SV marker closely linked with eggplant brown spot resistance and application
By GWAS to locate the candidate gene evm.model.Chr11.2544 for resistance to eggplant brown spot disease and developing the SV marker, the problem of lack of markers for eggplant brown spot disease resistance was solved, thereby improving the efficiency of eggplant breeding and the accuracy of disease resistance detection.
Patent Information
- Application Number
- CN202610331394.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-18
- Publication Date
- 2026-05-05
AI Technical Summary
The lack of effective genetic research and molecular markers for resistance to brown spot disease in eggplant makes it difficult to develop resistant varieties and hinders the development of the eggplant industry.
The candidate gene evm.model.Chr11.2544 for resistance to brown spot disease in eggplant was located by GWAS, and a closely linked SV marker was developed. DNA amplification detection of eggplant samples was performed using specific primers and kits to distinguish between resistant and susceptible materials.
This study provides a theoretical basis for marker-assisted selection breeding of eggplant brown spot disease resistance, improves breeding efficiency, and enables effective screening and detection of eggplant brown spot disease resistance.
Smart Images

Figure CN121975974A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology, specifically relating to an SV marker closely linked to resistance to eggplant brown spot disease and its application. Background Technology
[0002] Eggplant brown spot disease is caused by the brown spot fungus ( Phomopsis vexans Brown spot disease, a global fungal disease caused by infection, can lead to large-scale yield reductions in eggplant. It has become one of the most devastating diseases affecting eggplant quality and yield, severely hindering the development of the eggplant industry. Resistance to eggplant brown spot is a complex trait controlled by multiple genes. However, currently, there is a lack of resistant varieties of eggplant brown spot both domestically and internationally, and research reports on the genetics of resistance, gene mapping, linkage markers, and molecular mechanisms of resistance are scarce. Therefore, identifying closely linked markers and genes for brown spot resistance and using molecular breeding techniques to select superior resistant varieties is the most effective measure for controlling brown spot. This application utilizes forward genetics (GWAS mapping) to map the resistance of eggplant brown spot to... evm.model.Chr11.2544 The study identified candidate genes for resistance to brown spot disease and conducted related analyses and molecular marker development, which can lay the foundation for marker-assisted selection breeding of eggplant resistance to brown spot disease. Summary of the Invention
[0003] To address the shortcomings of the existing technologies, this invention aims to provide an SV marker closely linked to eggplant brown spot disease resistance and its application, laying the foundation for marker-assisted selection breeding of eggplant brown spot disease resistance and improving breeding efficiency.
[0004] To solve the above problems, the present invention adopts the following technical solution: In a first aspect, the present invention provides an SV marker closely linked to resistance to eggplant brown spot disease, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0005] In a second aspect, the present invention provides a primer for detecting the SV marker, characterized in that the nucleotide sequence of the primer is shown in SEQ ID NO.2 and SEQ ID NO.3.
[0006] Thirdly, the present invention provides a kit for detecting the SV marker, characterized in that it includes the primers.
[0007] Fourthly, the present invention provides a method for screening eggplant brown spot disease resistant materials, comprising: extracting DNA from an eggplant sample, amplifying the extracted eggplant sample DNA using the primers or the kits described above, and performing electrophoretic detection; if an amplified fragment is present, the eggplant sample is a brown spot disease susceptible material, and if no amplified fragment is present, it is a brown spot disease resistant material.
[0008] Furthermore, the amplification reaction program is as follows: pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 30 s, repeated 31 times; and further extension at 72℃ for 5 min.
[0009] Fifthly, the present invention provides the application of the SV marker described herein in the screening of eggplant brown spot disease resistant materials.
[0010] Sixthly, the present invention provides the application of the SV marker in the detection of brown spot disease in eggplant.
[0011] In a seventh aspect, the present invention provides the use of the primers or the kits described herein in the preparation of reagents for detecting resistance materials to eggplant brown spot disease.
[0012] The beneficial effects of this invention are as follows: Based on the GWAS analysis of multiple variants, this invention locates the linkage sites for resistance to eggplant brown spot disease, and then screens candidate genes for resistance to eggplant brown spot disease through bioinformatics analysis such as genome sequence analysis. evm.model.Chr11.2544 Furthermore, it was determined that the molecular marker SV98755912 is highly linked to resistance; the development of specific molecular markers for SV98755912 can provide a theoretical basis and effective molecular markers for molecular breeding of eggplant brown spot disease resistance. Attached Figure Description
[0013] Figure 1 This is a map of SNP-GWAS mapping for sites related to resistance to brown spot disease in eggplant, based on multi-year, multi-location phenotype BLUE values.
