Cerium nanoparticles of kaempferol and preparation method and application thereof
Kaempferol-cerium nanoparticles (KMP@Ce) formed by coordination of kaempferol with Ce3+ have solved the problems of limited efficacy and insufficient biocompatibility of existing anti-inflammatory drugs in the treatment of ARDS, and achieved synergistic effects of anti-inflammatory and antioxidant functions, showing excellent potential for ARDS treatment.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- THE SECOND AFFILIATED HOSPITAL ARMY MEDICAL UNIV
- Filing Date
- 2026-03-18
- Publication Date
- 2026-06-02
AI Technical Summary
Existing anti-inflammatory drugs such as glucocorticoids have limited efficacy and significant side effects in the treatment of acute respiratory distress syndrome (ARDS), while kaempferol and cerium ions, when used alone, lack sufficient biocompatibility and targeting, and cannot effectively scavenge reactive oxygen species (ROS) and suppress inflammation.
Kaempferol cerium nanoparticles (KMP@Ce) were prepared by forming coordination bonds between kaempferol and Ce3+, achieving a synergistic effect of anti-inflammatory and antioxidant functions. The particle size was 152-158 nm, which can be used to treat ARDS.
It achieved a comprehensive therapeutic effect on ARDS in in vitro and in vivo models, with good anti-inflammatory and ROS scavenging activities, showing better therapeutic effects than individual components, and with good biosafety and stability.
Smart Images

Figure CN121846137B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology and relates to kaempferol cerium nanoparticles, their preparation methods and applications. Background Technology
[0002] Kaempferol (KMP) is a naturally occurring phytochemical that is not only an effective component of many traditional Chinese medicines but also widely found in everyday foods. It possesses various potential biological activities and is a hot topic in modern pharmacological research. In recent years, numerous studies have confirmed the potential benefits of KMP for inflammatory diseases such as arthritis and allergic diseases. Some studies have shown that traditional Chinese medicines and compound preparations containing KMP (such as Lianhua Qingwen capsules and Reduning injection) can exert anti-inflammatory effects in COVID-19 infection; simultaneously, KMP can restore the integrity of the pulmonary endothelial cell barrier by regulating the SphK1 / S1P / SIPR1 / MLC2 signaling pathway. Although kaempferol (KMP) has anti-inflammatory potential, its poor water solubility, the easily oxidized and degraded bioactive phenolic groups in the physiological environment, and the limited antioxidant capacity of a single component are all challenges.
[0003] Cerium (Ce), as one of the most typical multivalent metals in the lanthanide series, commonly has the following valence state: Ce. 3+ Ce 4+ These ions can typically undergo dynamic and reversible transformations, thereby acquiring electron transfer capabilities to efficiently participate in redox cycles. This property endows cerium ions with excellent antioxidant and enzyme-like activities, such as Ce... 4+ Catalase-like enzymes can promote the conversion of hydrogen peroxide (H2O2) into water and oxygen, while Ce... 3+ Superoxide anions (•O2) can be removed through superoxide dismutase-like enzymes and redox reactions. - Cerium-based nanoparticles have shown excellent ROS scavenging activity in the treatment of various systemic inflammatory diseases, such as inflammatory bowel disease and periodontitis. (Cerium ions (Ce)...) 3+ / Ce 4+ Although it has excellent ROS scavenging (enzyme-like) activity, its biocompatibility, targeting and anti-inflammatory ability are limited when used alone.
[0004] Acute respiratory distress syndrome (ARDS) is a highly fatal non-cardiac pulmonary edema caused by various etiologies (such as infection, trauma, and aspiration). It is a common and severe respiratory critical illness characterized by high mortality and disability rates, with a mortality rate as high as 40–50%. Survivors often suffer from pulmonary fibrosis and cognitive impairment, seriously threatening their lives and health. Globally, ARDS affects millions of critically ill patients annually. International multicenter epidemiological studies show that the incidence of ARDS in intensive care unit (ICU) patients is 10.4%, with an in-hospital mortality rate of 34.9%–46.1%. Furthermore, the latest research in 2025 indicates that the incidence of ARDS increases significantly with age, with a much higher rate in people over 75 years of age than in adolescents. With the development of critical care medicine and the increasing aging of the population, the clinical burden of ARDS is growing, becoming a key focus and challenge in critical care.
[0005] Evidence-based strategies such as lung-protective ventilation and prone positioning ventilation have been proven to significantly improve the prognosis of ARDS. Meanwhile, drug therapy is also an important part of the comprehensive management strategy for ARDS, and anti-inflammatory drugs such as glucocorticoids have also been shown to be beneficial in clinical treatment studies. However, they only exert their main effect in the early stages of ARDS, have limited efficacy, and have certain side effects (gastrointestinal discomfort, allergic reactions, cardiovascular risk, central nervous system effects, etc.). Therefore, there are currently no specific drugs to significantly improve the overall treatment effect of ARDS. In this regard, recent studies have shown that excessive production of reactive oxygen species (ROS) and uncontrolled inflammation play a crucial role in ARDS. During the pathological process of ARDS, pathogenic factors activate immune cells (such as neutrophils and macrophages) and release large amounts of ROS (H2O2, •O2). - ROS damage cells and promote the release of various cytokines (TNF-α, ILs, etc.). ROS can also activate multiple signaling pathways (such as NF-κB, AMPK, PI3K / AKT, etc.), exacerbating inflammation and further leading to the production of more ROS. These two factors create a vicious cycle, driving disease progression. These findings provide a theoretical basis for the treatment of ALI / ARDS, suggesting that developing novel drugs with both ROS clearance and inflammation suppression properties remains an important task in ARDS treatment. Summary of the Invention
[0006] In view of this, the present invention utilizes the hydroxyl group (-OH) in polyphenolic compounds as a ligand to form coordination bonds with metal ions, thereby constructing a metal-polyphenol network. Anti-inflammatory kaempferol and antioxidant cerium ions are co-assembled through coordination bonds to form a single nanoparticle (KMP@Ce), achieving a dual-function integration. The purpose of this invention is to provide kaempferol cerium nanoparticles, their preparation method, and their application in the preparation of drugs for treating acute respiratory distress syndrome.
