Development and application of a specific marker associated with the shell thickness trait of the Chinese mitten crab.

Abstract

This invention discloses the development and application of a specific marker associated with the shell thickness trait of the Chinese mitten crab (Eriocheir sinensis). This molecular marker is located in Chr09 of the Chinese mitten crab genome. Esine02654 The gene region exhibits significant sequence length polymorphism: the wild type contains a 72 bp nucleotide sequence, while in the mutant, this sequence is mutated to a single base A or deleted. This invention utilizes the specific design of downstream primers located within this variant region to develop a primer pair for detecting this structural variation. Amplification using this primer pair shows a specific 109 bp band in thick-shelled individuals (wild-type), while thin-shelled individuals (homozygous deletion mutant) show no amplification band due to the absence of the primer binding site. This marker detection is simple, and the results are intuitively interpreted, showing either a band or no band, making it suitable for early-stage auxiliary screening and breeding of the thick-shell trait in Chinese mitten crabs.

Description

[0001] This invention belongs to the field of aquatic animal molecular biology and genetic breeding technology, specifically relating to a species of Chinese mitten crab (Eriocheir sinensis). Eriocheir sinensis Molecular markers, detection primers, and their application in molecular-assisted breeding of structural variation (SV) related to shell thickness trait. Background Technology

[0002] Chinese mitten crab ( Eriocheir sinensis ), commonly known as river crab or hairy crab, belongs to the phylum Arthropoda, class Malacostraca, order Decapoda, family Varunidae, and genus Eriocheir (Mallotus). Eriocheir This species is mainly distributed in rivers and lakes connected to the sea along the coast of China and the Korean Peninsula. It has unique reproductive migration habits and a strong ability to adapt to the environment. It is a key species in the aquatic ecosystem and is often regarded as an important indicator organism for assessing water quality health.

[0003] As an important farmed crab species in China, the Chinese mitten crab is widely favored by consumers for its tender meat, abundant roe, and high content of high-quality protein and highly unsaturated fatty acids. In recent years, China's river crab industry has developed rapidly, with the annual output value of the entire industrial chain exceeding 300 billion yuan, forming well-known regional brands represented by Yangcheng Lake and Gucheng Lake. Furthermore, with the promotion of ecological agriculture, the "rice-crab co-cultivation" model has become an important agricultural production method. The Chinese mitten crab plays a vital ecological role in this process, controlling weeds and pests, and improving soil structure, achieving a win-win situation for both economic and ecological benefits.

[0004] In the aquaculture of Chinese mitten crabs, shell thickness is a crucial economic trait. Firstly, individuals with thicker shells typically possess stronger defensive capabilities, effectively reducing cannibalism during molting and the aquaculture process, significantly improving survival rates. Secondly, thick-shelled individuals exhibit better tolerance during long-distance transportation, reducing losses during distribution. Furthermore, shell thickness is often positively correlated with meat firmness, directly impacting the product's commercial value. However, current breeding of superior Chinese mitten crabs primarily relies on traditional population-based selection, i.e., phenotypic selection. Because shell thickness is significantly influenced by environmental factors (such as water quality, feed, and temperature), and traditional breeding methods involve long cycles and generation intervals, the selection efficiency is relatively low, failing to meet the demands of modern aquaculture for rapid improvement of superior traits.

[0005] With the development of molecular biology techniques, marker-assisted selection (MAS) has become an effective approach to solving the aforementioned problems. Among various types of genetic variation, structural variation (SV) typically refers to large-segment (usually > 50 bp) sequence variations in the genome, mainly including insertions, deletions, inversions, and translocations. Compared with the widely used single nucleotide polymorphism (SNP), structural variation often involves changes over a larger range of the genome, making it more likely to cause structural damage to gene coding regions or significant changes in the function of regulatory regions, thus producing a stronger genetic effect on the organism's phenotype.

