Bipeptide modified bionic nano-vesicle as well as preparation method and application thereof

Abstract

The invention discloses a bipeptide modified bionic nano-vesicle as well as a preparation method and application thereof, and belongs to the field of biological medicines. The dipeptide modified bionic nano-vesicle comprises nano-particles formed by PLGA (poly (lactic-co-glycolic acid)), and the nano-particles are loaded with a medicine with a nerve protection or nerve repair effect; the surface of the nanoparticle is coated with a macrophage membrane for expressing RVG peptide and T7 peptide. The bipeptide modified bionic nano-vesicle simultaneously presents T7 peptide and RVG peptide through an engineered macrophage membrane, the T7 peptide is combined with a blood-brain barrier transferrin receptor through high affinity to realize efficient brain entry, astrocytes in the brain are specifically recognized by virtue of the RVG peptide, accurate recognition and delivery of target cells in a focus area are realized, and the bipeptide modified bionic nano-vesicle has a good application prospect. Meanwhile, the natural inflammation tropism and immune escape ability of a macrophage membrane are reserved, and the problems that a traditional drug delivery system is low in targeting precision, and cross-barrier distribution and intracerebral distribution are difficult to cooperate are solved.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to a bipeptide-modified biomimetic nanovesicle, its preparation method, and its application. Background Technology

[0002] The core challenge in effective treatment strategies for central nervous system diseases lies in the severe restriction of drug delivery to brain tissue caused by the blood-brain barrier (BBB). Conventional small-molecule drugs, due to limitations in molecular weight, lipid solubility, and other physicochemical properties, struggle to reach effective therapeutic concentrations in the brain. To overcome this challenge, nanomedicine delivery systems have become a research hotspot in recent years, primarily including synthetic nanocarriers (such as PLGA nanoparticles, gold nanoparticles, and PEGylated liposomes) and biomembrane-derived nanocarriers (such as cell membrane vesicles and exosomes). These systems, through nanosize effects and surface modification, have enhanced drug delivery potential to some extent, but their design and performance still have significant shortcomings.

[0003] Specifically, existing nanomedicine delivery systems face the following key shortcomings in their implementation: First, regarding synthetic nanocarriers, while PLGA nanoparticles exhibit good biocompatibility, they lack active targeting capabilities, resulting in low intrabrain delivery efficiency. Gold nanoparticles present significant challenges in terms of biosafety and large-scale production. PEGylated liposomes suffer from severely low targeting efficiency due to the steric hindrance of the PEG chain and the non-specific binding of targeting ligands to blood components. Second, regarding biomembrane-derived nanocarriers, while natural cell membrane vesicles (such as macrophage membrane vesicles) possess a certain inflammatory tendency, they lack the ability to specifically recognize specific brain cell types (such as astrocytes). Vesicles from other sources (such as erythrocyte membrane vesicles) often lack active targeting functionality. Furthermore, complete cell-based carrier systems (such as stem cells) present challenges such as complex preparation, high safety risks, and potential immune rejection. These shortcomings collectively lead to technical bottlenecks in existing systems, including insufficient cell-level targeting specificity, difficulty in balancing blood-brain barrier efficiency with effective intrabrain distribution, and ultimately, low drug delivery efficiency at the lesion site.

[0004] The root cause of these problems lies in the fact that existing technologies often focus on optimizing single functions (such as enhancing only BBB penetration or improving only circulation time), failing to address multiple key aspects from a system integration perspective, including effective exposure of the target ligand, efficient BBB crossing, and specific recognition of brain lesion cells. Therefore, there is an urgent need in this field for a novel drug delivery system that integrates inflammatory chemotaxis, efficient blood-brain barrier penetration, and precise cell targeting capabilities to overcome the fundamental limitations of existing technologies, such as low targeting accuracy, poor delivery efficiency, and difficulties in clinical translation. Summary of the Invention

[0005] The purpose of this invention is to provide a bipeptide-modified biomimetic nanovesicle, its preparation method, and its application, to solve the problems existing in the prior art. This invention constructs a biomimetic nanovesicle that integrates T7 peptide-mediated blood-brain barrier penetration, RVG peptide-mediated astrocyte targeting, and macrophage membrane-specific inflammatory tropism. This solves the problems of low targeting accuracy and difficulty in coordinating cross-barrier and intrabrain distribution in traditional drug delivery systems, significantly improving drug accumulation and neurorepair efficacy at brain injury sites.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a bipeptide-modified biomimetic nanovesicle, comprising nanoparticles formed from PLGA, wherein the nanoparticles are loaded with therapeutic drugs; the surface of the nanoparticles is coated with a macrophage membrane expressing RVG peptide and T7 peptide.