[0007] To achieve the above objectives, the present invention provides the following technical solution:
[0008] This invention provides the application of kaempferol-cerium nanoparticles in the preparation of a drug for treating acute respiratory distress syndrome, wherein the kaempferol-cerium nanoparticles are composed of kaempferol (KMP) and cerium chloride (Ce). 3+ The kaempferol (KMP) and Ce are assembled through coordination. 3+ The molar ratio is 1:3, and its structural formula is shown below:
[0009] ;
[0010] Preferably, the kaempferol cerium nanoparticles have a particle size of 152–158 nm;
[0011] Furthermore, the preparation method of the kaempferol cerium nanoparticles includes the following steps:
[0012] S1: Mix PEG-8000 aqueous solution with Ce 3+ Mix the aqueous solution and deionized water, and stir continuously at 900 g for 5 min.
[0013] S2: While stirring, quickly add kaempferol (KMP) ethanol solution and continue stirring for 30 min;
[0014] S3: The reaction solution was centrifuged at 20 °C and 8000 g for 10 min, the supernatant was discarded, the solution was resuspended in deionized water and washed twice by centrifugation to obtain the kaempferol cerium nanoparticles;
[0015] Furthermore, the present invention provides the application of the aforementioned kaempferol cerium nanoparticles in a pharmaceutical composition for the treatment of acute respiratory distress syndrome.
[0016] The beneficial effects of this invention are as follows:
[0017] This invention provides a mild, simple, and low-cost method for preparing kaempferol cerium nanoparticles (KMP@Ce). The method produces spherical nanoparticles with uniform morphology and good dispersibility, with an average particle size of approximately 152-158 nm. This size is beneficial for distribution and retention in the lungs. The kaempferol cerium nanoparticles are formed through stable coordination bonds (Ce-O), exhibiting a well-defined structure (KMP and Ce are coordinated in approximately a 1:3 ratio), ensuring consistent behavior as a single entity within the organism.
[0018] The kaempferol-cerium nanoparticles of this invention achieve synergistic and enhanced anti-inflammatory (kaempferol) and antioxidant (cerium) functions, thus exhibiting superior comprehensive therapeutic effects on acute respiratory distress syndrome (ARDS) compared to individual components in both in vitro and in vivo models. Furthermore, these nanoparticles are simple to prepare, stable in properties, and exhibit good biocompatibility. Preliminary findings indicate that they exert their effects through the AMPK-NRF2-NF-κB signaling axis, and testing revealed that KMP@Ce possesses good anti-inflammatory and ROS scavenging activity. These nanoparticles represent a promising potential therapeutic agent for ARDS and hold promise for further development into ARDS treatment drugs, demonstrating broad and potential applications in the field.
[0019] Other advantages, objectives, and features of the invention will be set forth in part in the description which follows, and in part will be apparent to those skilled in the art from the following examination, or may be learned from practice of the invention. The objectives and other advantages of the invention can be realized and obtained through the following description. Attached Figure Description
[0020] To make the objectives, technical solutions, and advantages of the present invention clearer, the preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings, wherein:
[0021] Figure 1 The morphology and particle size distribution of KMP@Ce are shown in the following figures: (A) TEM morphology and particle size distribution; (B) DLS hydrated particle size distribution.
[0022] Figure 2 The structural composition diagram of KMP@Ce is as follows: (A) UV-Vis spectrum; (B) XPS full spectrum; (C) XPS-O 1s high-resolution spectrum; (D) XPS-Ce 3d high-resolution spectrum; (E) FTIR spectrum;
[0023] Figure 3 For the KMP@Ce reaction preparation: (A) UV-Vis spectral titration; (B) HRMS spectrum;
[0024] Figure 4Molecular orbital information diagrams for KMP@Ce: (A) Initial optimization of potential structures, (B) Molecular orbital information diagrams of the lowest energy structures;
[0025] Figure 5 The following is a diagram of KMP@Ce self-assembly molecular interactions: (A) Dynamic snapshots and molecular interactions during the KMP@Ce self-assembly process; (B) RMSD and SASA curves during the simulation process; (C) The number of hydrogen bonds, hydrophobic interactions, and π-π interactions during the simulation process.
[0026] Figure 6 To investigate the in vitro inhibitory activity of KMP@Ce on inflammation: (AD) RT-qPCR was used to detect changes in the secretion levels of interleukin-6 (IL-6), interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), and interleukin-10 (IL-10) in RAW264.7 cells (stimulated by LPS) treated with different concentrations of KMP@Ce; (EH) RT-qPCR was used to detect changes in the secretion levels of IL-6, IL-1β, TNF-α, and IL-10 in RAW264.7 cells (stimulated by LPS) treated with KMP@Ce, KMP, and Ce. All data are expressed as mean ± standard deviation (mean ± SD) and analyzed for variance (ANOVA) using GraphPad Prism 8 software. Differences were considered statistically significant when p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***).
[0027] Figure 7 KMP@Ce in vitro ROS scavenging activity: (AB) KMP@Ce, KMP, Ce against DPPH• and ABTS• + Scavenging ability; (CE) KMP@Ce at different concentrations against •O2 - (F) Scavenging capacity of H2O2 and •OH; (G) Viability of RAW264.7 cells treated with KMP@Ce, KMP, and Ce (stimulated with different concentrations of H2O2); (H) ROS level in RAW264.7 cells treated with KMP@Ce, KMP, and Ce (stimulated with LPS); (I) KMP@Ce, KMP, and Ce can all reduce ROS levels, and KMP@Ce has the best performance; All data are expressed as mean ± standard deviation (mean ± SD) and were analyzed by ANOVA using GraphPad Prism 8 software. Differences were considered statistically significant when p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***).