[0006] Although there have been some reports on molecular markers in the Chinese mitten crab, there is still a lack of research on structural variation (SV) markers that have a large effect value and are easy to detect for the specific trait of shell thickness. Discovering functional SV markers closely linked to the shell thickness trait of the Chinese mitten crab and developing low-cost, high-throughput detection technologies is of significant theoretical and practical value for achieving precise breeding of superior varieties of the Chinese mitten crab, shortening the breeding cycle, and improving the economic benefits of the industry. Summary of the Invention

[0007] To address the problems existing in the prior art, the present invention aims to provide a structural variation (SV) molecular marker significantly associated with the shell thickness trait of *Eriocheir sinensis* and its application. This invention introduces the "shell thickness index (STI)" as a quantitative phenotypic standard. Based on whole-genome resequencing technology, high-depth sequencing was performed on 182 individual *Eriocheir sinensis*, and combined with a genome-wide association study (GWAS) strategy, a structural variation locus significantly associated with the shell thickness trait of *Eriocheir sinensis* was successfully screened and identified. This locus is located on chromosome 9 of the genome (version number: GCA_024679095.1), and is located at... Esine02654 Gene region. The polymorphism of this molecular marker is the deletion of a long sequence (SEQ ID NO: 1, 72 bp) in the mutant (mutated to 'A' or '*'). Statistical analysis of allele frequencies in populations with different shell thicknesses revealed that this marker is closely related to the shell thickness trait. In the thin-shelled population, the deletion type was the dominant allele; while in the thick-shelled population, the original long sequence type was the dominant allele.

[0008] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows: A structural variation molecular marker associated with the shell thickness trait of Chinese mitten crab, the nucleotide sequence of which is shown in SEQ ID NO: 1 (wild type), is used to assist in the detection and breeding of the shell thickness trait of Chinese mitten crab by identifying the above-mentioned specific DNA sequence.

[0009] The above-mentioned method for identifying the shell thickness trait of the Chinese mitten crab includes the following steps: (1) Collect the walking leg muscle tissue of Chinese mitten crab and extract the genomic DNA of Chinese mitten crab; (2) PCR amplification was performed using genomic DNA as a template; the upstream primer for the PCR amplification was shown in SEQ ID NO: 3, and the downstream primer was shown in SEQ ID NO: 4; (3) The amplification products were detected by agarose gel electrophoresis: if a specific amplification band of about 109 bp was detected, it was determined that the product carried the thick-shell dominant allele; if no specific amplification band was detected, it was determined that the product did not carry the thick-shell dominant allele.

[0010] Furthermore, the PCR amplification program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 15 sec, 35 cycles; 72℃ extension for 5 min, storage at 4℃; The PCR amplification reaction system consisted of: 10 μL of 2 × Rapid Taq Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of 50 ng / μL DNA template, and 7 μL of ultrapure water.

[0011] A primer pair for identifying the shell thickness trait of the Chinese mitten crab, wherein the upstream primer is shown in SEQ ID NO: 3 and the downstream primer is shown in SEQ ID NO: 4.

[0012] A kit for detecting the shell thickness trait of the Chinese mitten crab, the kit comprising the primer pair as described in claim 6.

[0013] Due to the adoption of the above technical solution, the advantages and positive effects of this invention are as follows: (1) This invention requires only a small amount of DNA from the walking leg muscles of the Chinese mitten crab, which can be used for genotyping via routine PCR amplification and electrophoresis. The marker is a dominant / recessive (Presence / Absence) marker, making the results extremely intuitive to interpret; (2) The identification method provided by this invention is simple to operate and low in cost. It can also accurately determine the size of Chinese mitten crab seedlings with small size and indistinct external characteristics. By carrying out early molecular-assisted selection in the seedling stage, it helps farmers to screen out superior individuals with high shell thickness potential earlier, shorten the breeding cycle, and increase the breeding yield and market value of the products. Attached Figure Description

[0014] Figure 1 This is a flowchart of the method for mining and detecting molecular markers of structural variation (SV) related to shell thickness in Chinese mitten crabs according to the present invention; Figure 2 This is a standard reference table for 20 bp DNA Ladder (Dye Plus); Figure 3 The image shows the PCR amplification electrophoresis results of the molecular marker for the shell thickness trait of the Chinese mitten crab provided in Example 2: Lane 17 is a 20 bp DNA ladder (Dye Plus); Lanes 1 to 7 correspond to thick-shelled individual samples, and the electrophoresis results all show a single specific band of about 109 bp in size, which is determined to be carrying the thick-shell dominant allele; Lanes 8 to 16 correspond to thin-shelled individual samples, and the electrophoresis results do not show a band, which is determined to be not carrying the thick-shell dominant allele; Figure 4 The electrophoresis results of the population verification of the shell thickness trait of Chinese mitten crab provided in Example 3 are shown in the figure. Lane 1 is a 20 bp DNA ladder (Dye Plus). Individuals B003, B018, B047, B303, B306, B353, B393, and B447 only amplified a single 109 bp band and were identified as carrying the thick-shell dominant allele. Individuals B032, B040, B044, B055, B448, B452, and B455 did not amplify the 109 bp specific band and were identified as not carrying the thick-shell dominant allele. Detailed Implementation

