Compositions and methods for inhibiting amyloid precursor protein (APP) expression
By designing APP RNAi agents and using dsRNA to inhibit APP gene expression, the limitations of existing treatment options and toxicity issues have been addressed, enabling effective prevention and treatment of APP-related diseases.
Patent Information
- Application Number
- CN202480063300.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-12-05
- Filing Date
- 2024-10-09
- Publication Date
- 2026-05-08
AI Technical Summary
Existing treatment options for APP-related diseases and symptoms are limited and mostly ineffective, especially when the disease progresses. Existing drugs are only used for symptom treatment rather than prevention or cure, and human gamma-secretase inhibitors have toxicity issues.
Provides APP RNAi agents, including double-stranded ribonucleic acid (dsRNA), which selectively inhibit APP gene expression and reduce APP levels through the design of sense and antisense strands.
Effectively inhibiting APP gene expression and blocking or suppressing the production of Aβ cleavage forms provides a novel therapy for the prevention or treatment of APP-related diseases, avoiding the limitations and toxicity issues of existing treatments.
Smart Images

Figure SMS_2 
Figure SMS_3 
Figure SMS_4
Abstract
Description
[0001] Invention Technology
[0002] This invention relates in part to compositions and methods that can be used to suppress the expression of amyloid precursor (APP) genes. Technical Background
[0003] The precursor amyloid (APP) gene encodes an integrated membrane protein expressed in neurons and glial cells. While the primary function of APP remains unclear, it is of great interest in current Alzheimer's disease (AD) research because aberrant APP processing leads to the production and accumulation of the neurotoxic peptide amyloid-β (Aβ). Aβ is generated from β-amyloid precursor (APP) via sequential cleavage by a β-secretase complex followed by a γ-secretase complex. In addition to its close involvement in AD pathogenesis, APP is also involved in various cellular activities that promote brain development and function. Inhibiting APP expression and / or activity can block or suppress the production and / or levels of cleaved Aβ forms of APP, potentially for the prevention or treatment of various APP-related diseases and conditions, such as AD, cerebral amyloid angiopathy (CAA), and early-onset familial Alzheimer's disease (EOFAD or eFAD). Currently, treatment options for APP-related diseases and conditions are limited and mostly ineffective. For example, many Aβ-guided immunotherapies are in different stages of development, while many human gamma-secretase inhibitor programs have been discontinued due to toxicity. To date, approved pharmacological treatments for APP-related diseases or disorders are intended to treat symptoms only, not to prevent or cure them, and the efficacy of such treatments is limited, especially when APP-related diseases or disorders develop in affected individuals.
[0004] Therefore, novel therapies targeting APP represent a new approach to reducing APP levels and treating APP-related diseases such as Alzheimer's disease. Summary of the Invention
[0005] In summary, this invention provides novel APP gene-specific RNAi agents, compositions comprising APP RNAi agents, and methods for inhibiting APP gene expression in vitro and / or in vivo using the APP RNAi agents described herein and compositions comprising APP RNAi agents. The APP RNAi agents described herein can selectively and effectively reduce, inhibit, or silence APP gene expression in subjects (e.g., human or animal subjects).
[0006] According to one aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of amyloid precursor (APP) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 1, 3 or 5 by no more than 1, 2 or 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 2, 4 or 6 by no more than 1, 2 or 3 nucleotides, wherein the sense strand and the antisense strand may be partially, substantially or completely complementary.
[0007] In some embodiments, the APP mRNA transcript is SEQ ID NO: 1.
