Preparation method and application of exosome for promoting hair regeneration
By enhancing the stemness of umbilical cord mesenchymal stem cells with a traditional Chinese medicine composition and binding them to exosomes, exosomes containing drug-containing serum were prepared, solving the safety and cost issues of stem cell therapy and achieving significant hair regeneration effects.
Patent Information
- Application Number
- CN202511992658.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-26
- Publication Date
- 2026-04-17
AI Technical Summary
Existing stem cell therapies for hair loss have safety and efficacy issues, are costly, and the application of stem cell exosomes alone is not very effective, making their application difficult.
A self-prepared traditional Chinese medicine composition was used to enhance the stemness of umbilical cord mesenchymal stem cells. By combining drug-containing serum with stem cell exosomes, a drug to promote hair regeneration was prepared. The drug-containing serum produced during human administration was co-incubated with mesenchymal stem cells, which significantly improved the hair-promoting effect of exosomes.
It significantly promotes the proliferation of dermal papilla cells, improves hair regeneration, reduces the amount of exosomes required, lowers application costs, and enhances the safety and effectiveness of the therapy.
Smart Images
Figure CN121874108A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of exosome application technology, and more specifically, relates to a method for preparing and applying exosomes for promoting hair regeneration. Background Technology
[0002] Hair loss, also known as androgenetic alopecia, is a prevalent hair follicle disease worldwide, characterized by follicle miniaturization and a progressive decrease in hair density. While not life-threatening, it significantly impacts patients' mental health and quality of life. Etiologically, hair loss can be classified into androgenetic alopecia, alopecia areata, and telogen effluvium, with androgenetic alopecia being the most common. Androgenetic alopecia is a pattern of hair loss occurring in genetically susceptible individuals under the influence of androgens. Its core pathway involves the conversion of androgens (primarily testosterone) into the more potent dihydrotestosterone (DHT) by 5α-reductase (mainly type II) in the pilosebaceous unit. After DHT binds to androgen receptors in hair follicle cells, it triggers a series of pathological changes by regulating the expression of downstream genes: First, hair follicle miniaturization: DHT signaling causes hair follicles in the anagen phase to gradually shrink, and terminal hair (coarse and stiff hair) transforms into vellus hair (fine and soft downy hair); Second, growth cycle disorder: the anagen phase of hair follicles is significantly shortened, and the telogen phase is prolonged, resulting in more frequent hair loss; Third, inflammation and fibrosis: Recent studies have shown that there is microinflammatory infiltration around hair follicles, accompanied by fibrosis, which may be a key step in the permanent closure of hair follicles.
[0003] In recent years, stem cell-based therapies have become a research hotspot due to their enormous potential in hair follicle regeneration and repair. Stem cell therapy aims to fundamentally reverse the pathological process of hair follicles and achieve functional hair regeneration by supplementing, activating, or repairing these key stem cell populations. However, stem cell therapy for hair loss still faces many challenges, such as safety (tumorigenicity risk, immune rejection), efficacy (survival rate of transplanted cells), and the high cost of stem cell preparation, as well as the lack of standardization in storage and transportation.
[0004] Currently, many studies explore the use of exosomes derived from stem cells and dermal papilla cells to treat hair loss. Exosomes can treat hair loss by regulating the proliferation of various hair-related cells and inhibiting apoptosis, including dermal papilla cells, hair matrix cells, outer root sheath cells, and hair follicle stem cells, thereby promoting hair growth. However, the effectiveness of exosomes depends on the source stem cells; in existing applications, the stem cells used have poor stem cell characteristics, and the effective amount of stem cells used is enormous; furthermore, the effect of applying stem cell exosomes alone to hair regeneration is not significant, making this method costly and challenging to implement. Summary of the Invention
[0005] Based on the aforementioned deficiencies in the existing technology, the present invention first provides a traditional Chinese medicine composition for enhancing the stemness of umbilical cord mesenchymal stem cells.
