The results showed that the HCON_00101910 gene was significantly upregulated after progesterone addition, confirming that small progesterone molecules can activate the expression of the HCON_00101910 gene. Subsequently, the movement trajectories of the fourth-stage larvae and the experimental group larvae were recorded using a microscopic imaging system (WMicrotracker), and their movement ability was quantitatively analyzed. The results showed that the larval activity was significantly increased after progesterone addition, indicating that small progesterone molecules can activate the expression of the HCON_00101910 gene and regulate the activity of *Haemaphysema contortus*. This means that the progesterone-HCON_00101910 activation pathway plays an important role in the "spring climax" phenomenon.

[0061] Next, to elucidate the downstream mechanism of action of HCON_00101910, *Haemaphysalis contortus* larvae were obtained and successfully cultured in vitro to the fourth larval stage. After 24 hours of culture with 4 μg / ml progesterone, chromatin immunoprecipitation sequencing (ChIP-seq) was performed. Genomic DNA fragments binding to the HCON_00101910 protein were enriched with specific antibodies, and high-throughput sequencing and bioinformatics analysis were used to map the genome-wide downstream target genes directly regulated by HCON_00101910. This map reveals how HCON_00101910 affects the parasite's activity and developmental process by regulating a specific set of genes, fully elucidating its potential core role in the diapause-activation transition. Figure 4 ).

[0062] Finally, to investigate the potential blocking ability of this invention against the spring climax of *Haemaphysema contortus*, sheep were randomly divided into an experimental group (inoculated with shRNA molecules targeting HCON_00101910, four biological replicates) and a control group (inoculated with a blank sequence, four biological replicates), and then artificially infected with *Haemaphysema contortus* larvae. Fecal samples were then collected regularly, and the number of eggs per gram of feces (EPG) was counted. The results showed that the EPG value in the experimental group was significantly lower than that in the control group, demonstrating that intervention with HCON_00101910 can effectively inhibit the reproductive capacity of the parasite. Figure 6 More importantly, on day 35 post-infection (a critical period simulating the transition from overwintering to spring), the abomasum of sheep was dissected to count and analyze adult worms and diapause larvae. The experimental group showed a significantly higher proportion of diapause larvae than the control group, while the proportion of mature adults was significantly lower. This indicates that interfering with HCON_00101910 not only reduces oviposition but, more importantly, disrupts the parasite's normal developmental cycle, "locking" most worms in diapause, thus reducing the number of diapause larvae activated in spring and during the peripartum period at the source. Figure 7 ).

[0063] 2. Discovery, mechanism and validation of target HCON_00023750

[0064] First, to clarify the target specificity of HCON_00023750, the gene sequence of *Haemaphysalis contortus* HCON_00023750, as well as estrogen receptor (ER) homologous gene sequences from humans, sheep, and *C. elegans*, were obtained from public databases (Wormbase, NCBI). A phylogenetic tree was constructed using MEGA 11 software with a neighbor-joining method (bootstrapping test 1000 times). The results showed ( Figure 1 HCON_00023750 forms an independent branch with mammalian ER (human ER, sheep ER) on the phylogenetic tree, indicating a distant phylogenetic relationship. However, its clustering with homologous nuclear receptor genes of other parasitic nematodes confirms that it has no direct homologs in mammalian hosts, ensuring the safety of intervention.

[0065] Secondly, the three-dimensional structure of the ligand-binding domain of the HCON_00023750 protein was predicted using AlphaFold 3, and preprocessed using Schrödinger Maestro software (hydrogenation and energy minimization). The 3D structure of estradiol (CID: 5757) was obtained from the PubChem database, optimized using the LigPrep module, and then molecular docking calculations were performed using the Glide module. The results showed ( Figure 2Estradiol forms a stable interaction with the ligand binding pocket of HCON_00023750, with a binding free energy of -36.17 kcal / mol, indicating a high affinity between the two and suggesting that estradiol is a potential ligand for HCON_00023750.