[0008] In some embodiments, the target region of the APP mRNA transcript is SEQ ID. Any of the following nucleotide sequences in NO:1: 378-398, 383-403, 391-411, 472-492, 499-519, 535-555, 536-556, 537-557, 539-559, 542-562, 561-581, 684-704, 723-743, 724-744, 725-745, 808-828, 809-829, 810-830, 811-831, 812-832, 813-833, 814-834, 817-837, 868-888, 1264-1284, 1368-1388, 1405-1425, 1406 -1426, 1407-1427, 1416-1436, 1417-1437, 1426-1446, 1427-1447, 1428-1448, 1434-1454, 1456-1476, 1458-1478, 1461-1481, 1462-1482, 1463-1483, 1465-1485, 1529-1549, 1608-1628, 1609-1629, 1611-1631, 1612-1632, 1675-1695, 1744-1764, 1818-1838, 1819-1839, 1820-1840, 1821-1 841, 1822-1842, 1833-1853, 1854-1874, 1856-1876, 1857-1877, 1861-1881, 1862-1882, 1876-1896, 1877-1897, 1878-1898, 1879-1899, 1885-1905, 1893-1913, 1895-1915, 1899-1919, 1900-1920, 1901-1921, 1934-1954, 1935-1955, 2038-2058, 2039-2059, 2111-2131, 2115-2135, 2116-213 6. 2138-2158, 2139-2159, 2302-2322, 2335-2355, 2422-2442, 2437-2457, 2443-2463, 2444-2464, 2471-2491, 2473-2493, 2488-2508, 2492-2512, 2495-2515, 2518-2538, 2521-2541, 2562-2582, 2571-2591, 2587-2607, 2590-2610, 2594-2614, 2608-2628, 2614-2634, 2682-2702, 2686-27062710-2730、2711-2731、2712-2732、2714-2734、2715-2735、2716-2736、2720-2740、2731-2751、2732-2752、2733-2753、2737-2757、2742-2762、2743-2763、2744-2764、2745-2765、2746-2766、2750-2770、2782-2802、1178-1198、1220-1240、1969-1989、2186-2206、2329-2349、373-393、384-404、385-405、390-410、392-412、393-413、428-448、498-518、501-521、519-539、520-540、540-560、541-561、543-563、544-564、633-653、634-654、635-655、643-663、695-715、720-740、721-741、726-746、728-748、804-824、805-825、871-891、895-915、996-1016、1315-1335、1374-1394、1408-1428、1411-1431、1415-1435、1423-1443、1424-1444、1425-1445、1432-1452、1457-1477、1459-1479、1460-1480、1761-1781、1779-1799、1816-1836、1825-1845、1841-1861、1849-1869、1852-1872、1853-1873、1869-1889、1879-1899、1881-1901、1882-1902、1892-1912、1894-1914、1896-1916、1901-1921、1902-1922、1904-1924、1933-1953、1936-1956、1983-2003、2040-2060、2112-2132、2116-2136、2117-2137、2140-2160、2142-2162、2289-2309、2292-2312、2296-2316、2297-2317、2304-2324、2341-2361、2421-2441、2423-2443、2424-2444、2427-2447、2428-2448、2430-2450、2435-2455、2479-2499、2487-2507、2494-2514、2498-2518、2515-2535、2517-2537、2520-2540、2559-2579、2560-2580、2561-2581、2564-2584、2567-2587、2570-2590、2572-2592、2573-2593、2574-2594、2577-2597、2585-2605、2586-2606、2597-2617、2598-2618、2599-2619、2601-2621、2604-2624、2605-2625、2615-2635、2616-2636、2617-2637、2618-2638、2637-2657、2656-2676、2657-2677、2658-2678、2659-2679、2662-2682、2690-2710、2691-2711、2695-2715、2697-2717、2699-2719、2700-2720、2701-2721、2705-2725、2708-2728、2709-2729、2713-2733、2718-2738、2721-2741、2724-2744、2725-2745、2726-2746、2730-2750、2734-2754、2735-2755、2739-2759、2748-2768、2751-2771、2753-2773、2754-2774、2755-2775、2756-2776、2780-2800、2782-2802、379-397、374-392、384-402、385-403、386-404、391-409、392-410、393-411、394-412、429-447、473-491、499-517、500-518、502-520、520-538、521-539、536-554、537-555、538-556、540-558、541-559、542-560、543-561、544-562、545-563、562-580、634-652、635-653、636-654、644-662、685-703、696-714、721-739、722-740、724-742、725-743、726-744、727-745、729-747