[0028] Figure 8 Analysis of potential biological mechanisms of KMP@Ce: (A) Potential signaling pathways suggested by significantly expressed genes in KMP@Ce; (B) Changes in the protein levels of AMPKα, NRF2, and p-P65; (C) Activation of the AMPK-NRF2-NF-κB signaling axis by KMP@Ce;
[0029] Figure 9 The therapeutic effect of KMP@Ce on ARDS mice: (A) H&E staining of mouse lung tissue, scale bar: 100 μm; (B) Lung injury score; (C) Lung dry-wet ratio; (DE) Changes in lung function indicators Rrs and Crs levels; (FI) Changes in the secretion levels of IL-6, IL-1β, TNF-α, and IL-10 in mouse lung tissue; (JM) Changes in the secretion levels of IL-6, IL-1β, TNF-α, and IL-10 in BALF; (NO) Changes in the levels of MDA and 8-OHdG in mouse lung tissue; (PQ) Changes in the levels of MDA and 8-OHdG in BALF. All data are expressed as mean ± standard deviation (mean ± SD) and analyzed by ANOVA using GraphPad Prism 8 software. Differences were considered statistically significant when p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***).
[0030] Figure 10 For the biosafety evaluation of KMP@Ce: (A) Cell viability after co-incubation of RAW264.7 cells with different concentrations of KMP@Ce for 24 h; (BC) Changes in the levels of BUN and CR, indicators of renal function evaluation, in ARDS mice treated with different concentrations of KMP@Ce; (DF) Changes in the levels of ALT, AST, and ALP, indicators of liver function evaluation, in ARDS mice treated with different concentrations of KMP@Ce. Detailed Implementation
[0031] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments are only schematic representations of the basic concept of the present invention. Unless otherwise specified, the following embodiments and features can be combined with each other.
[0032] The accompanying drawings are for illustrative purposes only and are schematic diagrams, not actual pictures. They should not be construed as limiting the invention. To better illustrate the embodiments of the invention, some parts in the drawings may be omitted, enlarged, or reduced, and do not represent the actual product dimensions. It is understandable to those skilled in the art that some well-known structures and their descriptions may be omitted in the drawings.
[0033] In the accompanying drawings of the embodiments of the present invention, the same or similar reference numerals correspond to the same or similar components. In the description of the present invention, it should be understood that if terms such as "upper," "lower," "left," "right," "front," and "rear" indicate the orientation or positional relationship based on the orientation or positional relationship shown in the drawings, they are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, the terms used to describe positional relationships in the drawings are only for illustrative purposes and should not be construed as limiting the present invention. For those skilled in the art, the specific meaning of the above terms can be understood according to the specific circumstances.
[0034] The reagents and instruments used in the embodiments of this invention are as follows:
[0035] Main reagents and instruments: KMP (97%, Shanghai Aladdin Biochemical Technology Co., Ltd.), Ce(NO3)3·6H2O (99%, Beijing Bailingwei Technology Co., Ltd.), PEG-8000 (99%, Shanghai Aladdin Biochemical Technology Co., Ltd.), lipopolysaccharide (LPS, Sigma-Aldrich (Shanghai) Trading Co., Ltd.), RAW264.7 cells (provided by the Chongqing Key Laboratory of Respiratory Diseases, where our research group is located), DMEM high glucose medium (cell culture grade, Gebroc Life Sciences, USA), fetal bovine serum (FBS, cell culture grade, Hyclone, USA), penicillin-streptomycin solution (cell culture grade, Gebroc Life Sciences, USA), H2O2 (3%, Shanghai Aladdin Biochemical Technology Co., Ltd.), TRIzol (100%, Thermo Fisher Scientific, USA), Cell Counting Kit-8 (CCK8, Beyotime Biotechnology Co., Ltd.), T-PER™ tissue protein extraction reagent (Thermo Fisher Scientific, USA), SuperPAGE stain-free pre-gel Bis-Tris (10%). 12-well kit (Shanghai Yamei Biomedical Technology Co., Ltd.), PVDF transfer membrane (Beijing Lanjieke Technology Co., Ltd.), skim milk powder for blocking (Shanghai Yuanye Biotechnology Co., Ltd.), AMPKα, NRF2, p-P65, GAPDH, HRP-labeled goat anti-rabbit IgG antibody (Saixintong (Shanghai) Biological Reagent Co., Ltd.), ultrasensitive chemiluminescence detection kit (Shanghai Yamei Biomedical Technology Co., Ltd.), RT-qPCR primers (Table 1, Shanghai Sangon Biotech Co., Ltd.), reverse transcription kit (Thermo Fisher Scientific, Inc.), total antioxidant capacity assay kit (ABTS). The following reagents were used: DPPH assay kit (Shanghai Sangon Biotech Co., Ltd.), Superoxide Dismutase Activity Assay Kit (Beijing Solarbio Science & Technology Co., Ltd.), Catalase Assay Kit (Shanghai Beyotime Biotechnology Co., Ltd.), Hydroxyl Radical Scavenging Rate Assay Kit (Fenton