[0008] The amino acid sequence of the RVG peptide is shown in SEQ ID NO.1;

[0009] The amino acid sequence of the T7 peptide is shown in SEQ ID NO.2.

[0010] Optionally, the therapeutic drug is a drug with neuroprotective or neuroreparative effects.

[0011] Optionally, the drug with neuroprotective or neuroreparative effects includes ginsenoside Rg1.

[0012] This invention also provides a method for preparing the aforementioned peptide-modified biomimetic nanovesicles, comprising the following steps:

[0013] S1. Preparation of PLGA nanoparticles loaded with therapeutic drugs;

[0014] S2. Preparation of macrophage membranes expressing RVG peptide and T7 peptide;

[0015] S3. After mixing the PLGA nanoparticles obtained in step S1 with the macrophage membrane obtained in step S2, the mixture is extruded to coat the surface of the nanoparticles with the macrophage membrane, thus obtaining the dipeptide-modified biomimetic nanovesicles.

[0016] Optionally, the method for preparing the macrophage membrane expressing RVG peptide and T7 peptide includes the following steps:

[0017] A recombinant lentiviral vector containing nucleotide sequences encoding RVG peptide and T7 peptide was constructed; macrophages were transfected with the recombinant lentiviral vector to obtain engineered macrophages expressing RVG peptide and T7 peptide; cell membranes were extracted from the engineered macrophages to obtain the macrophage membranes expressing RVG peptide and T7 peptide.

[0018] Optionally, the nucleotide sequences encoding the RVG peptide and the T7 peptide are obtained by primer amplification using nucleotide sequences such as those shown in SEQ ID NO.3 and SEQ ID NO.4.

[0019] Optionally, the macrophage membrane and the PLGA nanoparticles are mixed at a mass ratio of membrane protein to nanoparticles of 2:1.

[0020] Optionally, the extrusion process uses a polycarbonate membrane with a pore size of 100 nm.

[0021] The present invention also provides the application of the aforementioned dipeptide-modified biomimetic nanovesicles in the preparation of a promoter for the transdifferentiation of reactive astrocytes into neuron-like cells.

[0022] The present invention also provides the application of the aforementioned dipeptide-modified biomimetic nanovesicles in the preparation of drugs for treating traumatic brain injury or promoting nerve repair.

[0023] The present invention discloses the following technical effects:

[0024] This invention successfully constructs a multifunctional integrated biomimetic nanomedicine delivery system, effectively solving the core challenge of existing single-functional carriers being unable to simultaneously achieve efficient blood-brain barrier penetration and precise targeting at the cellular level within the brain. This system utilizes engineered macrophage membranes to simultaneously present T7 peptides and RVG peptides. It not only leverages the high affinity of T7 peptides to bind to the transferrin receptor on the blood-brain barrier for efficient brain entry, but also utilizes RVG peptides to specifically recognize astrocytes in the brain, achieving precise identification and delivery of target cells to the lesion area. Simultaneously, it preserves the natural inflammatory tendency and immune escape capability of the macrophage membrane, thus structurally optimizing multiple key aspects of the delivery process.

[0025] The experimental results of this invention demonstrate that the dipeptide-modified biomimetic nanovesicles significantly improve drug accumulation efficiency at the site of brain injury and efficiently promote the transdifferentiation of reactive astrocytes into neuron-like cells. This invention fundamentally overcomes the technical shortcomings of existing delivery systems, such as low targeting precision, difficulty in achieving both cross-barrier efficiency and brain distribution, providing a highly efficient, precise, and potentially transformative new therapeutic strategy for central nervous system diseases, especially traumatic brain injury and other diseases requiring neural repair. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 A schematic diagram of the construction of a lentiviral vector for co-expression of RVG / T7 dual peptides;

[0028] Figure 2 This is a representative immunofluorescence image of engineered macrophages co-expressing FLAG (green) and MYC (red) tags. The cell nuclei are counterstained with DAPI (blue), and the scale bar is 100 μm.