、805-823、806-824、809-827、810-828、811-829、812-830、813-831、814-832、815-833、818-836、869-887、872-890、896-914、997-1015、1179-1197、1221-1239、1265-1283、1316-1334、1369-1387、1375-1393、1406-1424、1407-1425、1408-1426、1409-1427、1412-1430、1416-1434、1417-1435、1418-1436、1424-1442、1425-1443、1426-1444、1427-1445、1428-1446、1429-1447、1433-1451、1435-1453、1457-1475、1458-1476、1459-1477、1460-1478、1461-1479、1462-1480、1463-1481、1464-1482、1466-1484、1530-1548、1609-1627、1610-1628、1612-1630、1613-1631、1676-1694、1745-1763、1762-1780、1780-1798、1817-1835、1819-1837、1820-1838、1821-1839、1822-1840、1823-1841、1826-1844、1834-1852、1842-1860、1850-1868、1853-1871、1854-1872、1855-1873、1857-1875、1858-1876、1862-1880、1863-1881、1870-1888、1877-1895、1878-1896、1879-1897、1880-1898、1882-1900、1883-1901、1886-1904、1893-1911、1894-1912、1895-1913、1896-1914、1897-1915、1900-1918、1901-1919、1902-1920、1903-1921、1905-1923、1934-1952、1935-1953、1936-1954、1937-1955、1970-1988、1984-2002、2039-2057、2040-2058、2041-2059、2112-2130、2113-2131、2116-2134、2117-2135、2118-2136、2139-2157、2140-2158、2141-2159、2143-2161、2187-2205、2290-2308、2293-2311、2297-2315、2298-2316、2303-2321、2305-2323、2330-2348、2336-2354、2342-2360、2422-2440、2423-2441、2424-2442、2425-2443、2428-2446、2429-2447、2431-2449、2436-2454、2438-2456、2444-2462、2445-2463、2472-2490、2474-2492、2480-2498、2488-2506、2489-2507、2493-2511、2495-2513、2496-2514、2499-2517、2516-2534、2518-2536、2519-2537、2521-2539、2522-2540、2560-2578、2561-2579、2562-2580、2563-2581、2565-2583、2568-2586、2571-2589、2572-2590、2573-2591、2574-2592、2575-2593、2578-2596、2586-2604、2587-2605、2588-2606、2591-2609、2595-2613、2598-2616、2599-2617、2600-2618、2602-2620、2605-2623、2606-2624、2609-2627、2615-2633、2616-2634、2617-2635、2618-2636、2619-2637、2638-2656、2657-2675、2658-2676、2659-2677、2660-2678、2663-2681、2683-2701、2687-2705、2691-2709、2692-2710、2696-2714、2698-2716、2700-2718、2701-2719、2702-2720、2706-2724、2709-2727、2710-2728、2711-2729、2712-2730、2713-2731、2714-2732、2715-2733、2716-2734、2717-2735、2719-2737、2721-2739、2722-2740、2725-2743、2726-2744、2727-2745、2731-2749、2732-2750、2733-2751、2734-2752、2735-2753、2736-2754、2738-2756、2740-2758、2743-2761、2744-2762、2745-2763、2746-2764、2747-2765、2749-2767、2751-2769、2752-2770、2754-2772、2755-2773、2756-2774、2757-2775、2781-2799、2783-2801、376-400、371-395、381-405、382-406、383-407、388-412、389-413、390-414、391-415、426-450、470-494、496-520、497-521、499-523、517-541、518-542、533-557、534-558、535-559、537-561、538-562、539-563、540-564、541-565、542-566、559-583、631-655、632-656、633-657、641-665、682-706、693-717、718-742、719-743、721-745、722-746、723-747、724-748、726-750、802-826、803-827、806-830、807-831、808-832、809-833、810-834、811-835、812-836、815-839、866-890、869-893、893-917、994-1018、1176-1200、1218-1242、1262-1286、1313-1337、1366-1390、1372-1396、1403-1427、1404-1428、1405-1429、1406-1430、1409-1433、1413-1437、1414-1438、1415-1439、1421-1445、1422-1446、1423-1447、1424-1448、1425-1449、1426-1450、1430-1454、1432-1456、1454-1478、1455-1479、1456-1480、1457-1481、1458-1482、1459-1483、1460-1484、1461-1485、1463-1487、1527-1551、1606-1630、1607-1631、1609-1633、1610-1634、1673-1697、1742-1766、1759-1783、1777-1801、1814-1838、1816-1840、1817-1841、1818-1842、1819-1843、1820-1844、1823-1847、1831