Colorimetric Assay, Shanghai Yuanye Biotechnology Co., Ltd.), Reactive Oxygen Spectroscopy Assay Kit (Shanghai Beyotime Biotechnology Co., Ltd.), BCA Protein Concentration Assay Kit (Shanghai Beyotime Biotechnology Co., Ltd.), Mouse IL-6, IL-1β, TNF-α, IL-10 Pre-coated Enzyme-Linked Immunosorbent Assay Kit (Shenzhen Dakwei Biotechnology Co., Ltd.), Lipid Oxidation (MDA) Assay Kit (Shanghai Beyotime Biotechnology Co., Ltd.), 8-Hydroxyguanosine (8-OHdG) Enzyme-Linked Immunosorbent Assay Kit (Beijing Solarbio Science & Technology Co., Ltd.), Phosphate Buffered Salt (PBS, 0.01M, pH 7.2-7.4, Shanghai Jizhi Biochemical Technology Co., Ltd.), Anhydrous Ethanol (purity ≥99%).7%, Chongqing Chuandong Chemical Group Co., Ltd.), Field Emission Transmission Electron Microscope (TEM, JEM-F200, NEC Corporation), Dynamic Light Scattering Spectrometer (DLS, Litesizer DLS500, Anton Paar GmbH, Austria), Ultraviolet-Vis Spectrophotometer (UV-Vis, UH5300, Hitachi High-Tech Scientific Nocalabe Laboratory, Japan), X-ray Photoelectron Spectrometer (XPS, Kratos AXIS SUPRA+, Shimadzu Corporation, Japan), Fourier Transform Infrared Spectrometer (FTIR, Nicolet IS 10, Thermo Fisher Scientific, USA), High Resolution Mass Spectrometer (HRMS, Q Exactive Orbitrap, Thermo Fisher Scientific, USA), CO2 Cell Culture Incubator (CCL-170B-8, ESI Technology Co., Ltd., Singapore), Multifunctional Microplate Reader (SpectraMax i3x, Meigu Molecular Instruments Shanghai Co., Ltd.), CFX96 Real-Time PCR System Systems (Bio-Rayet Life Sciences Research, Inc., USA), flow cytometers (FACS, Gallios, Beckman Coulter, Inc., USA), integrated chemiluminescence imaging system (Shanghai Qinxiang Scientific Instruments Co., Ltd.), animal lung function testing system (FV-FXM2-01, Cyrex, Canada), fully automated biochemical analyzer (BK-280, Shandong Boke Biotechnology Co., Ltd.), transcriptome sequencing and analysis (Shanghai Sangon Biotech Co., Ltd.).
[0036] Table 1 RT-qPCR primer sequences
[0037] Inflammatory factors Forward (primer, 5'-3') Reverse (primer, 5'-3') IL-6 CTTCTTGGGACTGATGCTGGTGAC (SEQ ID NO:1) TCTGTTGGGAGTGGTATCCTCTGTG (SEQ ID NO: 2) IL-1β CACTACAGGCTCCGAGAT GAACAAC (SEQ ID NO: 3) TGTCGTTGCTTGGTTCTCCTTGTAC (SEQ ID NO:4) TNF-α CACCACGCTCTTCTGTCTACTGAAC (SEQ ID NO:5) AGATGATCTGAGTGTGAG GGTCTGG (SEQ ID NO:6) IL-10 TGCCAAGCCTTATCGGAA ATGATCC (SEQ ID NO:7) AGCCGCATCCTGAGGGTCTTC (SEQ ID NO:8)
[0038] Example 1: Preparation and Characterization of KMP@Ce Nanoparticles
[0039] 1. Preparation of nanoparticles
[0040] a) At room temperature, mix PEG-8000 aqueous solution (24 mg / mL) with Ce 3+ Mix the aqueous solution (4.34 mg / mL) and deionized water, and stir continuously at 900 g for 5 min.
[0041] b) While stirring, quickly add KMP ethanol solution (1.43 mg / mL) and continue stirring for 30 min;
[0042] c) Centrifuge the reaction solution at 20 °C and 8000 g for 10 min, discard the supernatant; resuspend the precipitate in deionized water and wash by centrifugation again, repeating the cycle twice to thoroughly remove unreacted PEG-8000 and Ce. 3+ and KMP;
[0043] d) The final precipitate was resuspended in deionized water (10 mL) to obtain a KMP@Ce nanoparticle dispersion;
[0044] e) Accurately measure the dispersion (1 mL) into a pre-weighed centrifuge tube, dry it at 60 °C to constant weight, calculate the solid content, and use it for subsequent dosage preparation and biomedical validation.
[0045] This invention comprehensively characterized the prepared KMP@Ce from three aspects: morphology, particle size, structural composition, and reaction ratio, confirming the reliability of the method for preparing kaempferol-cerium co-assembled nanoparticles.
[0046] 2. Structural characterization
[0047] This invention investigated two methods for KMP@Ce morphology and particle size analysis: ① A 1 mg / mL KMP@Ce solution was prepared, and 10 μL was added to the surface of a copper mesh. After being completely dried under an infrared lamp, TEM measurements were performed. The results are shown in [Figure number missing]. Figure 1 A. KMP@Ce exhibits uniformly dispersed spherical particles with an average size of 152±26.93 nm. ② A 1 mg / mL KMP@Ce solution was prepared for DLS determination; the results are shown below. Figure 1 B, the hydrated particle size of KMP@Ce is approximately 158.03 nm. Given the good agreement between TEM and DLS results, the particle size of KMP@Ce is approximately 152~158 nm.
[0048] This invention examines three methods for analyzing the composition of KMP@Ce results:
[0049] (1) Prepare 1 mg / mL KMP@Ce ethanol solution and 1.43 mg / mL KMP ethanol solution, and transfer 2 mL into a quartz cuvette for UV-Vis measurement. The results are shown in the figure. Figure 2 A. KMP exhibits maximum UV absorption at 370 nm, while the absorption intensity of KMP@Ce is weakened compared to KMP and redshifted to 375 nm, demonstrating that KMP and Ce are similar. 3+ A clear reaction occurred between them.