[0015] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0016] The quantitative measurement standard for shell thickness of the Chinese mitten crab (Shell Thickness Index, STI) addresses the problems of large subjective error and non-reproducibility in existing technologies that rely solely on vernier calipers to measure thickness at specific sites. This invention proposes and employs the "Shell Thickness Index." STI ( ) is used as a quantitative indicator for identifying shell thickness characteristics.

[0017] The specific measurement method is as follows: Morphological data acquisition: The cephalothorax length of the Chinese mitten crab was measured using an electronic vernier caliper (accuracy 0.01 mm). L (referring to the distance from the frontal tooth depression to the posterior margin of the cephalothorax) and the width of the cephalothorax ( W The distance at the widest point of the thoracic armor is recorded in millimeters (mm).

[0018] Shell dry weight determination: Dissect the Chinese mitten crab, completely remove the carapace from its dorsal side, remove attached connective tissue, clean with deionized water, and pat dry. Place in a 60℃ oven to dry to constant weight, and weigh the dry shell using an electronic balance (accuracy 0.01 g). M ), the unit is recorded as grams (g).

[0019] Index Calculation: The shell thickness index is calculated using the following formula:

[0020] in, STI Units are g / mm 2 , M The dry weight of the shell is (g). L The length of the cephalothorax is measured in mm. W Width of the cephalothorax (mm).

[0021] The materials involved in the following embodiments are as follows: The FastPure Blood / Cell / Tissue / Bacteria DNA Isolation Mini Kit was purchased from Vazyme, catalog number DC112; the 2 × Rapid Taq Master Mix was purchased from Vazyme, catalog number P222; and the 20 bp DNALadder (Dye Plus) was purchased from Takara, catalog number 3420A.

[0022] Whole-genome resequencing of individuals with different shell thicknesses of the Chinese mitten crab (Eriocheir sinensis) was performed using the BGI Genomics DNBSEQ-T7 sequencing platform to screen for shell thickness-specific associated fragments. Based on the association analysis results, genomic variation sites and genes were located. Esine02654A 72 bp specific fragment, SEQ ID NO: 1, was obtained. The specific steps and analysis process are as follows: Raw sequencing data of the *Eriocheir sinensis* population was obtained using PE 150 sequencing mode. FastP software was used for quality control of the raw data, removing adapter sequences and low-quality bases to obtain clean data. The clean data obtained from quality control was aligned to the *Eriocheir sinensis* reference genome (version number: GCA_024679095.1) using the MEM algorithm in BWA (v0.7.17) software, and the results were sorted and deduplicated using SAMtools (v1.9). Single-sample variant detection was performed using the HaplotypeCaller module of GATK (v4.1.8) software, and multi-sample joint genotyping was performed to obtain a population variant information file (VCF). PLINK (v1.9) was used to perform quality control filtering on the variant data. Combined with individual shell thickness phenotype data, genome-wide association analysis (GWAS) was performed using GEMMA software to locate significant differential signals on the Chr09 chromosome, thereby obtaining the correct specific structural variant (SV) sequences.

[0023] The nucleotide sequence of the specific DNA fragment is as follows: AGAGATTGGAATGACTGAAGAAATGCAGAGAAGAATGAAGGAAAATAACATGGAAGAAAGACATGAAGAAAG (SEQ ID NO: 1), the full length of this sequence is 72 bp. In mutant (thick-shelled) individuals, the above sequence is mutated to a single base A or deleted. The flowchart of the method for identifying the shell thickness trait of the Chinese mitten crab in this invention is as follows. Figure 1 As shown.