[0029] Figure 3 Western blot validation image of FLAG / MYC expression in R / T-MaM (A) and quantitative images of FLAG (B) and MYC (C) expression; where Control is the control cells not transfected by lentivirus and Transfected is the transfected group cells;

[0030] Figure 4 A schematic diagram illustrating the synthesis of R / T-MaM-NPs nanoparticles;

[0031] Figure 5 The fluorescence overlay image shows PKH26-labeled macrophage membranes (red) encapsulating FITC-labeled nanoparticles (green), with a scale bar of 10 μm;

[0032] Figure 6 To analyze fluorescence intensity maps within different cells using confocal microscopy;

[0033] Figure 7 Fluorescence intensity map (A) and quantitative map (B) of Bend.3 cells for flow cytometry detection;

[0034] Figure 8 Fluorescence intensity map (A) and quantitative map (B) in reactive astrocytes for flow cytometry detection;

[0035] Figure 9 Fluorescence intensity map (A) and quantitative map (B) of Raw264.7 cells were detected by flow cytometry.

[0036] Figure 10 Whole-body biodistribution profiles of mice from different groups obtained by an in vivo imaging system;

[0037] Figure 11 Fluorescence images of isolated brain tissue from mice in different groups and 24 hours after injection;

[0038] Figure 12 Fluorescence images of major organs in mice from different groups 24 hours after injection;

[0039] Figure 13 Quantitative analysis of DiR signal intensity in brain tissue (A) and organs (B) of mice from different groups;

[0040] Figure 14 The images show the results of Western blot analysis of neuron-related proteins in reactive astrocytes in the peripheral tissues of mice from different groups after 32 days of treatment. A represents the Western blot results; B represents the quantitative analysis of Map2 protein; C represents the quantitative analysis of β3-tubulin protein; and D represents the quantitative analysis of NeuN protein.

[0041] Figure 15 Representative immunofluorescence images (A) and quantitative results (B) of Map2 expression in brain injury area slices of each group, with a scale bar of 100 μm. Detailed Implementation

[0042] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0043] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0044] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0045] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0046] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0047] Example 1: Preparation of engineered macrophage membranes expressing RVG / T7 dipeptide

[0048] This embodiment provides a method for preparing engineered macrophage membranes (R / T-MaM) expressing RVG peptide (amino acid sequence: YTIWMPENPRPGTPCDIFTNSRGKRASNG, SEQ ID NO.1) and T7 peptide (amino acid sequence: HAIYPRH, SEQ ID NO.2), the specific steps of which are as follows:

[0049] 1. Construction and preparation of lentiviral vectors

[0050] Target gene sequence: The coding sequence is SP-RVG-TM-flag-FT2A-SP-T7-TM-myc, where SP is the signal peptide sequence, RVG is the peptide targeting the acetylcholine receptor on astrocytes, TM is the transmembrane domain, flag and myc are detection tags, and FT2A is a self-cleaving peptide linker containing a furin cleavage site. This sequence was purchased from Genechem (Shanghai, China).

[0051] Amplification: The above-mentioned target gene fragment was amplified by PCR using primer pairs (forward: 5'- CCGGATCCCCGGGTACCGGTCGCCACCATGGAGACACACACTCCTGCTATG-3', SEQ ID NO.3; reverse: 5'- AACTGACACACTTAGTCGACTCACAGATCCTCCTCTGAGATCAGCTTC-3', SEQ ID NO.4).

[0052] Vector construction: The GV656 lentiviral vector backbone (pRRLSIN-cPPT-SFFV-MCS-SV40-puromycin, purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd.) was used, and linearized using AgeI and SalI restriction endonucleases. The amplified target gene fragment was ligated to the linearized vector using homologous recombinase to construct the recombinant plasmid pGV656-RVG-T7. Figure 1 ).

[0053] Verification: Colony PCR and DNA sequencing were performed on the recombinant plasmid to confirm that the inserted sequence was correct.

[0054] Lentiviral packaging: The correctly identified recombinant plasmid pGV656-RVG-T7 was mixed with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G at a mass ratio of 4:3:2 and transfected into 293T cells in logarithmic growth phase using Lipofectamine 2000 transfection reagent.

[0055] Virus collection and concentration: 72 hours after transfection, cell supernatant was collected, centrifuged at 500×g for 10 minutes to remove cell debris, and then filtered through a 0.45 μm cellulose acetate membrane. The viral supernatant was concentrated using ultracentrifugation or a commercially available virus concentration kit. The viral titer was determined by quantitative PCR and was approximately 1×10⁻⁶. 9 TU / mL, aliquoted and stored at -80℃.