[0050] (2) Accurately weigh 5 mg of KMP@Ce and KMP powder and place them in an X-ray photoelectron spectrometer. Perform XPS tests under vacuum and room temperature conditions and collect characteristic spectra of O and Ce elements. Figure 2 B shows that KMP@Ce contains characteristic peaks of Ce 3d, O 1s and C 1s, while KMP contains characteristic peaks of O 1s and C 1s, indicating that KMP reacts successfully with Ce. Figure 2C shows that the chemical environment (C-OH, COC, C=O) of O element in KMP@Ce is significantly different from that in KMP, indicating that the oxygen-containing functional groups in KMP may be Ce coordination sites; Figure 2 D shows that KMP@Ce contains typical Ce. 3+ Ce 4+ The characteristic peaks indicate the timely preparation of KMP@Ce.
[0051] (3) Accurately weigh 1 mg of KMP@Ce and KMP powder, compress them into tablets with potassium bromide powder at a mass ratio of 1:100, and then perform FTIR analysis. The results are shown in the figure. Figure 2 E, KMP@Ce is a new Ce-O-Ce (1382 cm⁻¹) compared to KMP. -1 Characteristic functional groups, and the phenolic hydroxyl group in KMP (3318 cm) -1 ) and benzene ring conjugated carbonyl group (1600 / 1580 cm) -1 The significant changes indicate that KMP coordinates with Ce, primarily at the phenolic hydroxyl group and the conjugated carbonyl group of the benzene ring. Therefore, KMP@Ce was successfully prepared by coordination of KMP with Ce.
[0052] 3. Reaction ratio
[0053] This invention investigated two methods for KMP@Ce reaction ratio analysis: ① preparing a 0.0143 mg / mL KMP@Ce solution and reacting it with 0.0217 mg / mL, 0.0434 mg / mL, 0.0651 mg / mL, and 0.0868 mg / mL Ce solutions, respectively. 3+ Solution mixing results in KMP:Ce 3+ The molar concentration ratios were 1:1, 1:2, 1:3, and 1:4. The coordination ratio was determined by UV-Vis spectral titration, and the results are shown in [Figure number missing]. Figure 3 A, KMP absorbance with Ce 3+ The content gradually decreases as KMP:Ce increases, while the content gradually decreases as KMP:Ce increases. 3+ After the KMP concentration was increased to 1:3, the absorbance of KMP showed a certain degree of enhancement, indicating that the coordination between KMP and Ce had reached saturation. ② A 1.2 mg / mL KMP@Ce solution was prepared and subjected to HRMS analysis; the results are shown below. Figure 3 B, a distinct KMP:Ce mass-to-charge ratio fragment peak of 1:3 was collected. Therefore, in the KMP@Ce preparation method of this invention, KMP and Ce coordinate in a 1:3 ratio to form KMP@Ce.
[0054] Example 2: KMP and Ce ratio verification
[0055] Structure optimization was performed using density functional theory (DFT) at the PBE0 / def2SVP level, with the Ce ion employing the pseudopotential basis set MWB28. Molecular orbital information was analyzed using the Multiwfn program to obtain the energies of the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO), and their energy range was calculated using the following formula: ΔE gap = E HOMO -E LUMO .
[0056] To investigate the coordination mechanism between KMP and Ce at the molecular level, based on HRMS results ( Figure 3 B) Given the KMP:Ce=1:3 ratio, perform initial structure optimization on the four potential coordination structures. Figure 4 A shows a strong interaction between the hydroxyl or carbonyl oxygen atom and the Ce atom in KMP, yielding the most stable structure with the lowest relative energy (0 kcal / mol). Further structural optimization yielded the lowest-energy structure. Figure 4 B discovered its ΔE gap The lower ratio indicates a significant electron transfer between KMP and Ce, providing theoretical support for its subsequent antioxidant properties. Therefore, the above results verify that the hydroxyl and carbonyl oxygen atoms in KMP successfully formed KMP@Ce through interactions such as hydrogen bonding and metal coordination, with a ratio of 1:3.
[0057] Example 3: KMP@Ce Self-Assembly Verification
[0058] The initial structure for the MD simulation was constructed using the insert-molecules module of Gromacs, creating an 8×8×8 nm box into which 50 KMP molecules were randomly filled. The MD simulation was performed using Gromacs 2024.4 under isothermal and isobaric conditions with periodic boundary conditions. The Amber14SB all-atom force field and the TIP3P water model were applied. During the MD simulation, all hydrogen bonds were constrained using the LINCS algorithm with an integration step size of 2 fs. Electrostatic interactions were calculated using the Particle-mesh Ewald method. The non-bonded interaction cutoff was set to 12 Å and updated every 10 steps. The simulation temperature was controlled at 300 K using the V-rescale temperature coupling method, and the pressure was controlled at 1 bar using the Parrinello-Rahman method. First, the steepest descent method was used to minimize the energy of the system to eliminate excessively close contact between atoms. Then, an NVT equilibrium simulation of 100 ps was performed at 300 K. Finally, a MD simulation of 200 ns was performed on the system, with the conformation saved every 40 ps, for a total of 5000 conformations. The simulation results were visualized using Gromacs embedded programs and VMD.
[0059] The self-assembly mechanism was further explored using molecular dynamics (MD) simulations. Figure 5 A shows that KMP initially exhibits a random distribution, but gradually aggregates into spherical clusters over time; Figure 5 B shows that in the early stages of the simulation, the mean square deviation (RMSD) and soluble surface area (SASA) curves, which are commonly used to assess the assembly progress and compactness of the system, both decreased significantly and gradually converged to an equilibrium state after 100 ns, indicating that the KMP-Ce complex follows an assembly path from dispersion to aggregation and then to stability. Figure 5 The C-values show that the number of hydrogen bonds, hydrophobic interactions, and π-π stacking interactions in the system gradually increases in the first 50 ns of the simulation and tends to stabilize after 100 ns, with average values of 66.69±3.57, 115.65±6.17, and 127.59±8.01, respectively, indicating that the core driving force for the assembly of the KMP-Ce complex is weak interactions.