[0006] A second objective of this invention is to provide the application of the above-mentioned traditional Chinese medicine composition in the preparation of umbilical cord mesenchymal stem cell exosomes.
[0007] A third objective of this invention is to provide the application of the above-mentioned umbilical cord mesenchymal stem cell exosomes in the preparation of a drug that promotes hair regeneration.
[0008] The objective of this invention is achieved through the following technical solution:
[0009] The inventive concept of this invention is as follows: The inventor formulated a traditional Chinese medicine composition for daily health care (mostly used to brew herbal tea or boil water for drinking). It was found that it had a significant effect on hair regeneration. After taking it three times a week for two months, some short hairs grew on the scalp, especially at the hairline. Based on this phenomenon, and considering the inventor's job, the inventor conceived of combining the traditional Chinese medicine composition with stem cell exosomes to investigate the effects on umbilical cord mesenchymal stem cells and hair regeneration. The research approach was to administer the traditional Chinese medicine composition to animals by gavage to produce serum containing the traditional Chinese medicine composition (hereinafter referred to as drug-containing serum). This simulated the process of humans taking traditional Chinese medicine. The drug-containing serum was added to the culture medium of mesenchymal stem cells and cultured. It was found that its ability to induce mesenchymal stem cells was enhanced, thereby affecting the function of mesenchymal stem cell exosomes.
[0010] Therefore, the present invention first protects the application of serum containing a traditional Chinese medicine composition in promoting the proliferation of umbilical cord mesenchymal stem cells, wherein the traditional Chinese medicine composition consists of 30g of Amomum villosum and 25g of Astragalus membranaceus.
[0011] This invention also protects the application of serum containing a traditional Chinese medicine composition in improving the stemness of umbilical cord mesenchymal stem cells, wherein the traditional Chinese medicine composition consists of 30g of Amomum villosum and 25g of Astragalus membranaceus.
[0012] Preferably, in the above applications, the serum containing the traditional Chinese medicine composition is obtained by collecting animal blood after administering the traditional Chinese medicine composition to an animal via gavage and then purifying it.
[0013] As a specific implementation method, the preparation process of drug-containing serum is as follows: Twenty SD rats were randomly divided into a drug-containing serum group and a blank serum group after one week of acclimatization, with 10 rats in each group. The drug-containing serum group was administered 2 mL·100g⁻¹·d⁻¹ of the traditional Chinese medicine composition by gavage, with a crude drug concentration of 0.25 g / mL; the blank serum group was administered an equal volume of 0.9% sodium chloride solution by gavage daily for 7 consecutive days. The rats were fasted for 12 hours before the last administration, but water was allowed. One hour after the last gavage, blood was aseptically collected from the heart, allowed to stand at room temperature for 1 hour, and then centrifuged at 3000 r / min for 15 min at 4 ℃. The supernatant serum was collected, sealed, and inactivated in a 56 ℃ water bath for 30 min. After filtration through a 0.22 μm sterile microporous membrane, it was stored at -80 ℃ for later use.
[0014] More specifically, the preparation of the herbal composition liquid is as follows: weigh the herbal formula (30g of Amomum villosum and 25g of Astragalus membranaceus), add 1000-1200mL of water, soak for 25-30 minutes, bring to a boil over high heat, then simmer over low heat until reduced to 500-600mL, filter while hot, concentrate the filtrate to obtain the herbal composition liquid, and determine that the crude drug concentration of the herbal composition liquid is 0.25g / mL.
[0015] Preferably, in the above application, the drug-containing serum is added to the culture medium of umbilical cord mesenchymal stem cells to enhance the stemness of mesenchymal stem cells and promote their proliferation.
[0016] Preferably, in the above applications, the amount of serum containing the traditional Chinese medicine composition added is 10%-20% of the volume of the umbilical cord mesenchymal stem cell basal culture medium.
[0017] More preferably, in the above applications, the amount of serum containing the traditional Chinese medicine composition added is 18% of the volume of the umbilical cord mesenchymal stem cell basal culture medium.