[0056] 2. Isolation and culture of primary macrophages

[0057] Primary macrophages were extracted from the peritoneal cavity of 8-12 week old ICR mice and cultured in RPMI 1640 medium (Gibco) containing 10% fetal bovine serum to obtain adherent primary macrophages, which were then cultured for further use.

[0058] 3. Lentiviral transfection of macrophages

[0059] When the primary macrophages grew to approximately 70% confluence, they were transfected with the lentivirus prepared above, and immunofluorescence staining (using anti-FLAG and anti-MYC antibodies) was performed to verify whether the primary macrophages successfully expressed RVG peptide and T7 peptide. Figure 2 ).

[0060] 4. Extraction of engineered macrophage cell membranes

[0061] Macrophages (R / T-Ma) that were transfected and validated to express RVG / T7 dipeptide were collected and washed three times with pre-cooled PBS.

[0062] The cell pellet was resuspended in membrane protein extraction reagent A (purchased from Beyotime Biotechnology, China) containing 1% protease inhibitor (PMSF), and the macrophage membrane expressing RVG / T7 dipeptide was extracted by differential centrifugation, which is R / T-MaM.

[0063] The concentration of membrane proteins was determined by the BCA method. R / T-MaM was resuspended in an appropriate amount of PBS, aliquoted, and stored at -80℃ for later use.

[0064] Validation: The expression of FLAG and MYC-tagged proteins in the extracted membrane samples was detected by Western blotting and immunofluorescence staining to confirm the successful expression and membrane localization of RVG and T7 peptides. Figure 3 ).

[0065] Example 2 Preparation and characterization of PLGA nanoparticles (NPs) loaded with ginsenoside Rg1 and R / T-MaM-NPs

[0066] This embodiment provides a method for preparing PLGA nanoparticles (NPs) loaded with the drug ginsenoside Rg1 (Rg1) and their encapsulation by engineered macrophage membranes to form R / T-MaM-NPs. A schematic diagram of the construction is shown below. Figure 4 As shown.

[0067] 1. Preparation of Rg1-loaded PLGA nanoparticles (Rg1-NPs)

[0068] Materials: PLGA (LA:GA=13:7 (m / m), molecular weight 40000-75000), ginsenoside Rg1, polyvinyl alcohol (PVA, molecular weight 30-70 kDa), dimethyl sulfoxide (DMSO), dichloromethane (DCM).

[0069] Method (liquid solvent evaporation method):

[0070] a. Mix 200 μL of DMSO solution containing 10 mg Rg1 with 1 mL of dichloromethane containing 100 mg PLGA as the oil phase (O phase).

[0071] b. The above oil phase is subjected to ultrasonic homogenization at 100W power for 30 seconds under ice bath conditions (1 second on, 1 second off) to form the primary emulsion (W1 / O).

[0072] c. Quickly pour the colostrum into 50 mL of 1% (w / v) PVA aqueous solution, further sonicate for 1 min, and stir under magnetic stirring (500 rpm) for 24 hours to allow the dichloromethane to completely evaporate and the nanoparticles to solidify.

[0073] d. The obtained nanoparticles were washed three times with distilled water, centrifuged at 15,000 rpm for 5 minutes each time, and the precipitate was collected to remove free PVA and Rg1.

[0074] e. Resuspend the washed nanoparticle precipitate in an appropriate amount of PBS or ultrapure water to obtain an Rg1-NPs suspension, and store it at 4°C in the dark.

[0075] Characterization: The hydration size and zeta potential of the NPs were determined using dynamic light scattering. Encapsulation efficiency and drug loading were determined by high-performance liquid chromatography.

[0076] 2. Preparation of engineered macrophage membrane vesicle-coated nanoparticles (R / T-MaM-NPs)

[0077] The R / T-MaM membrane protein solution prepared in Example 1 and the Rg1-NPs suspension prepared above were mixed in PBS at a mass ratio of membrane protein to NPs of 2:1.

[0078] The mixture was allowed to stand in an ice bath for 30 minutes to allow the membrane to begin interacting with the NPs.

[0079] Using a mini extruder equipped with a 100 nm pore size polycarbonate membrane, the above mixture was repeatedly extruded through the membrane pores under ice bath conditions.

[0080] The extruded product was centrifuged at 4°C and 15,000 rpm for 30 minutes to remove uncoated free membrane fragments or excessively large aggregates.

[0081] The precipitate was gently resuspended in PBS to obtain the final R / T-MaM-NPs.