[0060] Example 4: In vitro anti-inflammatory activity of KMP@Ce nanoparticles
[0061] This embodiment investigates the effects of different concentrations of KMP@Ce and KMP@Ce, KMP, and Ce (KMP=6.6 μg / mL, Ce=19.9 μg / mL, KMP@Ce=20 μg / mL, where the KMP and Ce concentrations are consistent with those contained in KMP@Ce and are designated as the 20 μg / mL concentration group) on the secretion of inflammatory factors in an LPS-induced RAW264.7 cell model, thereby evaluating its in vitro inhibitory performance on RAW264.7 cell inflammation. The specific steps are as follows:
[0062] (1) RAW264.7 cell culture: RAW264.7 cells frozen at -80℃ were rapidly thawed in a 37℃ water bath, disinfected with 75% ethanol, centrifuged and washed in a laminar flow hood, the supernatant was discarded and resuspended in DMEM complete medium containing 10% FBS and 1% double antibiotics, seeded in 6 cm culture dishes, and placed in a 37℃, 5% CO2 incubator for static culture;
[0063] (2) Quantitative reverse transcription polymerase chain reaction (RT-qPCR) was used to determine the mRNA expression level in macrophages: RAW264.7 cells in logarithmic growth phase were injected with 5 × 10⁻⁶ mRNA at a concentration of 5 × 10⁻⁶ mRNA. 5Cells were seeded in 6-well plates and stimulated with LPS (1.0 μg / mL) for 6 h after cell adhesion. Then, different concentrations of KMP@Ce and 20 μg / mL KMP@Ce, KMP, and Ce were added and incubated for 24 h. After cell collection, total RNA was extracted using the Trizol method, quantified by Nanodrop, and reverse transcribed into cDNA. The expression levels of IL-6, IL-1β, TNF-α, and IL-10 were detected by RT-qPCR using GAPDH as an internal control and the SYBR Green method. The data were analyzed by Bio-Rad CFXManager 3.0.
[0064] See results Figure 6 In the in vitro anti-inflammatory study, the expression levels of pro-inflammatory cytokines IL-6, IL-1β, and TNF-α gradually decreased with increasing KMP@Ce concentration, while the expression level of anti-inflammatory cytokines IL-10 gradually increased with increasing KMP@Ce concentration. Furthermore, Figure EH showed that KMP@Ce exhibited better performance than KMP and Ce in inhibiting the expression levels of pro-inflammatory cytokines IL-6, IL-1β, and TNF-α and enhancing the expression level of anti-inflammatory cytokines IL-10. Therefore, KMP@Ce possesses good in vitro anti-inflammatory activity.
[0065] Example 5: In vitro ROS scavenging activity of KMP@Ce nanoparticles
[0066] This embodiment studies the in vitro total antioxidant capacity, ROS scavenging capacity, and intervention effects of different concentrations of KMP@Ce, KMP, and Ce, as well as different concentration groups of KMP@Ce, KMP, and Ce, on the H2O2-induced oxidative stress model of RAW264.7 cells and on LPS-induced ROS generation in RAW264.7 cells, thereby evaluating its in vitro antioxidant and cell protective effects. The specific steps are as follows:
[0067] (1) Following the experimental protocol provided by the commercially available Total Antioxidant Capacity (T-AOC) assay kit (ABTS method and DPPH method), the in vitro total antioxidant capacity of KMP@Ce, KMP, and Ce at a concentration of 20 μg / mL was determined. The results are shown in the figure. Figure 7 AB, KMP@Ce has a stronger DPPH than KMP and Ce. • ABTS •+ The scavenging ability is significantly higher than the theoretical in vitro antioxidant capacity of KMP and Ce combined (KMP+Ce), proving that the total in vitro antioxidant capacity of KMP and Ce in KMP@Ce has a synergistic effect.
[0068] (2) Following the experimental protocols provided by the commercially available superoxide dismutase activity assay kit, catalase assay kit, and hydroxyl radical scavenging assay kit (Fenton colorimetric method), the effects of different concentrations of KMP@Ce on ROS types (•O2) were determined. - The scavenging abilities of H2O2 and •OH were measured, and the results are shown in [the table below]. Figure 7 Both CF and KMP@Ce possess good O2 properties. - The scavenging ability of KMP@Ce gradually increases with increasing KMP@Ce concentration, and exhibits the ability to remove H2O2 and •OH. - The tendency of >H2O2>•OH to be removed.
[0069] (3) RAW264.7 cells in the logarithmic growth phase were injected with 5 × 10⁻⁶ cells. 5 Cells were seeded in 6-well plates and, after adhesion, were stimulated with 200 mM and 400 mM H2O2 for 6 h, respectively, followed by incubation with 200 μg / mL KMP@Ce, KMP, and Ce for 24 h. Simultaneously, after adhesion, cells were stimulated with 500 mM H2O2 for 6 h, followed by incubation with 100 μg / mL and 200 μg / mL KMP@Ce, KMP, and Ce for 24 h, respectively. Cell viability was measured using the CCK8 assay after harvesting. Results are shown below. Figure 7 GH,KMP@Ce showed better recovery of RAW264.7 cell viability after H2O2-induced oxidative stress (restoring it to approximately 50%) compared to KMP and Ce, and its effect was significantly concentration-dependent. The H2O2 concentration used in this invention is significantly higher than the range of H2O2 concentrations in lung tissue during ARDS pathology reported in current literature (2.3 ± 1.2 μM), indicating that KMP@Ce has significant application potential in ARDS treatment through its cytoprotective effects.