-1855、1839-1863、1847-1871、1850-1874、1851-1875、1852-1876、1854-1878、1855-1879、1859-1883、1860-1884、1867-1891、1874-1898、1875-1899、1876-1900、1877-1901、1879-1903、1880-1904、1883-1907、1890-1914、1891-1915、1892-1916、1893-1917、1894-1918、1897-1921、1898-1922、1899-1923、1900-1924、1902-1926、1931-1955、1932-1956、1933-1957、1934-1958、1967-1991、1981-2005、2036-2060、2037-2061、2038-2062、2109-2133、2110-2134、2113-2137、2114-2138、2115-2139、2136-2160、2137-2161、2138-2162、2140-2164、2184-2208、2287-2311、2290-2314、2294-2318、2295-2319、2300-2324、2302-2326、2327-2351、2333-2357、2339-2363、2419-2443、2420-2444、2421-2445、2422-2446、2425-2449、2426-2450、2428-2452、2433-2457、2435-2459、2441-2465、2442-2466、2469-2493、2471-2495、2477-2501、2485-2509、2486-2510、2490-2514、2492-2516、2493-2517、2496-2520、2513-2537、2515-2539、2516-2540、2518-2542、2519-2543、2557-2581、2558-2582、2559-2583、2560-2584、2562-2586、2565-2589、2568-2592、2569-2593、2570-2594、2571-2595、2572-2596、2575-2599、2583-2607、2584-2608、2585-2609、2588-2612、2592-2616、2595-2619、2596-2620、2597-2621、2599-2623、2602-2626、2603-2627、2606-2630、2612-2636、2613-2637、2614-2638、2615-2639、2616-2640、2635-2659、2654-2678、2655-2679、2656-2680、2657-2681、2660-2684、2680-2704、2684-2708、2688-2712、2689-2713、2693-2717、2695-2719、2697-2721、2698-2722、2699-2723、2703-2727、2706-2730、2707-2731、2708-2732、2709-2733、2710-2734、2711-2735、2712-2736、2713-2737、2714-2738、2716-2740、2718-2742、2719-2743、2722-2746、2723-2747、2724-2748、2728-2752、2729-2753、2730-2754、2731-2755、2732-2756、2733-2757、2735-2759、2737-2761、2740-2764、2741-2765、2742-2766、2743-2767、2744-2768、2746-2770、2748-2772、2749-2773、2751-2775、2752-2776、2753-2777、2754-2778、2778-2802、2780-2804、373-403、368-398、378-408、379-409、380-410、385-415、386-416、387-417、388-418、423-453、467-497、493-523、494-524、496-526、514-544、515-545、530-560、531-561、532-562、534-564、535-565、536-566、537-567、538-568、539-569、556-586、628-658、629-659、630-660、638-668、679-709、690-720、715-745、716-746、718-748、719-749、720-750、721-751、723-753、799-829、800-830、803-833、804-834、805-835、806-836、807-837、808-838、809-839、812-842、863-893、866-896、890-920、991-1021、1173-1203、1215-1245、1259-1289、1310-1340、1363-1393、1369-1399、1400-1430、1401-1431、1402-1432、1403-1433、1406-1436、1410-1440、1411-1441、1412-1442、1418-1448、1419-1449、1420-1450、1421-1451、1422-1452、1423-1453、1427-1457、1429-1459、1451-1481、1452-1482、1453-1483、1454-1484、1455-1485、1456-1486、1457-1487、1458-1488、1460-1490、1524-1554、1603-1633、1604-1634、1606-1636、1607-1637、1670-1700、1739-1769、1756-1786、1774-1804、1811-1841、1813-1843、1814-1844、1815-1845、1816-1846、1817-1847、1820-1850、1828-1858、1836-1866、1844-1874、1847-1877、1848-1878、1849-1879、1851-1881、1852-1882、1856-1886、1857-1887、1864-1894、1871-1901、1872-1902、1873-1903、1874-1904、1876-1906、1877-1907、1880-1910、1887-1917、1888-1918、1889-1919、1890-1920、1891-1921、1894-1924、1895-1925、1896-1926、1897-1927、1899-1929、1928-1958、1929-1959、1930-1960、1931-1961、1964-1994、1978-2008、2033-2063、2034-2064、2035-2065、2106-2136、2107-2137、2110-2140、2111-2141、2112-2142、2133-2163、2134-2164、2135-2165、2137-2167、2181-2211、2284-2314、2287-2317、2291-2321、2292-2322、2297-2327、2299-2329、2324-2354、2330-2360、2336-2366、2416-2446、2417-2447、2418-2448