[0082] Verification: R / T-MaM was labeled with PKH26 (red film dye), and Rg1-NPs were labeled with FITC (green fluorescent dye). After preparation according to the above steps, observation by confocal fluorescence microscopy showed that the red fluorescent film completely encapsulated the green fluorescent NPs, forming a clear core-shell structure. Figure 5 ).

[0083] Example 3: In vitro functional validation and in vivo targeted therapy evaluation of R / T-MaM-NPs

[0084] This embodiment verifies the in vitro blood-brain barrier penetration, cell targeting ability, and therapeutic effect of R / T-MaM-NPs in a traumatic brain injury (TBI) model.

[0085] 1. In vitro blood-brain barrier penetration and cell-targeting experiments

[0086] Blood-brain barrier model construction: Mouse brain microvascular endothelial cells bEnd.3 were seeded in the upper chamber of a Transwell chamber (polyester membrane, 0.4 μm pore size) and cultured until a dense monolayer was formed and the transendothelial resistance (TEER) stabilized at 300 Ω·cm. 2 The above is used to simulate the blood-brain barrier.

[0087] Endothelial cell uptake: Bend.3 cells were seeded in confocal culture dishes and co-incubated for 2 hours with FITC-labeled NPs, MaM-NPs (macrophage membrane-coated NPs with unmodified peptides), and R / T-MaM-NPs, respectively. Intracellular fluorescence intensity was quantitatively analyzed by confocal microscopy and flow cytometry. Results are as follows: Figure 6 and Figure 7 As shown, the fluorescence intensity of the R / T-MaM-NPs group was significantly higher than that of other groups, confirming that the T7 peptide enhanced its binding and uptake with the transferrin receptor of endothelial cells.

[0088] In vitro BBB penetration and astrocyte targeting: Primary astrocytes (RAs) were seeded in the lower chamber of the Transwell model described above, and 1 μg / mL LPS stimulation was added to simulate an inflammatory environment. Equal amounts of FITC-labeled NPs, MaM-NPs, and R / T-MaM-NPs were added to the upper chamber, respectively. After 6 hours of incubation, astrocytes from the lower chamber were collected, and the uptake of the nanoparticles by cells was detected by flow cytometry and immunofluorescence. Results are as follows: Figure 6 and Figure 8 As shown, the R / T-MaM-NPs group exhibited the strongest fluorescence signal in astrocytes, indicating that it can effectively cross the in vitro BBB model and be efficiently taken up by target cells, with the RVG peptide and the inflammatory tropism of the macrophage membrane acting together.

[0089] Anti-macrophage phagocytosis assay: Different nanoparticle formulations were co-incubated with mouse monocyte / macrophage Raw264.7 cells for 2 hours, and flow cytometry was used to analyze the macrophage uptake of the nanoparticle formulations. For example... Figure 6 and Figure 9 As shown, the amount of R / T-MaM-NPs and MaM-NPs groups taken up by RAW264.7 was significantly lower than that of the uncoated NPs group, confirming that the macrophage membrane coating effectively reduced the risk of nanoparticles being non-specifically cleared by the immune system.

[0090] 2. In vivo brain-targeted distribution experiment

[0091] Animal model: Establish a mouse controlled cortical impaction (CCI) TBI model.

[0092] Nanoparticle injection and imaging: TBI model mice were randomly divided into three groups and injected via tail vein with NPs, MaM-NPs and R / T-MaM-NPs labeled with the near-infrared fluorescent dye DiR (DiR dose was consistent).

[0093] In vivo and ex vivo imaging: 24 hours after injection, whole-body fluorescence distribution in mice was captured using a small animal in vivo imaging system. Figure 10 The mice were then euthanized, and brain tissue and major organs (heart, liver, spleen, lungs, and kidneys) were removed for in vitro fluorescence imaging. Figure 11 and Figure 12 ).

[0094] Quantitative analysis: Quantitative analysis of fluorescence intensity in brain tissue and organs was performed. Results showed that the R / T-MaM-NPs group had the highest fluorescence accumulation in the brain injury area, approximately 2.6 times higher than the unmodified NPs group, and was mainly enriched in the liver and spleen. Figure 13 This demonstrates its highly efficient brain targeting and in vivo distribution characteristics.

