Starfish gender-related in del molecular marker, primer and application thereof

By designing InDel molecular markers and PCR primers for the star-spotted pufferfish, rapid and non-invasive sex identification of pufferfish was achieved, solving the problems of long detection cycles and sample damage in traditional methods, improving the efficiency of reproductive stem cell transplantation and the large-scale development of the pufferfish industry.

CN121951020BActive Publication Date: 2026-07-07YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610405059.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-03-31
Publication Date
2026-07-07
Estimated Expiration
2046-03-31

Smart Images

  • Figure CN121951020B_ABST
    Figure CN121951020B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of star point oriental tile genetic sex related InDel molecular marker, primer and its application, belong to molecular biology field, the molecular marker is located on the male DNA of star point oriental tile, the partial DNA sequence shown in the molecular marker is as shown in SEQ ID NO.1, the InDel molecular marker is a 2bp length insertion sequence, at the 35th and 36th of nucleotide sequence shown in SEQ ID NO.1, the sequence only stably exists in the genome of male individual of star point oriental tile, is deleted in the genome of female individual.This application can accurately and non-invasively identify the genetic sex of star point oriental tile fry and non-breeding season adult fish without killing experimental subjects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to an InDel molecular marker, primers, and their applications related to the genetic sex of the spotted pufferfish. Background Technology

[0002] Pufferfish are one of my country's important marine aquaculture fish species, characterized by their delicious meat, high nutritional value, and high market price. Among them, the testes (commonly known as "white milt") of male pufferfish are particularly prized for their delicious flavor and lack of tetrodotoxin, possessing extremely high edible value and economic added value, making them the most economically profitable core product in the pufferfish industry. Therefore, establishing a stable and controllable all-male population breeding technology system is an important direction for improving the economic benefits of the pufferfish industry and achieving high-quality development. Currently, the redfin pufferfish (… Takifugu rubripes ), Dark-patterned pufferfish ( Takifugu obscurus While aquaculture species such as pufferfish have established relatively mature artificial breeding systems, the lack of effective means to control the sex ratio and the excessively long breeding generation cycle severely restrict the implementation of large-scale all-male breeding. How to achieve precise sex control and efficient creation of superior germplasm has become a key technological bottleneck for the further development of the pufferfish industry.

[0003] In recent years, germ cell transplantation (GCT) has provided a new technical approach for all-male breeding of pufferfish. Pufferfish of the genus *Takifugu* belong to a typical XX / XY sex determination system. By constructing a female sterile recipient (XX) lacking endogenous germ cells, spermatogonial stem cells from a male donor (XY) are transplanted into the recipient's gonad. These cells differentiate and develop within the recipient's gonad, yielding Y-genotype eggs. Mating these eggs with normal males produces YY-genotype supermale individuals, thus enabling the targeted breeding of all-male red-finned pufferfish and significantly improving the propagation efficiency of superior male genetic material.

[0004] In this technological system, the selection of the recipient species and the sex identification of the individual recipient are crucial. *Tetraodon spp.* (Spotted pufferfish) Takifugu niphobles The small size and short sexual maturity cycle of *Pueraria spp.* make them ideal recipient materials for large-scale construction of recipient populations and reproductive stem cell transplantation, thus facilitating interspecific transplantation research in *Pueraria* species. The genetic sex of the recipient individual directly influences the differentiation direction of the donor's germ cells and the type of gametes. Therefore, accurate and rapid genetic sex identification of *Pueraria spp.* is a crucial technical step in ensuring recipient construction efficiency and improving the retrieval rate of Y-type oocytes.

[0005] However, existing sex determination methods mainly rely on gonadal histological observation, requiring dissection of samples for collection. This means that identified individuals cannot be used as live recipients for subsequent breeding or transplantation. While some SNP-based molecular identification methods have been reported, these methods rely on sequencing and have long detection cycles, making it difficult to meet the efficiency and timeliness requirements of large-scale breeding. Therefore, developing a simple and easy-to-use molecular genetic sex determination method suitable for live samples of the spotted pufferfish is of significant industrial application value for improving the efficacy of pufferfish reproductive stem cell transplantation and perfecting the all-male breeding technology system. Summary of the Invention

[0006] The purpose of this invention is to provide a rapid, non-invasive method for identifying the genetic sex of the spotted pufferfish using specific InDel molecular markers, PCR primers, and their applications.