[0024] Example 1 DNA Extraction (1) Sample collection: 182 mature Chinese mitten crab individuals were selected, and their STI values ​​were measured according to the above standards. Based on the STI values, 8 thin-shelled individuals and 8 thick-shelled individuals were selected. The population originated from Yili, Xinjiang; Dongying, Shandong; Nanjing, Suzhou, and Yancheng, Jiangsu; Wuhu, Anhui; and Xiaogan, Hubei. Walking leg tissue samples were taken from the Chinese mitten crabs using the following method: The crabs were washed and each crab was placed individually in a rearing box containing aerated water. After the Chinese mitten crabs stabilized, the tips of non-functional walking legs (such as the third or fourth walking leg; damage to the walking legs has no impact on the growth and development of the crabs) were quickly cut off with scissors. Tissue samples were collected from both thin-shelled and thick-shelled individuals, flash-frozen in liquid nitrogen for 30 min, and stored in an ultra-low temperature freezer at -80℃. Thin-shelled individuals were designated Es-B, and thick-shelled individuals were designated Es-H.

[0025] Thin-shell group: Includes samples Es-B01 to Es-B09. The STI values ​​of this group are 0.001421, 0.001385, 0.001336, and 0.001347, respectively (after removing invalid data and outliers). The average shell thickness index of the samples is approximately 0.00137. g / mm 2 .

[0026] Thick-shell group: Includes samples Es-H01 to Es-H07. The STI values ​​of this group are 0.001505, 0.001482, and 0.001747, respectively (after removing invalid data and outliers). The average shell thickness index of the samples is approximately 0.00158. g / mm 2 .

[0027] Analysis of significant differences: The mean STI value of the thick-shell group (0.00158) was significantly higher than that of the thin-shell group (0.00137). P < 0.05 This confirms that the selected samples exhibit significant phenotypic differences, ensuring the high authenticity and reliability of the loci identified by GWAS analysis.

[0028] (2) Genomic DNA extraction S1: Take approximately 50 mg of walking leg muscle tissue from the Chinese mitten crab, mince it or grind it into powder using liquid nitrogen, and place it in a 1.5 mL centrifuge tube. Add 200 μL of Buffer ACL and 20 μL of Proteinase K sequentially, and vortex thoroughly to mix until there are no obvious particulate substances in the solution; S2: Place the centrifuge tube in a 56°C water bath and incubate until the tissue is completely digested (about 3 hours). During this period, the tube can be inverted and mixed several times to promote digestion. S3: Add 200 μL of Buffer BCL to the digestion solution and shake thoroughly to mix. S4: Add 150 μL of anhydrous ethanol, shake to mix. At this time, flocculent precipitate may appear. Briefly centrifuge to collect the liquid on the inner wall of the tube cap. S5: Place the FastPure gDNA Mini Columns II adsorption column into a 2 mL collection tube, and transfer the entire mixture obtained in step S4 (including the flocculent precipitate) into the adsorption column. Centrifuge at 12,000 rpm (13,400 × g) for 1 min; S6: Discard the filtrate and return the adsorption column to the collection tube. Add 500 μL of Buffer WA along the tube wall to the adsorption column and centrifuge at 12,000 rpm (13,400 × g) for 1 min; S7: Discard the filtrate and return the adsorption column to the collection tube. Add 600 μL of Buffer WB along the tube wall to the adsorption column and centrifuge at 12,000 rpm (13,400 × g) for 1 min; S8: Transfer the adsorption column to a new 1.5 mL centrifuge tube. Add 50 μL of solution buffer (preheated to 55°C) to the center of the adsorption column membrane and incubate at room temperature for 5 min. Centrifuge at 12,000 rpm (13,400 × g) for 1 min and collect the DNA product. After concentration determination and electrophoresis, store at -20°C.

[0029] Example 2: Molecular marker verification of the shell thickness trait of Chinese mitten crab Specific primer pairs were designed based on the 400 bp sequences before and after the start site of SEQ ID NO: 1. Upstream primer (Es-2654-F): GAAGTGCTGAATTTACAAGG (SEQ ID NO: 3); Downstream primer (Es-2654-R): TCTTCAGTCATTCCAATCTC (SEQ ID NO: 4); 20 µL PCR reaction system: 10 μL of 2 × Rapid Taq Master Mix, 1 μL each of 10 μM upstream and downstream primers (SEQ ID NO: 3 and SEQ ID NO: 4), 1 μL of 50 ng / μL DNA template, and 7 μL of ultrapure water; PCR reaction procedure: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 15 sec, 35 cycles; 72℃ extension for 5 min, storage at 4℃. Take 5 μL of PCR amplification product and load it onto a 5% agarose gel. Load 5 μL of 20 bp DNA ladder (Dye Plus) onto lanes 6 and 12. Electrophoresis is performed at 120 V for 30 min, and the electrophoresis results are analyzed using a Bio-Rad gel imaging system.

