Isotope dilution-based DNA logic circuit for multiple output and absolute quantification

By designing DNA logic circuits encoded by lanthanides and using isotope dilution mass spectrometry, the challenges of spectral overlap interference and absolute quantification in multi-task analysis of DNA logic circuits were solved. This enabled high-accuracy analysis and absolute quantification of various cancer biomarkers (miRNAs), enhancing the potential of cancer biomarker diagnosis.

CN121933609APending Publication Date: 2026-04-28SICHUAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411506043.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-10-28
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Existing DNA logic circuits are susceptible to spectral overlap interference in multi-task analysis and are difficult to use for absolute quantitative analysis, especially in inter-laboratory comparisons and quality assurance.

Method used

A DNA logic circuit based on lanthanide element encoding was designed. Combining strand displacement reaction and isotope dilution mass spectrometry, the lanthanide element content was detected by ICPMS through targeted hybridization of target miRNA with triple-stranded DNA, thereby achieving accurate quantification of miRNAs, a variety of cancer biomarkers.

Benefits of technology

It achieves highly accurate analysis of multiple cancer biomarkers miRNA, enabling absolute quantification in actual samples, reducing matrix interference, and improving the diversity and accuracy of analytical calculations, thus providing potential application value for the diagnosis of cancer biomarkers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121933609A_ABST
    Figure CN121933609A_ABST
Patent Text Reader

Abstract

DNA logic circuits have a huge success in the past due to their unique performance in terms of scalability and computational correctness. However, DNA logic circuit-based computations still have two challenges that are often considered. Firstly, for complex multi-task analysis and output, a mainstream optical probe is often influenced by spectrum overlapping interference. Secondly, the absolute quantification result capable of being traced back to the main international unit system is impossible, especially for laboratory-to-laboratory comparison and quality assurance. In this case, a DNA logic circuit encoded by lanthanide isotope and decoded by element mass spectrometry is constructed. The 155Gd-enriched isotope and the 145Nd-enriched isotope are incorporated into a DNA logic circuit for the absolute quantification of the isotope dilution-based miRNA. The diversity and calculation precision of the isotope DNA logic circuit are greatly improved, and huge potential is provided for related diagnosis of cancer biomarkers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of analytical chemistry, specifically the field of analytical chemical sensing using inductively coupled plasma mass spectrometry (ICPMS), and particularly relates to a DNA logic circuit for multiplex analysis and absolute quantification of miRNA based on inductively coupled plasma mass spectrometry. Background Technology

[0002] Deoxyribonucleic acid (DNA) is a highly programmable biomolecule whose precise base-pairing properties allow for the construction of DNA circuits for a variety of purposes. Previous studies have demonstrated the scalability and accuracy of DNA logic circuits, showcasing their immense potential in bioanalysis. However, computation based on DNA logic circuits still faces two frequently considered challenges. First, mainstream optical probes are often affected by spectral overlap interference for complex multi-task analyses and outputs. Second, absolute quantification results traceable to major SI units are impossible, especially for interlaboratory comparisons and quality assurance. In recent years, metal isotope labeling has been successfully applied to the detection of biomolecules. Metal isotope labeling offers two main advantages. First, it allows for the simultaneous and selective detection of over 100 stable metal isotopes without the limitation of spectral overlap. Second, isotope dilution analysis can obtain isotope ratios with extremely high accuracy and precision, enabling absolute quantification analysis in major SI units. Here, we construct a DNA logic circuit encoded with lanthanide isotopes and decoded by elemental mass spectrometry. 155 Gd enriched isotopes and 145 Nd-enriched isotopes were incorporated into a DNA logic circuit for absolute quantification of miRNAs based on isotope dilution. The proposed isotope-DNA logic circuit significantly improves the diversity and accuracy of analytical computations, offering great potential for the diagnosis of cancer biomarkers. Summary of the Invention

[0003] The purpose of this invention is to provide an accurate DNA logic circuit based on lanthanide element encoding, combined with isotope dilution mass spectrometry, to achieve accurate quantification of multiple cancer biomarkers miRNA and to evaluate their application potential in real samples.