[0018] The present invention also provides a method for preparing umbilical cord mesenchymal stem cell exosomes containing drug-treated serum, which involves mixing and culturing the serum containing the traditional Chinese medicine composition with umbilical cord mesenchymal stem cells, and then separating the umbilical cord mesenchymal stem cell exosomes containing drug-treated serum.
[0019] The present invention co-incubates umbilical cord mesenchymal stem cell exosomes containing the above-mentioned drug-containing serum with dermal papilla cells and finds that it can significantly promote the proliferation of dermal papilla cells. Therefore, the present invention also protects the application of the umbilical cord mesenchymal stem cell exosomes containing the drug-containing serum in promoting the proliferation of dermal papilla cells.
[0020] When the umbilical cord mesenchymal stem cell exosomes containing the drug-containing serum were used in an animal model, it was found that they were more effective in promoting hair growth than mesenchymal stem cell exosomes alone, and required a smaller dosage. Therefore, this invention also protects the use of the umbilical cord mesenchymal stem cell exosomes containing the drug-containing serum in the preparation of drugs that promote hair growth.
[0021] Compared with the prior art, the present invention has the following beneficial effects:
[0022] This invention provides a traditional Chinese medicine composition that can be used to promote the proliferation of mesenchymal stem cells and enhance their stemness. Furthermore, this invention involves administering the traditional Chinese medicine composition to animals via gavage to produce serum containing the composition (hereinafter referred to as drug-containing serum). This simulates the process of humans taking traditional Chinese medicine. When the drug-containing serum is co-incubated with mesenchymal stem cells, the results show that it enhances the induction ability of mesenchymal stem cells, and the isolated exosomes exhibit a superior effect on promoting hair regeneration compared to normal exosomes. Attached Figure Description
[0023] Figure 1 The effect of drug-containing serum dosage on the proliferation of umbilical cord mesenchymal stem cells;
[0024] Figure 2 The effect of drug-containing serum on the expression of the stem gene OCT4 in umbilical cord mesenchymal stem cells;
[0025] Figure 3 The effect of drug-containing serum addition on the expression of the stem gene OCT4 in umbilical cord mesenchymal stem cells;
[0026] Figure 4 Electron micrographs of the prepared drug-containing serum MSCs-exo and MSCs-exo; the top image is MSCs-exo, and the bottom image is drug-containing serum MSCs-exo; the scale bar is 200 nm.
[0027] Figure 5 Cellular uptake of MSCs-exo in drug-containing serum;
[0028] Figure 6 The effect of serum MSCs-exo concentration containing the drug on dermal papilla cell proliferation;
[0029] Figure 7 The image shows the hair growth of subject 1 after applying MSCs-exo serum containing the drug; the left image is before application, and the right image is after application.
[0030] Figure 8 Hair growth in subject 2 after applying MSCs-exo serum containing the drug; Figure 8 A represents the area before application. Figure 8 B shows the hair growth effect after application; Figure 8 C is a microscopic photograph of the hair before application (magnification 30x). Figure 8 D is a microscope image of the hair after application (magnification 30x). Detailed Implementation
[0031] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific drawings and embodiments. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.
[0032] Example 1
[0033] I. Preparation of Traditional Chinese Medicine Composition Solution
[0034] Weigh out the Chinese herbal formula (30g of Amomum villosum and 25g of Astragalus membranaceus), add 1000-1200mL of water, soak for 25-30 minutes, bring to a boil over high heat, then simmer over low heat until reduced to 500-600mL and filter while hot. Concentrate the filtrate to obtain the Chinese herbal composition liquid. The concentration of the raw Chinese herbal composition liquid is 0.25g / mL.