[0070] (4) RAW264.7 cells in the logarithmic growth phase were injected with 5 × 10⁻⁶ cells. 5 Cells were seeded in 6-well plates and, after adhesion, stimulated with LPS (1.0 μg / mL) for 6 h. Then, KMP@Ce, KMP, and Ce were added at concentrations of 20 μg / mL and incubated for 24 h, respectively. After cell collection, intracellular ROS levels were measured using a commercially available reactive oxygen species (ROS) assay kit via FACS. Results are shown in the table below. Figure 7 I, KMP@Ce, KMP, and Ce can all reduce ROS levels, with KMP@Ce exhibiting the best performance. Therefore, KMP@Ce possesses excellent in vitro ROS scavenging activity.
[0071] Example 6: Analysis of the potential biological mechanisms of KMP@Ce nanoparticles
[0072] This embodiment utilizes transcriptome sequencing and analysis of a KMP@Ce, KMP, and Ce-treated LPS-induced RAW264.7 cell inflammation model, combined with Western blotting experiments to reveal the potential biological mechanism of KMP@Ce. The specific steps are as follows:
[0073] (1) RAW264.7 cells in logarithmic growth phase were injected with 5 × 10⁻⁶ cells. 5 The cells were seeded in 6-well plates and, after adhesion, stimulated with LPS (1.0 μg / mL) for 6 h. Then, KMP@Ce, KMP, and Ce at concentrations of 20 μg / mL were added and co-incubated for 24 h. Total RNA was extracted using Trizol reagent for subsequent transcriptome sequencing and analysis. Significant differences in gene expression were observed between the KMP@Ce, KMP, and Ce treatment groups and the LPS treatment group. Typical genes promoting macrophage M2 polarization (such as Ccl17 and Tgm2) and antioxidant genes (such as Gsta3) were significantly expressed. Simultaneously, Ccna1, a downstream effector molecule indirectly influenced by the AMPK signaling pathway, was also significantly expressed. Figure 8 A shows that, based on enrichment analysis using the Kyoto Encyclopedia of Genes and Genomes (KEGG), the top 30 significantly enriched signaling pathways identified in KMP@Ce are mostly associated with AMPK, NRF2, and NF-κB signaling pathways. At the same time, genes that showed significant differences between the KMP@Ce, KMP, and Ce treatment groups and the LPS treatment group converged on the regulatory network of the AMPK–NRF2–NF-κB signaling axis.
[0074] (2) RAW264.7 cells in the logarithmic growth phase were injected with 5 × 10⁻⁶ cells. 5 The cells were seeded into 6-well plates and, after adhesion, stimulated with LPS (1.0 μg / mL) for 6 h. Then, KMP@Ce, KMP, Ce, and KMP@Ce (10 μg / mL) at concentrations of 20 μg / mL were added and incubated for 24 h. The cells were washed with pre-cooled PBS and tissue lysis buffer was added to extract total protein. After determining the protein concentration by BCA method, an equal volume of protein sample was taken for electrophoresis (140 V, 30 min) and transferred to a PVDF membrane (250 mA, 90 min). Non-specific binding sites were blocked with 5% skim milk powder for 2 h and then incubated overnight with AMPKα, NRF2, and p-P65 antibodies. The next day, the membrane was incubated with the corresponding secondary antibodies at room temperature for 1 h. Finally, chemiluminescence was used for imaging. Figure 8BC results showed significantly increased expression levels of key proteins AMPKα and NRF2, and significantly decreased expression levels of p-P65, indicating that AMPK activation can affect the nuclear translocation of NRF2 and p-P65. AMPK can rapidly reduce intracellular ROS levels, and given that ROS is an important positive regulator of the NF-κB signaling pathway, a decrease in ROS levels can subsequently inhibit NF-κB function and exert anti-inflammatory activity. Therefore, activation of the AMPK–NRF2–NF-κB signaling axis is a potential biological mechanism for KMP@Ce to treat ARDS.
[0075] Example 7: Therapeutic effect of KMP@Ce on ARDS mice
[0076] This embodiment follows ethical standards in raising C57BL / 6 mice (6-8 weeks old, male). After anesthesia with sodium pentobarbital (50 mg / kg, 3-5 min) via intraperitoneal injection, an ARDS animal model was established by intratracheal infusion of LPS (5 mg / mL) through oral intubation. KMP (5 mg / mL), Ce (5 mg / mL), and KMP@Ce (1 / 5 / 10 mg / mL) were administered to ARDS mice for 24 h. The effects of KMP, Ce, and KMP@Ce on lung histopathology, lung injury, lung dry-wet ratio, lung function, bronchoalveolar lavage fluid (BALF), and the expression levels of inflammatory factors in lung tissue were investigated to evaluate the therapeutic effect of KMP@Ce on ARDS mice. Specific steps are as follows:
[0077] (1) Twenty-four hours after drug intervention in each experimental group, mice were anesthetized and lung tissue was dissected and removed. The tissue was immediately fixed in 4% paraformaldehyde solution, and dehydrated, embedded, sectioned, and stained with hematoxylin and eosin (H&E) to observe the lung inflammation. The results are shown in the figure. Figure 9 A. LPS successfully induced a mouse ARDS model, with lung tissue exhibiting severe inflammatory cell infiltration and structural damage. The KMP, Ce, and KMP@Ce experimental groups all showed therapeutic effects, namely, compared with the LPS group, inflammatory cell infiltration was reduced and the degree of alveolar structural damage was alleviated. Among them, the KMP@Ce experimental group showed the best effect in a concentration-dependent manner, suggesting that it may exert its anti-inflammatory effect through KMP and Ce.