[0066] Next, to verify the above-mentioned interaction function, an estradiol addition experiment was designed. L4 stage larvae cultured in vitro (culture method as in Example 1) were divided into two groups: a blank control group (containing only culture medium) and an estradiol treatment group (final concentration of 100 pg / mL estradiol, consistent with the concentration in pregnant sheep, making the experiment more closely resemble the physiological state of sheep). They were cultured at 38℃ and 10% (v / v) CO2 for 48 hours. The mRNA expression level of HCON_00023750 was detected by qPCR. The results showed that the gene expression level in the estradiol treatment group was significantly upregulated compared to the control group (upregulated 2.3 times). Simultaneously, the larval development status was observed under a stereomicroscope, and the proportion developing to the late L4 stage (development rate) was statistically analyzed. The results showed that… Figure 3 The development rate of the estradiol-treated group reached 78%, which was significantly higher than that of the control group (51%), confirming that estradiol can promote larval development by activating HCON_00023750.

[0067] Based on the mRNA sequence of HCON_00023750, an shRNA sequence (GATCCGAGACTGTATAATTGACAATTCAAGAGATTGTCAATTATACAGTCTCTTTTTT) was designed, cloned into the pLKO.1 lentiviral vector, and packaged into recombinant lentivirus (titer ≥ 1 × 10⁻⁶). 8 TU / mL). L4 stage larvae were divided into a blank control group and an shRNA treatment group. After transduction at MOI=50, they were cultured for 96 hours, and the silencing efficiency was detected by qPCR. The results showed that the sequence silencing efficiency reached 60% (TU / mL). Figure 5 ).

[0068] 3. Animal experimental validation of synergistic intervention targeting two targets

[0069] Twenty-four healthy lambs were randomly divided into four groups (n=6): Group A: Blank control group (uninfected); Group B: Infected control group (infected with 8000 untreated L3 larvae); Group C: Single-target intervention group (infected with 8000 L3 larvae treated with HCON_00101910-shRNA lentivirus); Group D: Dual-target intervention group (infected with 8000 L3 larvae treated with HCON_00101910-shRNA + HCON_00023750-shRNA dual-target lentivirus). Fecal samples were collected periodically after infection for EPG counting. Dissection was performed on day 35 post-infection to determine the total number of abomasal parasites and the proportion of diapause larvae. The results (Figure 6) showed that on day 21 post-infection (peak oviposition), the mean EPG value was 5587 in group B, 1657 in group C (a 70% decrease), and 443 in group D (a 90% decrease), confirming that the synergistic intervention targeting both groups significantly inhibited parasite reproduction more effectively than the single-target intervention. Dissection results (Figure 7) showed that the proportion of diapause larvae in the abomasum was 3% in group B, 6.3% in group C (a 2-fold increase), and 12.4% in group D (a 4-fold increase). Simultaneously, the number of adult worms in group D was significantly lower than in group C, confirming that the synergistic intervention targeting both groups more effectively locked larvae in diapause, preventing their development into adults.

[0070] Example 1: Molecular docking and functional verification of progesterone with HCON_00101910

[0071] (1) Molecular docking

[0072] The 3D structure of the ligand-binding domain of the *Haemaphysalis contortus* HCON_00101910 protein was predicted using AlphaFold 3. Preprocessing of the protein, including hydrogenation, hydrogen bond optimization, and energy minimization, was performed using the Protein Preparation Wizard module in Schrödinger Maestro software. The 3D structure of progesterone (CID: 5994) was obtained from the PubChem database, and force field allocation and energy optimization were performed using the LigPrep module. Finally, molecular docking calculations were performed using the Glide module. The results showed that the binding free energy between progesterone and HCON_00101910 was -49 kcal / mol, indicating a high affinity between the two. The docking results are visualized as follows: Figure 2 As shown.