[0035] II. Preparation of drug-containing serum
[0036] Twenty SD rats were randomly divided into a drug-containing serum group and a blank serum group after one week of acclimatization, with 10 rats in each group. The drug-containing serum group was administered 2 mL of the traditional Chinese medicine composition solution (100 g⁻¹ d⁻¹) by gavage, with a crude drug concentration of 0.25 g / mL. The blank serum group was administered an equal volume of 0.9% sodium chloride solution by gavage daily for 7 consecutive days. The rats were fasted for 12 hours before the last administration, but water was allowed. One hour after the last gavage, blood was aseptically collected from the heart, allowed to stand at room temperature for 1 hour, and then centrifuged at 3000 r / min for 15 min at 4 ℃. The supernatant serum was collected, sealed, and inactivated in a 56 ℃ water bath for 30 min. After filtration through a 0.22 μm sterile microporous membrane, it was stored at -80 ℃ for later use.
[0037] III. Effects of drug-containing serum on the stemness of umbilical cord mesenchymal stem cells
[0038] 1. Effects of drug-containing serum on the proliferation of umbilical cord mesenchymal stem cells
[0039] Umbilical cord mesenchymal stem cells were treated with 10%-20% of the volume of drug-containing serum in their basal culture medium (serum-free medium) for 24h, 48h, and 72h, respectively, followed by MTT assays. The results are as follows: Figure 1 The results showed that 10%, 15%, and 20% of the drug-containing serum all promoted the proliferation of mesenchymal stem cells, indicating that the drug-containing serum selected in this invention can significantly promote the proliferation of umbilical cord mesenchymal stem cells and is non-toxic and safe for umbilical cord mesenchymal stem cells.
[0040] 2. Effect of drug-containing serum on the expression level of OCT4 mRNA in umbilical cord mesenchymal stem cells
[0041] In the basal culture medium (serum-free medium) for umbilical cord mesenchymal stem cells, 15% of the volume of drug-containing serum was added to culture the umbilical cord mesenchymal stem cells, which served as the experimental group. Mesenchymal stem cells cultured in basal culture medium without drug-containing serum served as the control group. The expression level of the stem gene OCT4 mRNA in the experimental group and the control group was detected.
[0042] Primer sequences used for RT-PCR:
[0043] OCT4-F: GTCGCCAGAAGGGCAAAC;
[0044] OCT4R: CAGGGTGGGTGAAGTGAGGG;
[0045] RT-PCR results showed that the relative expression level of the stem cell gene OCT4 mRNA in the experimental group was significantly higher than that in the control group, indicating that the drug-containing serum used in this invention significantly increased the expression of the stem cell gene in mesenchymal stem cells, thereby promoting the stemness of umbilical cord mesenchymal stem cells. Figure 2 ).
[0046] 3. Effect of drug-containing serum dosage on the expression level of OCT4 mRNA in umbilical cord mesenchymal stem cells.
[0047] In the basal culture medium for umbilical cord mesenchymal stem cells, 15%, 16%, 17%, 18%, 19%, and 20% of the basal culture medium volume of drug-containing serum were added, respectively, to culture umbilical cord mesenchymal stem cells as experimental groups. Mesenchymal stem cells cultured in basal culture medium without drug-containing serum were used as control groups. The expression level of the stem cell gene OCT4 mRNA in the experimental and control groups was detected.
[0048] RT-PCR results showed that when the amount of drug-containing serum was 18%, the relative expression level of the stem cell gene OCT4 mRNA was the highest in mesenchymal stem cells. Figure 3 ).
[0049] In addition, from Figure 1 It can be seen that when the amount of drug-containing serum added is 15%-20%, it has little effect on the proliferation of umbilical cord mesenchymal stem cells. Considering the effect of drug-containing serum on the stemness of umbilical cord mesenchymal stem cells, in summary, the subsequent experiments of this invention used drug-containing serum with an added amount of 18% for culturing umbilical cord mesenchymal stem cells.
[0050] IV. Extraction and identification of exosomes from umbilical cord mesenchymal stem cells cultured in drug-containing serum
[0051] 1. Extraction of exosomes from umbilical cord mesenchymal stem cells containing drug-containing serum
[0052] As the experimental group, 18% of the volume of drug-containing serum was added to the basal culture medium for P3 to P5 umbilical cord mesenchymal stem cells to culture umbilical cord mesenchymal stem cells. The seeding density of umbilical cord mesenchymal stem cells was 1*10⁻⁶. 5 Cells were cultured using standard methods, with a control group included. The cells were cultured in P3 to P5 umbilical cord mesenchymal stem cell basal medium, with a seeding density of 1*102. 5 cells; routine culture.