[0004] The principle of this invention is based on the principle of strand displacement reaction. By rationally designing the target miRNA to target triple-stranded DNA, the target can accurately hybridize with it. The strand displacement reaction is initiated sequentially by the target miRNA, gradually displacing the metal probe DNA strands on the triple strand. Taking the detection of liver cancer markers miR-21 and miR-223 as an example, when miR-21 is present, it first recognizes A1 through its exposed toe point, simultaneously replacing A2. Then, another toe point is exposed, and miR-223 can displace A3 on the triple strand. As the DNA logic circuit analyzes and calculates, more and more lanthanide probe DNA strands are displaced, and the lanthanide content on the magnetic beads decreases. After magnetic separation and nitration of the magnetic beads, the nitration solution is fully diluted, and the isotope content is analyzed using ICPMS. By analyzing the lanthanide content in solutions containing different concentrations of miRNA using the CPS value of ICPMS, this method achieves sensitive analysis of miRNA. Simultaneously, this DNA logic system is labeled with enriched isotopes. 155 Gd, 145 By combining Nd with isotope dilution, ratio analysis of mass numbers 155 and 157, and 145 and 146 can be performed. Using the equation, the content of miRNA in the system can be accurately calculated, achieving absolute quantification of the target without matrix interference. Attached Figure Description

[0005] This invention employs the principles of nucleic acid molecular chain substitution and isotope dilution. Leveraging the advantages of isotope tags being free from overlapping interference and isotope dilution detection providing absolute quantification, it achieves highly accurate biological analysis of various cancer biomarkers.

[0006] Figure 1 (ad) is a schematic diagram of the mechanism of the analytical method of this invention and a diagram illustrating the designed sequence. Figure 1 (e) is the sequence used in the analysis method of this invention; Figure 2 The diagram shows the construction of the system in the analytical method of this invention, including a scanning electron microscope characterization diagram of the magnetic beads after being labeled with triple-stranded DNA, an isotope distribution diagram of the magnetic beads before and after modification with triple strands, and a Zeta potential diagram of the magnetic beads before and after modification with triple strands. Figure 3 To verify the feasibility of the logic circuit in the analytical method of this invention, the following are included: (a) a schematic diagram of the chain displacement reaction mediated by dual footholds; (b) a diagram of various logic responses executed by miRNA input and element signal output; (c) an ICPMS scan of the mixed probe; (d) a YES-AND logic verification of the DNA logic circuit; and (e) a DNA gel electrophoresis characterization diagram. Figure 4(ad) is divided into a linear correlation diagram of the reaction, (e) is the cross-reactivity verification of the method of the present invention, and (f) is the specificity verification of the method of the present invention; Figure 5 This describes the performance of miRNA analysis in the analytical method of this invention. Figure 6 This is a statistical analysis of the spiked recovery results of miRNA in serum using the analytical method of this invention; Figure 7 The present invention provides the analytical methods for (a) the absolute quantitative equation for miR-223, (b) the absolute quantitative equation for miR-181a, and (c) the statistical results of the absolute quantitative results of miRNA in serum.

[0007] Figure 8 The accompanying figure is a summary diagram of the analytical method of this invention. Detailed Implementation

[0008] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. The water used in the following examples is ultrapure water, treated by a Milli-Q ultrapure water purification system.

[0009] A. Preparation of DNA-DOTA-Ln probe chains A1. Dissolve A2, A3, B2, and B3 in 0.5M NH4Ac at pH 5.6 to 100 µM. Then take 20 µL of the above DNA and mix it with excess TCEP at 37°C for 30 minutes to reduce the disulfide bonds in the DNA strand. Then purify it three times with an ultrafiltration tube. A2. MMA-DOTA and the four lanthanide chlorides used were dissolved in 0.5M NH4Ac at pH 5.6 to concentrations of 5 mM and 10 mM, respectively. Then, 10 µL of MMA-DOTA and 10 µL of the lanthanides were mixed and incubated at 37°C for 1 h. After the reaction was complete, an appropriate amount of 10 mM EDTA was added, and the reaction was continued for 15 minutes to neutralize excess metal ions. A3. Add the reduced DNA to the system and continue the reaction for 2 hours. After the reaction is complete, purify the solution 8 times using an ultrafiltration tube, and finally dilute the solution to 6 µM with TNM buffer.