[0030] Identification of shell thickness trait: Individuals with a specific band size of approximately 109 bp were identified as carrying the thick-shell dominant allele of Chinese mitten crab; individuals without a specific amplified band were identified as not carrying the thick-shell dominant allele of Chinese mitten crab.

[0031] Lanes 1 to 7 correspond to thick-shelled individuals; the electrophoresis results all showed a single specific band of approximately 109 bp in size, indicating that they carried the dominant allele for thick-shelled individuals. Lanes 8 to 16 correspond to thin-shelled individuals; the electrophoresis results did not show any bands, indicating that they did not carry the dominant allele for thick-shelled individuals.

[0032] Example 3: Auxiliary screening of shell thickness trait in Chinese mitten crab seedlings (1) Sample collection: 500 individuals were randomly selected from a Chinese mitten crab population sourced from a breeding base in Gucheng Lake, Gaochun District, Nanjing City. The walking leg tissue of the Chinese mitten crabs was sampled as follows: The crabs were washed and temporarily kept in an aquarium. After the crabs stabilized, the tips of the fourth walking leg were quickly cut off with scissors. Tissue samples from all individuals were collected, flash-frozen in liquid nitrogen for 30 min, and stored in an ultra-low temperature freezer at -80℃. The samples were numbered sequentially from B000 to B499.

[0033] (2) Genomic DNA extraction: The DNA extraction process is the same as in Example 1.

[0034] (3) Determination of crab shell thickness: 20 µL PCR reaction system: 10 μL of 2 × Rapid Taq Master Mix, 1 μL each of 10 μM upstream and downstream primers (SEQ ID NO: 3 and SEQ ID NO: 4), 1 μL of 50 ng / μL DNA template, and 7 μL of ultrapure water; PCR reaction procedure: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 15 sec, 35 cycles; 72℃ extension for 5 min, storage at 4℃. Take 5 μL of PCR amplification product and load it onto a 5% agarose gel. Load 5 μL of 20 bp DNA Ladder (Dye Plus) onto lane 9, electrophoresis at 120V for 30 min, and then analyze the electrophoresis results using a BioLearning gel imaging system.

[0035] Identification of shell thickness trait: Individuals with a specific band size of approximately 109 bp were identified as carrying the thick-shell dominant allele of Chinese mitten crab; individuals without a specific amplified band were identified as not carrying the thick-shell dominant allele of Chinese mitten crab.

[0036] Group validation results as follows Figure 4As shown: Individuals B003, B018, B047, B303, B306, B353, B393, and B447 only amplified a 109 bp band, indicating they carried the thick-shell dominant allele and were used as core parents for subsequent breeding. Individuals B032, B040, B044, B055, B448, B452, and B455 did not amplify the 109 bp specific band and were identified as not carrying the thick-shell dominant allele, and were used for ordinary commercial crab farming.

[0037] (4) Retrospective verification of phenotypes after breeding: To further verify the predictive power of the above molecular markers in actual breeding parent populations, Figure 4 The parental individuals whose genotypes have been identified were mated and bred according to the breeding plan. After the parents completed their breeding tasks, the actual shell thickness phenotype of the two representative parental individuals was retrospectively dissected and measured according to the aforementioned "shell thickness index (STI)" measurement standard.

[0038] Results: The actual average shell thickness index (STI) of the reproductive individuals (B003, B018, B047, B303, B306, B353, B393, B447) identified by molecular markers as carrying the thick-shell dominant allele was 0.00160. g / mm² The groups of individuals identified as "not carrying the thick-shell dominant allele" after reproduction (B032, B040, B044, B055, B448, B452, B455) had an actual average shell thickness index of only 0.00109. g / mm² .

[0039] Verification conclusion: Statistical analysis showed that the actual STI value of the thick-shelled group selected by molecular marker screening was significantly higher than that of the thin-shelled group (P < 0.05). This phenotypic retrospective verification data highly agrees with the earlier PCR molecular marker identification results, fully demonstrating that the structural variation (SV) molecular markers developed in this invention are not only theoretically significantly correlated with shell thickness traits, but also have extremely high predictive accuracy and practical value in actual live breeding production.