[0053] When the cell fusion rate of the two groups reached 90%, the cells were collected separately and cultured in culture medium containing exosome-free serum for 48 h. The cell supernatant was collected, and exosomes of umbilical cord mesenchymal stem cells containing drug serum (hereinafter referred to as drug-containing serum MSCs-exo) and normal umbilical cord mesenchymal stem cell exosomes (hereinafter referred to as MSCs-exo) were extracted by low-temperature ultracentrifugation (4 ℃, 100000 g, centrifugation for 30 min).
[0054] Exosomes extracted from culture supernatant were analyzed by transmission electron microscopy (TEM). Figure 4 Observations showed that both the extracted drug-containing serum MSCs-exo and MSCs-exo exhibited typical cup-shaped bilayer membrane structures, with MSCs-exo particles having a diameter of approximately 115 nm and drug-containing serum MSCs-exo particles having a diameter of approximately 142 nm. The BCA protein concentration was measured at 1.17 ± 0.28 μg / μL for MSCs-exo and 1.63 ± 0.35 μg / μL for drug-containing serum MSCs-exo.
[0055] 2. Cell uptake assay of drug-containing serum MSCs-exo
[0056] MSCs-exo containing drug-treated serum were labeled with Dil red lipophilic dye and then co-incubated with dermal papilla cells for 24 h. The cells were then analyzed under a fluorescence microscope. Figure 5 The observation results showed that red fluorescence was distributed around blue fluorescence, indicating that Dil-labeled exosomes were located in the cytoplasm of dermal papilla cells, suggesting that drug-containing serum MSCs-exo could be internalized by dermal papilla cells, which is a prerequisite for subsequent experiments.
[0057] Example 2: Effect of drug-containing serum MSCs-exo on dermal papilla cell proliferation
[0058] Rat dermal papilla cells (generations 3-5) were seeded in 96-well plates (5000 cells / well) with five EXO concentration gradients (0, 50, 100, 200, 400 μg / ml) and replicates. The cells were incubated overnight at 37°C with 5% CO2 to allow adhesion. The culture medium was discarded, and the cells were washed three times with PBS. Then, the above-mentioned serum-containing MSCs-exo was added and incubated for 24 hours. Before detection, CCK8 reagent was added to DMEM basal medium at a 1:10 ratio, mixed well, and added to each well. The cells were incubated at 37°C for 1 hour. The absorbance at OD450 nm of the serum-containing MSCs-exo after 24 hours was measured using a microplate reader to observe dermal papilla cell proliferation.
[0059] The results showed that, compared with the control group, serum MSCs-exo containing the drug significantly promoted the proliferation of dermal papilla cells. Among them, the highest proliferation rate (118%) was observed when the serum MSCs-exo containing the drug was 100 μg / ml.
[0060] Example 3: Hair follicle growth promotion experiment using drug-containing serum MSCs-exo
[0061] C57BL / 6 purebred mice weighing 15-20g (both male and female) were used. Under mild ether anesthesia, the hair on the backs of the mice was plucked using a mixture of rosin and paraffin, covering an area of approximately 3cm × 4cm. The mice were then divided into three groups: a negative control group, an experimental group, and a positive control group. The day after hair removal, the prepared product for each experimental group was evenly applied to the plucked area on the backs of each group of mice. The dosage for the experimental group (using MSCs-exo serum containing the drug) was 10ml / kg and 5ml / kg, respectively, while the dosage for the positive control group (using MSCs-exo) was 10ml / kg and 5ml / kg, respectively. The negative control group received the same volume of physiological saline once daily for 20 consecutive days. The differences in hair growth among the groups were observed and photographed over the 20 days. After 20 days of treatment, the skin from the plucked area on the backs of the mice was collected, fixed with formalin, and used for pathological sectioning to observe hair follicle growth.