、2419-2449、2422-2452、2423-2453、2425-2455、2430-2460、2432-2462、2438-2468、2439-2469、2466-2496、2468-2498、2474-2504、2482-2512、2483-2513、2487-2517、2489-2519、2490-2520、2493-2523、2510-2540、2512-2542、2513-2543、2515-2545、2516-2546、2554-2584、2555-2585、2556-2586、2557-2587、2559-2589、2562-2592、2565-2595、2566-2596、2567-2597、2568-2598、2569-2599、2572-2602、2580-2610、2581-2611、2582-2612、2585-2615、2589-2619、2592-2622、2593-2623、2594-2624、2596-2626、2599-2629、2600-2630、2603-2633、2609-2639、2610-2640、2611-2641、2612-2642、2613-2643、2632-2662、2651-2681、2652-2682、2653-2683、2654-2684、2657-2687、2677-2707、2681-2711、2685-2715、2686-2716、2690-2720、2692-2722、2694-2724、2695-2725、2696-2726、2700-2730、2703-2733、2704-2734、2705-2735、2706-2736、2707-2737、2708-2738、2709-2739、2710-2740、2711-2741、2713-2743、2715-2745、2716-2746、2719-2749、2720-2750、2721-2751、2725-2755、2726-2756, 2727-2757, 2728-2758, 2729-2759, 2730-2760, 2732-2762, 2734-2764, 2737-2767, 2738-2768, 2739-2769, 2740-2770, 2741-2771, 2743-2773, 2745-2775, 2746-2776, 2748-2778, 2749-2779, 2750-2780, 2751-2781, 2775-2805, or 2777-2807.
[0009] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand includes a region complementary to the mRNA portion encoding APP, the complementary region comprising at least 15, 16, 17, 18, or 19 consecutive nucleotides, the consecutive nucleotides differing from the complementary sequence of any nucleotide sequence in SEQ ID NO:1 by no more than 0, 1, 2, or 3. Nucleotides: 378-398, 383-403, 391-411, 472-492, 499-519, 535-555, 536-556, 537-557, 539-559, 542-562, 561-581, 684-704, 723-743, 724-744, 725-745, 808-828, 809-829, 810-830, 811-831, 812-832, 813-833, 814-834, 817-837, 868-888, 1264-1284, 1368 -1388, 1405-1425, 1406-1426, 1407-1427, 1416-1436, 1417-1437, 1426-1446, 1427-1447, 1428-1448, 1434-1454, 1456-1476, 1458-1478, 1461-1481, 1462-1482, 1463-1483, 1465-1485, 1529-1549, 1608-1628, 1609-1629, 1611-1631, 1612-1632, 1675-1 695, 1744-1764, 1818-1838, 1819-1839, 1820-1840, 1821-1841, 1822-1842, 1833-1853, 1854-1874, 1856-1876, 1857-1877, 1861-1881, 1862-1882, 1876-1896, 1877-1897, 1878-1898, 1879-1899, 1885-1905, 1893-1913, 1895-1915, 1899-1919, 1900-192 0, 1901-1921, 1934-1954, 1935-1955, 2038-2058, 2039-2059, 2111-2131, 2115-2135, 2116-2136, 2138-2158, 2139-2159, 2302-2322, 2335-2355, 2422-2442, 2437-2457, 2443-2463, 2444-2464, 2471-2491, 2473-2493, 2488-2508, 2492-2512, 2495-2515,2518-2538、2521-2541、2562-2582、2571-2591、2587-2607、2590-2610、2594-2614、2608-2628、2614-2634、2682-2702、2686-2706、2710-2730、2711-2731、2712-2732、2714-2734、2715-2735、2716-2736、2720-2740、2731-2751、2732-2752、2733-2753、2737-2757、2742-2762、2743-2763、2744-2764、2745-2765、2746-2766、2750-2770、2782-2802、1178-1198、1220-1240、1969-1989、2186-2206、2329-2349、373-393、384-404、385-405、390-410、392-412、393-413、428-448、498-518、501-521、519-539、520-540、540-560、541-561、543-563、544-564、633-653、634-654、635-655、643-663、695-715、720-740、721-741、726-746、728-748、804-824、805-825、871-891、895-915、996-1016、1315-1335、1374-1394、1408-1428、1411-1431、1415-1435、1423-1443、1424-1444、1425-1445、1432-1452、1457-1477、1459-1479、1460-1480、1761-1781、1779-1799、1816-1836、1825-1845、1841