[0073] Example 2: Construction and in vitro validation of shRNA lentiviral vector

[0074] (1) shRNA design and lentiviral vector construction

[0075] Based on the mRNA sequence of the *Haemaphysalis contortus* HCON_00101910 gene, short hairpin RNA (shRNA) sequences specifically targeting HCON_00101910 were designed and screened (as shown in SEQ ID NO.1: GTTTCTTCATGCAAGAGTACTCGAGTACTCTTGCATGAAGAAACTTTTT). ShRNA sequences targeting HCON_00023750 were also developed (as shown in SEQ ID NO.2: GATCCGAGACTGTATAATTGACAATTCAAGAGATTGTCAATTATACAGTCTCTTTTTT). The optimized shRNA sequences were cloned into a lentiviral transfer plasmid (pLKO.1) containing the U6 promoter, and a marker plasmid expressing green fluorescent protein (GFP) was constructed for transduction efficiency monitoring. Lentiviral packaging was performed in HEK-293T cells using a three-plasmid system (containing a packaging plasmid (psPAX2), an envelope plasmid (pMD2.G), and a transfer plasmid (pLKO.1)). After ultracentrifugation and concentration of the viral supernatant, the viral titer was determined using qPCR, ultimately obtaining a titer of not less than 1×10⁻⁶. 8 Recombinant lentiviral particles at TU / mL were prepared. A lentivirus carrying a blank sequence was also constructed as a negative control.

[0076] (2) Parasite culture and lentivirus transduction

[0077] To obtain the larvae required for the experiment, third-stage (L3) larvae of *Haemaphysalis contortus* were first collected and treated with a 0.5 g / L sodium hypochlorite solution. The larvae were suspended in this solution and incubated in a 37°C constant-temperature shaker at 200 rpm for 20 minutes to induce sheath detachment. After incubation, samples were taken and the detachment efficiency was assessed under an optical microscope. Once 80% to 90% of the larvae had completed detachment, they were immediately purified by centrifugation.

[0078] Centrifugation was performed at 1000 × g for 5 minutes. After centrifugation, the centrifuge tube was carefully removed, approximately 1 mL of supernatant was discarded, and the larvae were resuspended in an equal volume of physiological saline. This washing step was repeated three times. The supernatant was then removed, and 1 mL of DMEM complete medium containing 1% (v / v) antibiotic (penicillin-streptomycin) was added to the precipitate to resuspend the larvae. The resuspended larvae were then allowed to stand at room temperature for 30 minutes to allow the larvae to recover physiologically. To obtain sterile larvae suitable for in vitro culture, the larvae were washed 1-3 times with appropriate sterile medium (e.g., M-199 medium) according to subsequent culture requirements, resulting in L3-stage larvae that had undergone desheathing and sterilization. To obtain L4-stage larvae, the treated L3-stage larvae were transferred to 24-well plates containing 500 μL of M-199 complete medium (Sigma, USA) and cultured at 39°C in an incubator containing 20% ​​CO2. During the culture period, the culture medium was changed every 24-48 hours, and the larvae were cultured for 4 days until they reached the L4 stage. Subsequently, the L4 larvae were resuspended in culture medium containing 5 μg / mL Polybrene transfection reagent, and recombinant lentivirus solutions were added to each group (groups: blank group, NC shRNA group, HCON_00101910-shRNA group, HCON_00023750-shRNA group, and dual-target group), with the multiplicity of infection (MOI) set at 50. After transduction at 38℃ and 10% (v / v) CO2 for 12 hours, the culture medium was replaced with fresh medium, and the culture was continued for 96 hours. The interference efficiency was verified by qPCR.