[0014] Figure 2 This is an InDel-GWAS map of sites related to resistance to brown spot disease in eggplant, based on multi-year, multi-location phenotype BLUE values.
[0015] Figure 3 This is a map of SV-GWAS mapping for sites related to resistance to brown spot disease in eggplant, based on multi-year, multi-location phenotype BLUE values.
[0016] Figure 4 This is a haplotype diagram of candidate genes for resistance to brown spot disease in eggplant.
[0017] Figure 5 The image shows the electrophoretic detection results of 66 eggplant germplasm resources using the SV98755912 molecular marker. Detailed Implementation
[0018] The present invention will be further described in detail below with reference to specific embodiments.
[0019] It should be noted that these embodiments are only used to illustrate the present invention and are not intended to limit the present invention. Simple improvements to the method under the premise of the present invention are all within the scope of protection claimed by the present invention.
[0020] The molecular biology experimental techniques used in the following examples include DNA extraction, PCR amplification, gel electrophoresis, etc. Unless otherwise specified, they are usually performed according to conventional methods. For details, please refer to "Molecular Cloning: A Laboratory Manual" (3rd Edition) (translated by Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peitang et al., 2002, Beijing: Science Press), or follow the conditions recommended by the manufacturer.
[0021] Example 1 Candidate genes for resistance to eggplant brown spot disease were located based on GWAS. 1. Test materials In 2022 and 2023, at the Baiyun Base of the Guangdong Academy of Agricultural Sciences, multiple evaluations of brown spot disease resistance were conducted on 126 germplasm accessions of detached fruits using the "cross" shaped inoculation method. Before inoculation, DNA was extracted from leaves of all 126 eggplant resources using the "Universal Plant Genomic DNA Extraction Kit (200 times)" from Beijing TransGen Biotechnology Co., Ltd., and the samples were sent to the company for whole-genome resequencing. Surveys began three days after artificial inoculation with the brown spot pathogen, recording the disease incidence of each material (photographs and surveys were conducted daily). Once the disease status of each germplasm material stabilized (generally 10-14 days after inoculation), the disease index was calculated (Disease Index = ∑(Number of diseased fruits at each level × Representative value at each level) / (Total number of fruits × Highest representative value) × 100%).
[0022] 2. SNP-GWAS mapping results of candidate genes for resistance to brown spot disease in eggplant Using “S076” as the reference genome (see: https: / / db.cngb.org / data_resources / project / CNP0006177, Assembly ID: CNA0142776 SNP-GWAS analysis was performed. A linear mixed model (LMM) was used in Gemma (v.0.98.3) software with the kinship matrix (K) as a covariate for association analysis, and Manhattan plots were generated using the CMplot (v.4.4.1) package in Rstudio (v.4.3.2). The threshold for GWAS was set using the number of valid SNPs calculated in GEC (v.0.2) software to adjust the Bonferroni correction threshold (P < 1.46 × 10⁻⁶). -6 Considering that complex quantitative traits are often jointly regulated by multiple small-effect loci, a relatively lenient second threshold (P < 1 × 10⁻⁶) was adopted. -5 This is to facilitate the capture of variant sites associated with disease resistance traits.
[0023] The results showed that strong association signals were mainly identified on Chr11, with the associated region being 98694790-98977959. Analysis of significant sites (Peak point: T / C SNP: Chr11.98757246) within the Chr11 associated region and candidate genes within the strongly linked LD region indicated that the SNP with the highest P-value was directly located... evm.model.Chr11.2544 Genetically (see) Figure 1 (Table 1).
[0024] 3. InDel-GWAS mapping results of candidate genes for resistance to eggplant brown spot disease Using “S076” as the reference genome, InDel-GWAS analysis was performed (the specific analysis procedure is the same as above). The results showed that strong association signals were mainly identified at Chr11. Analysis of significant sites (AT / A InDel: Chr11.98770151) and candidate genes in strongly linked LD regions at Chr11 indicated that InDel sites are also located in… evm.model.Chr11.2544 Genetically (see) Figure 2 (Table 1).
[0025] 4. SV-GWAS mapping results of candidate genes for resistance to brown spot disease in eggplant Based on the eggplant SV dataset (see: https: / / doi.org / 10.5281 / zenodo.18425195), SV-GWAS analysis was performed (the specific analysis procedure is the same as above). The results showed that the strong association signal was mainly identified at Chr11. Analysis of significant SV sites at Chr11 (TGCTGATACTGGAGATTTCCTTTGGTATTCATCTGGATCAGGTAGCTCTCTCTCATTTCGCGTCTCCTTTGTTCTTCTTGTCCCCGTCTGACAACAACTTTGCCCTCTTACATCCCGCA / T: Chr11.98755912 119 bp) and candidate genes in strongly linked LD regions also indicated that SV is directly located at... evm.model.Chr11.2544 Genetically (see) Figure 3 (Table 1).