[0062] The results are shown in Table 1. Compared with the negative control group, the drug-containing serum MSCs-exo in the experimental group significantly promoted the increase in the number of hair follicles and stimulated new hair growth, showing a better effect on hair growth. In addition, the MSCs-exo in the positive control group also promoted the increase in the number of hair follicles to a certain extent, playing a positive role in hair growth. However, compared with the experimental group, at the same concentration, the hair-promoting effect of the positive control group was significantly less than that of the experimental group. The table also shows that the number of hair follicles in the 10ml / kg positive control group was roughly similar to that in the 5ml / kg experimental group. This indicates that to achieve a similar or consistent effect in promoting hair follicle growth, the dosage of the drug-containing serum MSCs-exo of this invention is much less than the dosage of MSCs-exo alone. This also shows that the drug-containing serum MSCs-exo used in this invention is superior to MSCs-exo alone in promoting hair growth. This may be related to the previously mentioned effect of the drug-containing serum enhancing the stemness of umbilical cord mesenchymal stem cells and promoting stem cell proliferation.
[0063] Table 1
[0064] Example 4: Hair growth promotion experiment using drug-containing serum MSCs-exo
[0065] Fifty patients with androgenetic alopecia were recruited, with a disease duration of 10 years and a short duration of 2 years, aged between 30 and 60 years. The drug-containing serum MSCs-exo (100 μg / ml) described in this invention was used as the test drug. Patients applied the test drug topically / sprayed it onto the affected area, 2 ml each time, twice a day (once in the morning and once in the evening). One course of treatment was 4 weeks, and 4 courses of treatment were used continuously without interruption.
[0066] Testing criteria: Significant effect: No hair loss, thick hair grows in bald and sparse areas of the scalp, gradually becoming thicker and darker; Effective: No hair loss, sparse hair grows in bald and sparse areas of the scalp; Ineffective: Hair loss occurs, no hair grows in bald areas of the scalp.
[0067] The clinical treatment of 50 patients was statistically analyzed, and the results are shown in Table 2.
[0068] Table 2
[0069] Figure 7 and Figure 8 Photos of hair growth in Subject 1 and Subject 2 before and after treatment, respectively. Figure 7 It can be seen that Subject 1 and Subject 2 had typical androgenetic alopecia symptoms before treatment. After treatment, their hair on the top of their heads grew significantly and the quality of the new hair was very good.
Claims
1. The application of serum containing a traditional Chinese medicine composition in promoting the proliferation of umbilical cord mesenchymal stem cells, characterized in that, The traditional Chinese medicine composition consists of 30g of Amomum villosum and 25g of Astragalus membranaceus.
2. The application of serum containing a traditional Chinese medicine composition in improving the stemness of umbilical cord mesenchymal stem cells, characterized in that, The traditional Chinese medicine composition consists of 30g of Amomum villosum and 25g of Astragalus membranaceus.
3. The application according to claim 1 or 2, characterized in that, The serum containing the traditional Chinese medicine composition is obtained by collecting animal blood after administering the traditional Chinese medicine composition to animals via gavage and then purifying it.
4. The application according to claim 3, characterized in that, The amount of serum containing the traditional Chinese medicine composition added is 10%-20% of the volume of the umbilical cord mesenchymal stem cell basal culture medium.
5. A method for preparing umbilical cord mesenchymal stem cell exosomes containing drug-treated serum, characterized in that, The method involves mixing and culturing the serum containing the traditional Chinese medicine composition as described in claim 4 with umbilical cord mesenchymal stem cells, and then separating the umbilical cord mesenchymal stem cell exosomes containing the drug-containing serum.
6. The use of the umbilical cord mesenchymal stem cell exosomes containing the drug-containing serum as described in claim 5 in promoting the proliferation of dermal papilla cells.
7. The use of the umbilical cord mesenchymal stem cell exosomes containing drug-containing serum as described in claim 5 in the preparation of a drug for promoting hair growth.