[0007] Based on the whole genome sequencing data of the spotted pufferfish, this invention screened out a 2 bp insertion sequence that is only stably present in the male genome of the spotted pufferfish, namely the male-specific InDel (insertion / deletion) marker. Based on this, specific PCR primers were designed to verify the characteristics of the sex-difference PCR products of spotted pufferfish, which showed that the male sample had the target band, while the female sample did not.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] One objective of this invention is to provide a genetically sex-related InDel molecular marker for the spotted pufferfish. The molecular marker is located on the male DNA of the spotted pufferfish, and the partial DNA sequence containing the molecular marker is shown in SEQ ID NO.1. The InDel molecular marker is a 2bp insertion sequence located at positions 35 and 36 of the nucleotide sequence shown in SEQ ID NO.1. This sequence is stably present only in the genome of male spotted pufferfish individuals and is absent in the genome of female individuals.

[0010] The male-related gene fragment containing the molecular marker (SEQ ID NO.1):

[0011] ATCTGTCTCACAGGGTGCTGCAGGTACCTGCCTCTGTAAAGTGTTTCCATCGTTTCTTATTTTCACTTCTGGGTATGCCAACACTTGACATTCCTTCTCATTTTTGTTCTGGCAGGTATTAATCAAACAG GAAATTCAGAGAAAAAGTGGCTATGCTATTCAAGTAGACGAGGAACATCTTCGCGTGCAGCTGGACACCATTCAGTCTGAACTCAATGCCCCCACCCAGTTCAAGGTAAGTGTTTCAACATAGTAGCAGT.

[0012] The second objective of this invention is to provide a PCR primer for genetic sex identification of the spotted pufferfish, wherein the primer comprises a forward primer Primer_F and a reverse primer Primer_R, and the nucleotide sequence is as follows:

[0013] Primer_F: CTGCAGGTACCTGCCTCTG, SEQ ID NO.2;

[0014] Primer_R: CTTACCTTGAACTGGGTGGGG, SEQ ID NO.3.

[0015] The primers can amplify the sex-specific sequence of the spotted pufferfish. The 3' end of Primer_F binds to the aforementioned 2 bp male-specific InDel marker. When the male genome is used as a template, one DNA fragment can be amplified; when the female genome is used as a template, the 3' end of the primer is mismatched due to the natural deletion of this 2 bp sequence, thus failing to amplify the DNA fragment.

[0016] Furthermore, a specific amplified fragment of 224 bp in length was obtained by using the male fish genomic DNA as a template. The nucleotide sequence is shown in SEQ ID NO.4.

[0017] The third objective of this invention is to provide a method for genetic sex determination of the spotted pufferfish. Using the genome of the spotted pufferfish individual to be tested as a template, PCR amplification is performed using the aforementioned primers, and the results are determined based on the agarose gel electrophoresis of the amplification products: if a target band of 224 bp is amplified, the individual to be tested is determined to be male; if the target band is not amplified, the individual to be tested is determined to be female.

[0018] The PCR amplification reaction system consists of: PCR amplification premix, forward primer Primer_F, reverse primer Primer_R, genomic DNA template, and ddH2O. For example, a 50 μL reaction system is prepared as follows: 25 μL of 2×HyperMB Taq PCR Master Mix Pro, 1 μL of 10 μmol / L Primer_F, 1 μL of 10 μmol / L Primer_R, 1 μL of genomic DNA template, and ddH2O to a final volume of 50 μL.

[0019] The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 67.2℃ annealing for 30 s, 72℃ extension for 6 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min.

[0020] The fourth objective of this invention is to provide a kit for genetic sex determination of the spotted pufferfish, wherein the kit contains at least the PCR primers with the nucleotide sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0021] The fifth objective of this invention is to provide the application of the InDel molecular marker and the PCR primers in identifying the genetic sex of the spotted pufferfish.