[0079] (3) RNA extraction and qPCR verification

[0080] Total RNA was extracted from each group of worms using the TRIzol method. The specific steps were as follows: Collect the treated worms from each group, add 1 mL of TRIzol reagent, and lyse the cells thoroughly by vortexing. Then add 0.2 mL of chloroform, shake vigorously for 15 seconds, incubate at room temperature for 5 minutes, and centrifuge at 12000 × g for 15 minutes at 4°C. Carefully aspirate the supernatant and transfer it to a new centrifuge tube. Add an equal volume of isopropanol to precipitate the RNA, incubate at -20°C for 1 hour, and then centrifuge again at 12000 × g for 15 minutes at 4°C to collect the RNA precipitate. Wash the precipitate twice with 75% (v / v) ethanol, air-dry, and finally dissolve the RNA in an appropriate amount of RNase-free water. The RNA concentration and purity were measured using a micro-spectrophotometer to ensure that the A260 / A280 ratio was between 1.8 and 2.0, meeting the experimental requirements.

[0081] Take 1 μg of total RNA and perform reverse transcription using the PrimeScript RT kit. The reaction volume is 20 μL, containing 4 μL of 5× PrimeScript Buffer, 1 μL of RT Primer Mix, 1 μg of RNA template, and an appropriate amount of RNase-free water. The reaction conditions are: 37℃ for 15 minutes, 85℃ for 5 seconds. The obtained cDNA is stored at -20℃ for later use.

[0082] Real-time quantitative PCR was performed using the SYBR Green fluorescent dye method, with *Haemaphysalis contortus* 18S rRNA as an internal reference gene. The reaction volume was 20 μL, containing 10 μL SYBR Premix Ex Taq II, 0.8 μL upstream primer (10 μM), 0.8 μL downstream primer (10 μM), 2 μL cDNA template, and 6.4 μL RNase-free water. The reaction was performed on a real-time quantitative PCR instrument with the following program: 95℃ pre-denaturation for 30 seconds; followed by 40 cycles of 95℃ denaturation for 5 seconds and 60℃ annealing / extension for 30 seconds; finally, melting curve analysis was performed to verify amplification specificity.

[0083] Each sample was configured with 3 technical replicates, using 2^ (-ΔΔCt) The relative expression levels of genes were calculated using a method similar to that used in GraphPadPrism 9.0 software, and the graphs were plotted. The results are as follows: Figure 5 As shown, the target gene silencing efficiency of the HCON_00101910-shRNA group was 55%, and that of the HCON_00023750-shRNA group was 60%, both achieving effective silencing.

[0084] Example 3: Animal infection experiment to verify the intervention effect

[0085] (1) Parasite pretreatment and animal infection

[0086] Twenty-four healthy lambs were randomly divided into four groups (n=6): Group A (blank control, no infection), Group B (control group, untreated and infected with parasites), Group C (single-target treatment group, infected with parasites), and Group D (dual-target treatment group, infected with parasites). Each lamb was orally infected with 8,000 corresponding larvae. This experimental design aimed to simulate the natural process of autumn infection, overwintering, and spring development to evaluate the effectiveness of single-target and dual-target interventions in disrupting this cycle and inhibiting the spring surge.

[0087] (2) Fecal egg count (EPG)

[0088] Starting from day 17 post-infection (the beginning of the oviposition period), fresh feces were collected daily from sheep in each group, and fecal egg counts were performed using the McMaster counting method (dilution ratio 1:15). Data showed that group A, infected with shRNA-pretreated parasites, had significantly lower EPG values ​​than group B, the control group, throughout the monitoring period. The dynamic changes in EPG are shown below. Figure 5 As shown.

[0089] Example 4: Statistics on the load and developmental stages of true stomach parasites

[0090] (1) Dissection and collection of insect bodies

[0091] On day 35 post-infection (a timeframe simulating the end of winter and the start of the spring spawning peak), all sheep were euthanized and dissected to collect the abomasum (the fourth stomach of ruminants). The Haemonchus contortus worms were then removed using a dissecting needle and placed in DMEM medium to maintain their viability.

[0092] (2) Parasite count and diapause analysis

[0093] All parasites were collected. Parasite counts were performed under a stereomicroscope, and adults and diapause larvae (L4 stage) were distinguished based on morphological characteristics. The total number of parasites and the proportion of diapause larvae in each group were calculated. Results showed that the proportion of diapause larvae in group D (dual-target treatment group) was as high as 12%, significantly higher than 6% in group C (single-target treatment group) and significantly higher than 3% in group B (infected control group). This result demonstrates that dual-target interference can effectively disrupt the normal developmental cycle of parasites, arresting most parasites in the diapause stage at key time points. This provides direct experimental evidence for reducing the parasite source during the spring peak. Results are as follows... Figure 6 As shown in Figure 7.