[0026] Table 1. Significant loci associated with brown spot disease resistance based on GWAS analysis.
[0027] Example 2 evm.model.Chr11.2544 Relationship between gene mutation and resistance to eggplant brown spot disease Based on the above SNP, InDel, and SV-GWAS analyses, they mutually validated each other. evm.model.Chr11.2544 The gene was associated with resistance to brown spot disease in eggplant populations and was identified as a candidate gene for resistance to brown spot disease in eggplant. To analyze... evm.model.Chr11.2544 How does a gene cause differences in resistance to eggplant brown spot disease? Haplotype analysis was used to investigate the relationship between gene variation and resistance to eggplant brown spot disease. A 119 bp SV (deleted sequence) Chr11:98755912 was identified as significantly associated with the phenotype, and the SV98755912 marker was highly linked to resistance to eggplant brown spot disease. Figure 4 ).
[0028] SEQ ID NO.1 (119 bp SV, Chr11:98755912): TGCTGATACTGGAGATTTCCTTTGGTATTCATCTGGATCAGGTAGCTCTCTCTCATTTCGCGTCTCCTTTGTTCTTCTTGTCCCGTCTGACAACAACTTTGCCCTCTTACATCCCGCA.
[0029] Example 3 Development and validation of SV98755912 molecular markers Based on the SV98755912 sequence information, primers were designed using the Primer3Plus website for a 119 bp sequence (500 bp amplified upstream and downstream from the SV98755912-119bp sequence). After design, the primers were aligned to the eggplant genome to determine the sequence specificity of the amplified target fragment. The primer sequences are: SV98755912-F (SEQ ID NO.2): 5'-CCGAGTGCTCTCCATGTTGT-3' and SV98755912-R (SEQ ID NO.3): 5'-GCACCTCGAACCATGGAAGA-3'. The amplification system consisted of 20 μL: 8 μL ddH2O, 10 μL PCR mix (Genstar), 0.5 μL primer SV98755912-F (10 μmol / L), 0.5 μL primer SV98755912-R (10 μmol / L), and 1 μL DNA template (500 ng / μL). The PCR reaction program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, for 31 cycles; and a final extension at 72℃ for 5 min. After the reaction, 5 μL of the product was electrophoresed on 1% agarose gel, stained with Goldview, and observed and photographed using a gel imaging system. Based on the electrophoresis results, SV98755912-F (SEQ ID NO.2) and SV98755912-R (SEQ ID NO.3) could distinguish the resistant and susceptible phenotypes of 66 natural populations, i.e., the material with amplified fragments was susceptible to brown spot disease, and the material without amplified fragments was resistant to brown spot disease (see [link to electrophoresis results]). Figure 5 (See Table 2). It was finally determined to be a specific primer for amplifying the SV98755912 fragment and can be used to detect eggplant materials resistant to brown spot disease.
[0030] Table 2. Detection results of the SV98755912 molecular marker in 66 eggplant germplasm resources.
[0031] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described with reference to preferred embodiments, those skilled in the art should understand that various changes in form and detail can be made without departing from the spirit and scope of the invention as defined in the appended claims.
Claims
1. An SV marker closely linked to resistance to eggplant brown spot disease, characterized in that, The nucleotide sequence of the SV marker is shown in SEQ ID NO.
1.
2. A primer for detecting the SV marker of claim 1, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.
3.
3. A kit for detecting the SV marker of claim 1, characterized in that, Includes the primers described in claim 2.
4. A method for screening eggplant brown spot disease resistant materials, characterized in that, include: DNA was extracted from eggplant samples, and the extracted DNA was amplified using the primers described in claim 2 or the kit described in claim 3, followed by electrophoresis detection. If an amplified fragment was present, the eggplant sample was considered susceptible to brown spot disease; otherwise, it was considered resistant to brown spot disease.
5. The method for screening eggplant brown spot disease resistant materials according to claim 4, characterized in that, The amplification reaction program is as follows: pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 30 s, repeated 31 times; and further extension at 72℃ for 5 min.
6. The application of the SV marker as described in claim 1 in the screening of eggplant brown spot disease resistant materials.
7. The application of the SV marker as described in claim 1 in the detection of brown spot disease in eggplant.
8. The use of the primers of claim 2 or the kit of claim 3 in the preparation of reagents for detecting resistance materials to eggplant brown spot disease.