[0010] B. Formation of the triple chain L3 B1. Dilute the A1 chain to 6 µM with TNM buffer; B2. Mix 6 µM A2 and A3 labeled with metal ions with an equal volume of 6 µM A1, anneal in a PCR instrument at 95℃ for 10 minutes, slowly cool to 25℃, and then keep warm for 1 hour to form triplet LA. B3. The formation conditions of LB are the same as above.

[0011] C. Fixation of the triple chain L3 C1. First, take 500 µL of 10 mg / mL magnetic microspheres MBs, wash them sequentially with solution a, solution b, and B&W buffer, then redissolve them in 2×B&W buffer to 1 mL, add the prepared triplet DNA, and react at 25℃ for 1 h. C2. After the reaction is complete, the magnetic microspheres of the two triple strands are mixed and washed, and washed at least 5 times with TNM 5 buffer; C3. Finally, resuspend in 40 mL of the above buffer solution.

[0012] D. Detection of the target object D1. Mix 20 µL of the magnetic microsphere-triplex complex MB-L3 with different concentrations of the target substance in a small centrifuge tube and dilute to a total volume of 100 µL. Then, incubate the mixture with shaking at 37 °C for 2.5 h. D2. Then perform magnetic separation, discard the supernatant, add 100 µL of 20% HNO3 to the centrifuge tube, shake and digest overnight; D3. After magnetic separation, the supernatant was diluted 5 times with water and then analyzed by ICPMS. E. ICPMS Parameter Settings and Cleaning E1. Insert the ICPMS suction pump tubing into an aqueous solution containing 1% nitric acid; E2. Set the normal mode to acquire signals from the solution, with an acquisition time of 25 ms and a sample acquisition rate of 0.25 L / min; E3. Rinse thoroughly with a 1% nitric acid solution for 5-10 minutes.

[0013] F. Quantitative analysis of CPS using ICPMS F1. Insert the ICPMS suction pump tubing into the fully diluted sample; F2. Analyze the cps value of ICPMS using the above signal acquisition parameters.

[0014] G. Spiked Recovery Experiment G1. Extract serum samples using a kit and dilute the resulting solution tenfold; G2. Add different concentrations of miRNA to the treated serum sample and react using the reaction conditions described in D above; G3. Use ICPMS for analysis.

[0015] H. Absolute Quantitative Experiment H1. Extract serum samples using a kit and dilute the resulting solution tenfold; H2. Different concentrations of miRNA were added to the treated serum samples, and the reaction was carried out using the reaction conditions described in D above; H3. Substitute the measured isotope ratio R value into the equation to calculate the content of the target substance.

[0016] Implementation Example 1: Construction of the Reaction Platform DNA labeling is accomplished through the interaction of DOTA and SH bonds, and the binding of DNA strands to magnetic beads is the result of the reaction between streptavidin and biotin. We use a variety of characterization methods to demonstrate the successful construction of the method of this invention. Figure 2 (a and b) are SEM images of magnetic beads modified with the upper triple chain L3 at different scales. Figure 2 c shows the distribution of isotopes on the magnetic beads. Meanwhile, because negatively charged DNA binds to the slightly positively charged magnetic beads... Figure 2 The Zeta potential in (d) also changed. All of these results confirm the successful modification of the probe DNA on the magnetic beads.

[0017] Implementation Example 2: Feasibility Study of the Inventive Method First, a feasibility study was conducted on the method of the present invention. Figure 3 (a) is a schematic diagram of the double-strand displacement reaction of the method of the present invention, which is initiated sequentially by two miRNAs and gradually displaces the metal isotopes from the magnetic beads. Figure 3 (b) represents the logic circuit inputs and outputs corresponding to this method. Figure 3 (c) shows the ICPMS scan spectrum of the mixed probe, illustrating that each isotope does not interfere with the others, thus enabling simultaneous multi-element detection. Figure 3 (d) Verification of the AND-YES logic gate during actual ICPMS testing using the invention method, demonstrating that miR-223 and miR-181a can only be detected after miR-21 and miR-155 activate the logic gate. Similarly, Figure 3 The gel electrophoresis diagram in (e) also confirms this conclusion.