[0022] The beneficial effects of this invention compared to existing technologies are as follows: This invention discloses a primer and detection method for in vivo genetic sex identification of the spotted pufferfish based on micro-InDel markers. In practical applications, only a small amount of DNA needs to be extracted from the fin rays of the spotted pufferfish for routine PCR amplification and agarose gel electrophoresis. The genetic sex can be accurately identified based on the presence of specific amplified bands on the electrophoresis gel. This technical solution avoids the limitations of traditional tissue sectioning methods and can accurately and non-invasively identify the genetic sex of spotted pufferfish fry and adult fish outside the breeding season without euthanizing the experimental subjects. The identified fish can be directly used as live recipients for subsequent transplantation operations or large-scale aquaculture. This method has significant advantages such as no need for gene sequencing, extremely high specificity, speed, low cost, and ease of operation, providing strong technical support for the use of spotted pufferfish as recipients in all-male breeding and large-scale industrial applications based on reproductive stem cell transplantation. Attached Figure Description

[0023] Figure 1 This is a schematic diagram of the male-specific InDel marker and primer design for the star-shaped pufferfish of this invention; in the diagram, the red text represents the 2 bp male-specific insertion sequence, and the sequence circled in the red dashed box is the binding region of the primer.

[0024] Figure 2This is an agarose gel electrophoresis image of the PCR products used to identify the sex of the spotted pufferfish in Example 2 of this invention; where M is a 2000 DNA Marker; lanes 1-12 are the amplification results of male spotted pufferfish samples; lanes 13-24 are the amplification results of female spotted pufferfish samples.

[0025] Figure 3 This is a verification image (H&E staining) of the gonadal histological sections of a partial sample of the star-shaped pufferfish in Example 2 of the present invention. Detailed Implementation

[0026] The technical solutions of the embodiments of the present invention will be fully described below with reference to the accompanying drawings. The described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0027] Unless otherwise specified, all reagents required for this invention are purchased from conventional commercial channels; any experimental procedures not mentioned are conventional molecular biology experimental methods in this field and will not be described in detail here.

[0028] Example 1: Screening and primer design of sex-specific InDel markers in the spotted pufferfish

[0029] (1) Screening of sex-specific InDel markers in star-spotted pufferfish

[0030] A high-throughput sequencing data analysis strategy was employed to obtain the genome sequence of *Pueraria lobata* from publicly available databases, and whole-genome resequencing data from 30 individuals of different sexes were randomly selected. Quality control and sequence alignment were performed on the data. Based on this, sex-specific variant detection and differential analysis were conducted to screen for candidate sex-specific sequence markers that were stable only in males and absent in females. The analysis results showed that a 2 bp insertion sequence (i.e., a male-specific InDel marker) was detected in the target genome region, existing only in males. Figure 1 This marker was not detected in any female samples. PCR amplification primers were designed based on this InDel marker, with the primer binding site covering the insertion region (e.g., ...). Figure 1 (As shown in the area within the red dashed box).

[0031] During PCR amplification, the 3' end of the primer can perfectly complement the template because the male individual's genome contains this specific 2 bp insertion sequence, amplifying the target band. The female individual's genome naturally lacks this 2 bp insertion sequence, so the primer cannot form an effective amplification and therefore no amplification product is produced, thus enabling the genetic sex identification of the spotted pufferfish.

[0032] Based on the above principles, the specific primer combination sequences that were determined and synthesized are shown in Table 1;

[0033] Table 1 Primer Information

[0034] ;

[0035] Using the primer combination described above, a 224 bp DNA fragment was amplified from the genome of a male *Pueraria lobata*. The nucleotide sequence of this male-specific amplification product is shown in SEQ ID NO.4.

[0036] PCR amplification product of the male gene (SEQ ID NO.4):

[0037] CTGCAGGTACCTGCCTCTGTAAAGTGTTTCCATCGTTTCTTATTTTCACTTCTGGGTATGCCAACACTTGACATTCCTTCTCATTTTTGTTCTGGCAGGTATTAATCAAACAGGAAATTCAGAGAAAAAGTGGCTATGCTATTCAAGTAGACGAGGAACATCTTCGCGTGCAGCTGGACACCATTCAGTCTGAACTCAATGCCCCCACCCAGTTCAAGGTAAG.

[0038] Example 2: Molecular identification and histological verification of sex in live spotted pufferfish

[0039] To verify the accuracy of PCR primers for genetic sex identification in spotted pufferfish, this example involved in vivo molecular testing on 24 adult spotted pufferfish, followed by comparative verification using gonadal tissue sections.

[0040] (1) Verification of genomic DNA extraction: A small amount of tail fin was cut from each of the 24 spotted pufferfish samples (numbered 1-24) and genomic DNA template was extracted using the HyperMB Extraction-Free Animal Tissue / Cell Genomic PCR Direct Amplification Kit (catalog number: B690020), as described in the kit instructions. Subsequently, the concentration of DNA and the OD260 / OD280 ratio were measured using a NanoDrop2000 micro spectrophotometer, and DNA integrity was detected by 1.0% agarose gel electrophoresis.