[0094] The above embodiments are used to explain and illustrate the present invention, but not to limit the present invention. Any modifications and changes made to the present invention within the spirit and scope of the claims shall fall within the protection scope of the present invention.

Claims

1. The application of shRNA targeting nuclear receptor genes in the preparation of biological agents that block the activation of diapause larvae of Haemonchus contortus, characterized in that, The target genes are the HCON_00101910 and HCON_00023750 genes of *Haemaphysalis contortus*. The shRNA sequence targeting the HCON_00101910 gene is shown in SEQ ID NO.1: GTTTCTTCATGCAAGAGTACTCGAGTACTCTTGCATGAAGAAACTTTTT; the shRNA sequence targeting the HCON_00023750 gene is shown in SEQ ID NO.2: GATCCGAGACTGTATAATTGACAATTCAAGAGATTGTCAATTATACAGTCTCTTTTTT. A dual-target synergistic intervention agent was prepared using the target genes as targets. Among them, silencing the HCON_00101910 gene can significantly inhibit parasite activity, and silencing the HCON_00023750 gene can significantly block the larval development process.

2. The application of the shRNA targeting the nuclear receptor gene according to claim 1 in the preparation of a biological agent that blocks the activation of diapause larvae of Haemonchus contortus, characterized in that, The HCON_00101910 gene can specifically bind to progesterone. Progesterone acts as a ligand for the HCON_00101910 gene, activating its expression and significantly enhancing parasite activity. The HCON_00023750 gene can specifically bind to estradiol. Estradiol acts as a ligand for the HCON_00023750 gene, activating its expression and significantly promoting larval development.

3. The application of the shRNA targeting the nuclear receptor gene according to claim 2 in the preparation of a biological agent that blocks the activation of diapause larvae of Haemonchus contortus, characterized in that, The biological agent contains a progesterone synthesis inhibitor or an anti-progesterone neutralizing antibody, which reduces the effective concentration of progesterone in the host or in the microenvironment surrounding the parasite, and indirectly inhibits the activation of the HCON_00101910 signaling pathway.

4. The application of the shRNA targeting the nuclear receptor gene according to claim 2 in the preparation of a biological agent that blocks the activation of diapause larvae of Haemonchus contortus, characterized in that, The biological agent contains an estradiol synthesis inhibitor, an estradiol competitive antagonist, or an anti-estradiol neutralizing antibody, which reduces the effective concentration of estradiol in the host or the microenvironment surrounding the parasite, and indirectly inhibits the activation of the HCON_00023750 signaling pathway.

5. The application of the shRNA targeting the nuclear receptor gene according to claim 1 in the preparation of a biological agent that blocks the activation of diapause larvae of Haemonchus contortus, characterized in that, By identifying the downstream target gene network directly regulated by the HCON_00101910 gene and / or the HCON_00023750 gene, the biological agent contains a lentivirus-mediated gene silencing agent of key effector genes in this network for RNAi targeted intervention, mimicking the functional phenotype of the target genes.

6. The application of the shRNA targeting the nuclear receptor gene according to claim 1 in the preparation of a biological agent that blocks the activation of diapause larvae of Haemonchus contortus, characterized in that, The biological agent interferes with parasite activity-related proteins or development-related proteins, causing the parasite to remain in a diapause state within the host, thereby blocking the spring / perinatal peak of schistosomiasis.

7. The application of the shRNA targeting the nuclear receptor gene according to claim 1 in the preparation of a biological agent that blocks the activation of diapause larvae of Haemonchus contortus, characterized in that, The biological agent is a lentivirus-mediated gene silencing agent.

Images