[0018] Example 3: Exploring the experimental conditions for the method of the present invention. The main optimizations of the method of this invention include the total number of probes in the system and the reaction conditions. Figure 4 (a) Investigation into the selection of magnetic beads. As a platform carrying the reaction, magnetic beads have a significant impact on the entire reaction system. Therefore, we compared the performance of four different types of magnetic beads sold by Thermo Fisher Scientific, and finally found that MB-280 had the best reaction performance. Figure 4(b) Exploring the dosage of LA. Each milligram of 280-MB can load 200 pmol of mononucleotides. To achieve optimal analytical performance, we optimized the amount of LA required per microliter of magnetic beads, increasing the volume of 2 µM triplet LA from 2 µL to 10 µL. The results showed that the highest signal-to-noise ratio was achieved at an LA volume of 2 µL; therefore, 2 µL of LA was selected. Figure 4 (c) Investigation of the volume of MB-LA used in each sample. The volume of magnetic beads labeled with LA also affects the overall reaction, so we optimized the MB-LA volume by adding it to the system from 0.25 µL to 1.25 µL. Based on the results, we finally determined the MB-LA volume to be 0.25 µL. Figure 4 (d) represents the Na in the reaction buffer. + The concentration of Na+ in the reaction buffer was investigated. According to the principle of like-pair repulsion, negatively charged DNA molecules are difficult to hybridize. Ions from the ionization of positively charged salts in the reaction buffer help neutralize the negative charges between DNA molecules, which facilitates hybridization between the probe and target. However, excess ions in the system can also damage the original DNA structure. Therefore, we also optimized the concentration of Na+ in the reaction solution. + Based on the results, we chose 500 mM Na. + The concentration of salt ions in the buffer solution for the reaction. Figure 3 (e) shows the results of the incubation temperature investigation. At higher reaction temperatures, the strand displacement reaction occurs faster within the same time frame. Conversely, lower system temperatures result in more stable DNA double strands, making strand displacement reactions less likely. Therefore, we optimized the reaction temperature and ultimately selected 37°C as the reaction temperature for this invention. Figure 3 (f) shows the results of the incubation time study. Hybridization time is a crucial factor affecting reaction efficiency. To ensure sufficient reaction time, we investigated the reaction efficiency within the range of 60–180 minutes. The results show that the chain substitution efficiency gradually increases with increasing reaction time, reaching its maximum at 150 minutes. Therefore, we selected 150 minutes as the reaction time for this system.

[0019] Example 4: Investigating the linearity of this method after taking the logarithm of the target miRNA concentration, as well as the specificity and cross-reactivity of the reaction. The results are as follows Figure 4 and Figure 5 As shown, this invention's method simultaneously detects four cancer-related miRNAs. To verify that the four targets do not interfere with each other during detection, we performed a cross-specificity experiment. We prepared a series of mixed reaction solutions containing different targets. From the final signals of the lanthanides corresponding to different target materials, it can be seen that only the target material causes a change in the signal of the corresponding element on the magnetic beads. Figure 4e). Therefore, no cross-reactivity occurs when all four targets are detected simultaneously using this method. To test the specificity of this method for the target analytes, we selected single / double mismatched sequences and two random sequences as interfering agents for selectivity experiments. The concentration of all interfering agents was 10 times that of the target analytes. At these concentrations, we measured the cps signal of ICPMS, and the results are as follows. Figure 4 The f-values ​​show that only the target miRNA significantly reduces the lanthanide metal signal on the magnetic beads, confirming the good selectivity of this strategy. Linear processing of the lanthanide signal values ​​on the magnetic beads corresponding to different concentrations of miRNA revealed a good linear relationship between the target miRNA and the corresponding lanthanide element CPS signals. The fitted linear equation, linear range, and detection limit are shown below. Figure 5 As shown.

[0020] Example 5: Exploring the spiked recovery analysis capability of this method in real samples. To verify the applicability of this method in real samples, we performed human serum sample recovery experiments using the standard addition method. Considering the complexity and viscosity of serum samples, we first extracted the serum using a kit, and then added different concentrations of miRNA to the samples for recovery experiments. Figure 6 As shown, the recoveries for different spiked samples ranged from 91.2% to 107%, with relative standard deviations of 0.4% to 4.5%. These results demonstrate the potential of our proposed method for real-world sample analysis.