[0041] (2) PCR amplification: The DNA of the above 24 samples was amplified by PCR using the primers Primer_F and Primer_R designed in Example 1. The specific PCR reaction system (total volume 50 μL) is shown in Table 2. The DNA polymerase 2X HyperMBTaq PCR Master Mix Pro was purchased from Sangon Biotech (Shanghai) Co., Ltd. (Catalog No.: B690020).

[0042] Table 2 PCR reaction system

[0043] ;

[0044] Set the PCR reaction conditions according to Table 3;

[0045] Table 3 PCR reaction conditions

[0046] .

[0047] (3) Agarose gel electrophoresis and result interpretation: Take 5 μL of the above PCR amplification product and place it in a 1% agarose gel for electrophoresis separation (120V, 30 min). The lane number should be consistent with the sample number. Use a UV gel imaging system to observe and record the results. The marker used is 2000 DNA Marker, purchased from Beijing Ruiboxingke Biotechnology Co., Ltd. (product number RB-MK2).

[0048] PCR product results as follows Figure 2 As shown: lanes 1-12 show clear bands at the 224 bp position, corresponding to samples 1-12 being male spotted pufferfish samples; lanes 13-24 show bands without a target, corresponding to samples 13-24 being female spotted pufferfish samples.

[0049] (4) Verification by gonadal histological sections: To verify the accuracy of the above molecular identification results, histological sections of the gonadal tissue of 24 experimental fish were dissected. Samples 1-12 were identified as male spotted pufferfish, whose gonads were filled with seminal vesicles and spermatogenic cells at various stages; samples 13-24 were identified as female spotted pufferfish, whose gonads contained a large number of oocytes ( Figure 3 (Only representative samples are shown). The results of gonadal histological sections demonstrate that the accuracy rate of sex identification in *Pueraria lobata* is 100%, indicating that the specific InDel molecular marker and primer identification method provided by this invention can identify the genetic sex of *Pueraria lobata* individuals extremely quickly, accurately, and non-invasively.

[0050] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

Claims

1. A genetically sex-related InDel molecular marker for the spotted pufferfish, characterized in that, The molecular marker is located on the DNA of male star-spotted pufferfish. The DNA sequence of the molecular marker is shown in SEQ ID NO.

1. There is an insertion sequence of 2 bp in the DNA sequence. Specifically, the insertion is at position 35 (T) and position 36 (G) of the nucleotide sequence shown in SEQ ID NO.

1. This insertion sequence is stable only in the genome of male star-spotted pufferfish and is missing in the genome of female individuals.

2. A PCR primer for genetic sex determination of the spotted pufferfish, characterized in that, The primers are shown in SEQ ID NO.2-3.

3. A method for genetic sex determination of the spotted pufferfish, characterized in that, Using the genome of the individual *Pueraria lobata* to be tested as a template, PCR amplification was performed using the primers described in claim 2. The results were determined by agarose gel electrophoresis of the amplification products: if a 224 bp target band was amplified, the individual to be tested was determined to be male; if the target band was not amplified, the individual to be tested was determined to be female.

4. The method according to claim 3, characterized in that, The PCR amplification reaction system was prepared as follows: 25 μL of 2×HyperMB Taq PCR Master Mix Pro, 1 μL of 10 μmol / L Primer_F, 1 μL of 10 μmol / L Primer_R, 1 μL of genomic DNA template, and ddH2O to a final volume of 50 μL.

5. The method according to claim 3, characterized in that, The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 67.2℃ annealing for 30 s, 72℃ extension for 6 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min.

6. A kit for genetic sex determination of the spotted pufferfish, characterized in that, The kit contains at least the PCR primers shown in SEQ ID NO.2 and SEQ ID NO.

3.

7. The application of the InDel molecular marker of claim 1 or the PCR primer of claim 2 in identifying the genetic sex of the spotted pufferfish.

Citation Information

Patent Citations

  • Primer and method for quickly detecting gender difference of juvenile fishes of fugu rubripes

    CN103320517A

  • Molecular marker, method, primer pair, application and identification kit for intron deletion variation of sparus padus amhr2 gene

    CN117844913A