[0078] (2) The Smith score was used to quantitatively assess pulmonary edema, inflammation, hemorrhage, atelectasis, and hyaline membrane formation using a score of 0-4. The total score was the sum of all scores. The average score of 10 high-power fields was taken as the final score for each animal. The results are shown in […]. Figure 9B. The LPS treatment group had significantly higher lung injury scores than the control group, while the lung injury scores of each group after KMP, Ce, and KMP@Ce interventions decreased. The KMP@Ce experimental group also had significantly lower scores than the KMP and Ce experimental groups, and showed a dose-dependent improvement trend, indicating that it can effectively reduce pathological damage to lung tissue.
[0079] (3) Lung tissue was obtained as before. The wet weight and dry weight of mouse lung tissue before and after drying at 60 °C for 72 h were measured, and their ratio was calculated to assess the degree of pulmonary edema. The results are shown in […]. Figure 9 The C, LPS treatment group showed a significant increase in this ratio, while the KMP@Ce group showed a lower ratio than the KMP, Ce treatment group, indicating that pulmonary edema was greatly reduced.
[0080] (4) Twenty-four hours after drug intervention in each experimental group, mice were deeply anesthetized, their tracheas were cut open, and the flexiVent FX system for detecting animal lung function was connected. The system parameters were adjusted according to the instructions to measure two lung function indicators: airway resistance (Rrs) and lung compliance (Crs). The results are shown in the table below. Figure 9 DE, when LPS was instilled into the airways of mice, airway resistance increased and lung compliance decreased; while the KMP, Ce, and KMP@Ce experimental groups improved airway function compared with the LPS treatment group. At the same time, the KMP@Ce experimental group showed the most significant decrease in airway resistance and increase in lung compliance, indicating that KMP@Ce can effectively promote the recovery of lung function in ARDS mice through the synergistic effect of KMP and Ce.
[0081] (5) Twenty-four hours after drug intervention in each experimental group, mice were anesthetized and their lungs were perfused with PBS via endotracheal intubation. The collected BALF was centrifuged (4 ℃, 3000 g, 15 min) and the supernatant was collected. At the same time, lung tissue was obtained according to the above steps, minced and total RNA was extracted using TRIzol reagents, and cDNA was extracted strictly according to the experimental method provided by the commercially available reverse transcription kit for subsequent RT-qPCR detection. The expression levels of various inflammatory factors and oxidative stress markers in BALF and lung tissue were quantitatively analyzed using commercially available mouse IL-6, IL-1β, TNF-α, IL-10 pre-coated enzyme-linked immunosorbent assay kits, lipid peroxidation (MDA) detection kits and 8-hydroxydeoxyguanosine (8-OHdG) enzyme-linked immunosorbent assay kits. The results are shown in the figures below. Figure 9FQ and LPS stimulation led to the accumulation of large amounts of IL-6, IL-1β, TNF-α, MDA, and 8-OHdG in the lungs and BALF tissues of mice, while IL-10 decreased and increased. The KMP, Ce, and KMP@Ce experimental groups showed an inhibitory trend towards IL-6, IL-1β, TNF-α, MDA, and 8-OHdG, and a promoting trend towards IL-10, with the KMP@Ce group exhibiting a concentration-dependent effect and showing the best efficacy. These results indicate that KMP@Ce can exert anti-inflammatory and antioxidant activities through the synergistic effect of KMP and Ce, thereby exerting lung protective function. Therefore, KMP@Ce possesses good therapeutic effects for ARDS.
[0082] Example 8: Biosafety Evaluation of KMP@Ce Nanoparticles
[0083] This embodiment investigated the biosafety of KMP@Ce at both the cellular and animal levels:
[0084] (1) RAW264.7 cells in logarithmic growth phase were injected with 1×10 4 Cells were seeded in 96-well plates and incubated with different concentrations of KMP@Ce for 24 h after adhesion. Cell viability was assessed using the CCK8 assay. Results are shown below. Figure 10 A, KMP@Ce at 200 μg / mL did not significantly affect the viability of RAW264.7 cells.
[0085] (2) The ARDS mouse model was constructed as before. After intervention with different concentrations of KMP@Ce for 24 h, blood was collected from the retro-orbital venous plexus of mice and serum was obtained by centrifugation (4 ℃, 1500 g, 10 min, supernatant collected). Liver function indicators: alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) and kidney function indicators: blood urea nitrogen (BUN) and creatinine (Cr) were detected using a fully automated biochemical analyzer. The results are shown in the figure. Figure 10 BF, the therapeutic concentration of KMP@Ce used in this invention has almost no effect on the liver and kidney function of mice, and its administration can still keep the liver and kidney function indicators of mice within the normal reference range. Therefore, KMP@Ce has good biosafety.
[0086] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. The application of kaempferol cerium nanoparticles in the preparation of drugs for treating acute respiratory distress syndrome, characterized in that: The kaempferol-cerium nanoparticles are composed of kaempferol and Ce. 3+ The kaempferol and Ce are assembled through coordination. 3+ The molar ratio is 1:3, and its structural formula is shown below: 。 2. The application according to claim 1, characterized in that: The kaempferol cerium nanoparticles have a particle size of 152–158 nm.
3. The application according to claim 1, characterized in that: The preparation steps of the kaempferol cerium nanoparticles are as follows: S1: Mix PEG-8000 aqueous solution with Ce 3+ Mix the aqueous solution and deionized water, and stir continuously at 900 g for 5 min. S2: While stirring, quickly add the kaempferol ethanol solution and continue stirring for 30 min; S3: The reaction solution obtained in step S2 is centrifuged at 20 °C and 8,000 g for 10 min, the supernatant is discarded, the solution is resuspended in deionized water and washed twice by centrifugation to obtain the kaempferol cerium nanoparticles.
4. The application according to claim 1, characterized in that: The use of the kaempferol cerium nanoparticles in the preparation of pharmaceutical compositions for the treatment of acute respiratory distress syndrome.
Citation Information
Patent Citations
Nano enzyme as well as preparation method and application thereof
CN120093780A