[0040] The above description is merely a preferred embodiment of the present invention. All equivalent variations and modifications made within the scope of the claims of this invention should be considered within the scope of this invention. The referenced sequences are as follows: AGAGATTGGAATGACTGAAGAAATGCAGAGAAGAATGAAGGAAAATAACATGGAAGAAAGACATGAAGAAAG; The sequence SEQ ID NO: 2 is: TTTAATAGAGAAGGGGGAAGGGAAGGAGGGATGGGAGAGAAGAAAGGAAGGAAGGAGGGGAGGAAGGAGATACAGGAATGAAGGAAAAGGTATGGAGGGATGGGAGGATAGGAAAGAGGGATTGGAGATATAATAGAGGGGAGAAGGGAAGGAGGGATGGAAGAGAAGGAAGGAAGGATGGGAGGAAGAAGGGAAAGGAGTTATAACGGGAAATACACGGAGATGGAACACAAACAGATAAGAAGTGAAAAAGAAAAAAATATATATTAGCAAAAAAACATGGATATAAATTGGAGAGAAAAACAGAGGCCAGTGAAGTGCTGAATTTACAAGGAATCATTATATTCCCACGCTTTTTCTGACGTAAATAGAGCATGAAAAAGGAAGACAGATATGAAGAAAAGAGATTGGAATGACTGAAGAAATGCAGAGAAGAATGAAGGAAAATAACATGGAAGAAAGACATGAAGAAAGAAGAGAATGAAATGACAAGAAATGCGAAGAATTAAGGAAAATAATATGGAAGAAAGAAGAGAATGAAATGACTGAAGAAACGGAGAGAAAAAATCAGGAAAATAACAGGAAGACAGACGTGAAGAAAGAAGAAAATGCAGTGACTGAAGAAACGCAAAGAAGAATGAAGGAAAATAACAGGAAGACAGACATGAAGAAAGAAGAAAATGAAATGACTGAAGAAACGGAAAAATAATGAAGGAAAATAACAAGGAAGACAAACATGAAGAAAAAAGAAAATGAAATGACTGAAGAAACGGAAAGAAAAATGAAGGAAAATAACAAAG;

[0041] The sequence SEQ ID NO: 3 is: GAAGTGCTGAATTTACAAGG; The sequence SEQ ID NO: 4 is: TCTTCAGTCATTCCAATCTC.

[0042] The above are only some embodiments of the present invention and do not limit the present invention to adopt other implementation methods.

Claims

1. The development and application of a specific marker related to the shell thickness trait of the Chinese mitten crab, characterized in that: The molecular marker is located in the genome of Eriocheir sinensis and version number is GCA_024679095.1 chromosome 9 Chr09 Esine02654 gene region; the molecular marker shows sequence length polymorphism, and contains two allelic types: a wild type allelic gene containing a nucleotide sequence AGAGATTGGAATGACTGAAGAAATGCAGAGAAGAATGAAGGAAAATAACATGGAAGAAAGACATGAAGAAAG as shown in SEQ ID NO: 1, with a length of 72 bp; and a mutant allelic gene, in which the sequence of SEQ ID NO: 1 is mutated to a single base A or deleted.

2. An auxiliary detection and breeding method for the shell thickness trait of the Chinese mitten crab, characterized in that: This is achieved by identifying the specific structural variant sequence as described in claim 1.

3. The identification method according to claim 2, characterized in that, Includes the following steps: (1) Collect the walking leg muscle tissue of Chinese mitten crab and extract the genomic DNA of Chinese mitten crab; (2) PCR amplification was performed using genomic DNA as a template; the upstream primer for the PCR amplification was SEQ ID NO: 3, and the downstream primer was SEQ ID NO: 4; (3) The amplification products were detected by agarose gel electrophoresis: individuals with a specific amplification band of about 109 bp were identified as carrying the thick-shell dominant allele; individuals without a specific amplification band were identified as not carrying the thick-shell dominant allele.

4. The identification method according to claim 3, characterized in that: The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 15 sec, 35 cycles; 72℃ extension for 5 min, storage at 4℃.

5. The identification method according to claim 3, characterized in that: The PCR amplification reaction system consisted of: 10 μL of 2 × Rapid Taq Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of 50 ng / μL DNA template, and 7 μL of ultrapure water.

6. A primer pair for identifying the shell thickness trait of the Chinese mitten crab, characterized in that: The upstream primer of the primer pair is shown in SEQ ID NO: 3, and the downstream primer is shown in SEQ ID NO:

4.

7. A kit for identifying the shell thickness of the Chinese mitten crab, characterized in that: The kit contains the primer pair as described in claim 6.

Images