[0095] 3. Evaluation of in vivo treatment efficacy

[0096] Given that the transdifferentiation of reactive astrocytes (RAs) is a long-term induction process, this invention treated TBI model mice for one month, supplementing them weekly with the nano-formulation. Brain tissue samples were collected on day 32 after the start of treatment for analysis. The specific procedure is as follows:

[0097] Treatment regimen: TBI model mice were randomly divided into four groups: PBS group, oral Rg1 group, empty vector group (R / T-MaM-NPs without Rg1), and R / T-MaM-NPs treatment group. Starting after model establishment, administration was performed weekly via tail vein (empty vector group and R / T-MaM-NPs group) for one month. The oral Rg1 group received an equal dose of Rg1 via gavage.

[0098] Sample collection and analysis: Mice were sacrificed on the second day after the last administration (i.e., the 32nd day after modeling) and tissues around the brain injury were collected.

[0099] Western blotting: Detecting the expression of neuronal markers (MAP2, β3-tubulin, NeuN). For example... Figure 14 As shown, the expression of mature neuronal proteins MAP2, β3-tubulin and NeuN was significant in the R / T-MaM-NPs group, while only weak expression was observed in the oral Rg1 group, and almost no expression was observed in the PBS group and the empty vector group. The expression levels of the above proteins in the R / T-MaM-NPs treatment group were significantly higher than those in the other groups.

[0100] Immunofluorescence staining: Frozen brain sections were co-stained with GFAP (astrocyte marker) and MAP2. For example... Figure 15 As shown, the R / T-MaM-NPs group showed a large number of MAP2-positive neuron-like cells in the damaged area, and some of them co-localized with GFAP signals, which was consistent with the results of Western blot analysis, suggesting that reactive astrocytes had transdifferentiated into neuron-like cells.

[0101] Conclusion: The above results indicate that R / T-MaM-NPs can efficiently target and deliver Rg1 to the TBI lesion area and significantly promote the transdifferentiation of reactive astrocytes into neuron-like cells, demonstrating good neurorepair therapeutic effects.

[0102] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A bipeptide-modified biomimetic nanovesicle, characterized in that, The invention includes nanoparticles formed from PLGA, the nanoparticles being loaded with therapeutic drugs; the surface of the nanoparticles being coated with macrophage membranes expressing RVG peptides and T7 peptides; The amino acid sequence of the RVG peptide is shown in SEQ ID NO.1; The amino acid sequence of the T7 peptide is shown in SEQ ID NO.

2.

2. The bipeptide-modified biomimetic nanovesicles according to claim 1, characterized in that, The therapeutic drug is a drug with neuroprotective or neuroreparative effects.

3. The bipeptide-modified biomimetic nanovesicles according to claim 2, characterized in that, The drugs with neuroprotective or neuroreparative effects include ginsenoside Rg1.

4. A method for preparing bipeptide-modified biomimetic nanovesicles as described in any one of claims 1-3, characterized in that, Includes the following steps: S1. Preparation of PLGA nanoparticles loaded with therapeutic drugs; S2. Preparation of macrophage membranes expressing RVG peptide and T7 peptide; S3. After mixing the PLGA nanoparticles obtained in step S1 with the macrophage membrane obtained in step S2, the mixture is extruded to coat the surface of the nanoparticles with the macrophage membrane, thus obtaining the dipeptide-modified biomimetic nanovesicles.

5. The preparation method according to claim 4, characterized in that, The method for preparing the macrophage membrane expressing RVG peptide and T7 peptide includes the following steps: A recombinant lentiviral vector containing nucleotide sequences encoding RVG peptide and T7 peptide was constructed; macrophages were transfected with the recombinant lentiviral vector to obtain engineered macrophages expressing RVG peptide and T7 peptide; cell membranes were extracted from the engineered macrophages to obtain the macrophage membranes expressing RVG peptide and T7 peptide.

6. The preparation method according to claim 5, characterized in that, The nucleotide sequences encoding the RVG peptide and the T7 peptide were obtained by amplification using primers with nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.

4.

7. The preparation method according to claim 4, characterized in that, The macrophage membrane and the PLGA nanoparticles are mixed at a mass ratio of membrane protein to nanoparticles of 2:

1.

8. The preparation method according to claim 4, characterized in that, The extrusion process uses a polycarbonate membrane with a pore size of 100 nm.

9. The use of a bipeptide-modified biomimetic nanovesicle as described in any one of claims 1-3 in the preparation of a promoter for the transdifferentiation of reactive astrocytes into neuron-like cells.

10. The use of a bipeptide-modified biomimetic nanovesicle as described in any one of claims 1-3 in the preparation of a medicament for treating traumatic brain injury or promoting nerve repair.

Images