[0021] Implementation Example 6: Investigating the absolute quantitative capability of this method in real samples. After labeling artificially enriched isotopes on LA and LB plates, absolute quantification of the target can be achieved by combining isotope dilution. To verify the accuracy of the isotope dilution method, we also tested its recovery rate. The procedure was the same as for sample spike analysis. After measuring the mass number signals of 155 / 157 (Gd) and 145 / 146 (Nd) by ICPMS, the target content could be calculated using an equation to obtain the recovery rate. Figure 7 Recovery rates ranged from 92.2% to 109%, with relative standard deviations of 0.04% to 8.5%, indicating that the isotope dilution method has good accuracy. Combined with the standard curve method, the target responded to both methods, thereby reducing the misdiagnosis rate and achieving accurate cancer diagnosis.

Claims

1. A DNA logic circuit based on isotope dilution for multi-component output and absolute quantification, characterized in that: The analytical method includes a DNA logic circuit for sensitive detection of cancer biomarkers miRNA, constructed by encoding lanthanide element probes and decoding them using inductively coupled plasma mass spectrometry (ICPMS). The nucleic acid sequences in the analytical method include the target sequences miR-21, miR-223, miR-155, and miR-181a, as well as sequences A1, A2, A3, B1, B2, and B3 for binding lanthanide metals. The signal output probes in the analytical method are DNA linked to the lanthanide metal-macrocyclic compound DOTA complex via thiol groups. When the target is present, a double-strand displacement reaction occurs between the target and triple-stranded DNA L3, successively displacing the DNA strands carrying lanthanide element signals. After the magnetic beads are dissolved in 20% nitric acid, the remaining metal elements on the magnetic beads are analyzed by ICPMS.

2. The DNA logic circuit according to claim 1, characterized in that: The trivalent lanthanide ions, after complexing with DOTA, form a complex that then attaches to thiol-containing DNA via an addition reaction. After eluting off excess metal ions by centrifugation (16500 rpm), the mixture is redissolved in TNM buffer (10 mM Tris-HCl, 100 mM NaCl, 100 mM...). MgCl (pH=7.5) was used, and annealing was performed in a thermal cycler (annealing conditions: 95℃ for 10 minutes, then slowly cooled to 25℃ and held at 25℃ for 1 hour) to form LA and LB triplet complexes. Subsequently, the two triplet complexes were added separately to washed streptavidin-modified magnetic beads. Following the magnetic bead instructions, the beads were incubated at room temperature for 1 hour. Magnetic beads containing lanthanide DNA probes on their surface were obtained through the specific binding of streptavidin and biotin. By rationally designing the target miRNA targeting sequences A1 and B1, the target could accurately hybridize with them and replace A2, A3, B2, and B3, generating a lanthanide signal difference on the magnetic beads. The target sequences are: miR-21: UAGCUUAUCAGACUGAUGUUGA, miR-223: UGUCAGUUUGUCAAAUACCCCA miR-155: UUAAUGCUAAUCGUGAUAGGGGU, miR-181a: AACAUUCAACGCUGUCGGUGAGU; the sequence for constructing the triplet is: A1: 5'-biotin-(T 15 )- TCAACATCAGTCTGATAAGCTATGGGGTATTTGACAAACTGACA-(T5)-SH-3', A2: 5'- SH -(T5)-ATACCCCATAGCTTATCAG, A3: 5'- SH -(T5)- TGTCAGTTTGTCAA, B1: 5'- biotin -(T 15 )-ACCCCTATCACGATTAGCATTAAACTCACCGACAGCGTTGAATGTT-(T5)-SH-3', B2: 5'- SH -(T5)-CGGTGAGTTTAATGCTAAT, B3: 5'- SH -(T5)- AACATTCAACGCTGT.

3. The ICPMS detection method according to claim 1, characterized in that: When the target miRNA is added and the DNA logic circuit is activated, the DNA probe strand labeled with lanthanide tags is gradually displaced and becomes free in the supernatant. After magnetic separation, the magnetic beads are nitrated overnight with 20% nitric acid. After diluting the nitrated solution by a certain factor, the content of specific elements in the solution is analyzed by ICPMS with a residence time of 25 ms and a sample uptake rate of 0.25 L / min.