-1861、1849-1869、1852-1872、1853-1873、1869-1889、1879-1899、1881-1901、1882-1902、1892-1912、1894-1914、1896-1916、1901-1921、1902-1922、1904-1924、1933-1953、1936-1956、1983-2003、2040-2060、2112-2132、2116-2136、2117-2137、2140-2160、2142-2162、2289-2309、2292-2312、2296-2316、2297-2317、2304-2324、2341-2361、2421-2441、2423-2443、2424-2444、2427-2447、2428-2448、2430-2450、2435-2455、2479-2499、2487-2507、2494-2514、2498-2518、2515-2535、2517-2537、2520-2540、2559-2579、2560-2580、2561-2581、2564-2584、2567-2587、2570-2590、2572-2592、2573-2593、2574-2594、2577-2597、2585-2605、2586-2606、2597-2617、2598-2618、2599-2619、2601-2621、2604-2624、2605-2625、2615-2635、2616-2636、2617-2637、2618-2638、2637-2657、2656-2676、2657-2677、2658-2678、2659-2679、2662-2682、2690-2710、2691-2711、2695-2715、2697-2717、2699-2719、2700-2720、2701-2721、2705-2725、2708-2728、2709-2729、2713-2733、2718-2738、2721-2741、2724-2744、2725-2745、2726-2746、2730-2750、2734-2754、2735-2755、2739-2759、2748-2768、2751-2771、2753-2773、2754-2774、2755-2775、2756-2776、2780-2800、2782-2802、379-397、374-392、384-402、385-403、386-404、391-409、392-410、393-411、394-412、429-447、473-491、499-517、500-518、502-520、520-538、521-539、536-554、537-555、538-556、540-558、541-559、542-560、543-561、544-562、545-563、562-580、634-652、635-653、636-654、644-662、685-703、696-714、721-739、722-740、724-742、725-743、726-744、727-745、729-747、805-823、806-824、809-827、810-828、811-829、812-830、813-831、814-832、815-833、818-836、869-887、872-890、896-914、997-1015、1179-1197、1221-1239、1265-1283、1316-1334、1369-1387、1375-1393、1406-1424、1407-1425、1408-1426、1409-1427、1412-1430、1416-1434、1417-1435、1418-1436、1424-1442、1425-1443、1426-1444、1427-1445、1428-1446、1429-1447、1433-1451、1435-1453、1457-1475、1458-1476、1459-1477、1460-1478、1461-1479、1462-1480、1463-1481、1464-1482、1466-1484、1530-1548、1609-1627、1610-1628、1612-1630、1613-1631、1676-1694、1745-1763、1762-1780、1780-1798、1817-1835、1819-1837、1820-1838、1821-1839、1822-1840、1823-1841、1826-1844、1834-1852、1842-1860、1850-1868、1853-1871、1854-1872、1855-1873、1857-1875、1858-1876、1862-1880、1863-1881、1870-1888、1877-1895、1878-1896、1879-1897、1880-1898、1882-1900、1883-1901、1886-1904、1893-1911、1894-1912、1895-1913、1896-1914、1897-1915、1900-1918、1901-1919、1902-1920、1903-1921、1905-1923、1934-1952、1935-1953、1936-1954、1937-1955、1970-1988、1984-2002、2039-2057、2040-2058、2041-2059、2112-2130、2113-2131、2116-2134、2117-2135、2118-2136、2139-2157、2140-2158、2141-2159、2143-2161、2187-2205、2290-2308、2293-2311、2297-2315、2298-2316、2303-2321、2305-2323、2330-2348、2336-2354、2342-2360、2422-2440、2423-2441、2424-2442、2425-2443、2428-2446、2429-2447、2431-2449、2436-2454、2438-2456、2444-2462、2445-2463、2472-2490、2474-2492、2480-2498、2488-2506、2489-2507、2493-2511、2495-2513、2496-2514、2499-2517、2516-2534、2518-2536、2519-2537、2521-2539、2522-2540、2560-2578、2561-2579、2562-2580、2563-2581、2565-2583、2568-2586、2571-2589、2572-2590、2573-2591、2574-2592、2575-2593、2578-2596、2586-2604、2587-2605、2588-2606、2591-2609、2595-2613、2598-2616、2599-2617、2600-2618、2602-2620、2605-2623、2606-2624、2609-2627、2615-2633、2616-2634、2617-2635、2618-2636、2619-2637、2638-2656、2657-2675、2658-2676、2659-2677、2660-2678、2663-2681、2683-2701、2687-2705、2691-2709、2692-2710、2696-2714、2698-2716、2700-2718、2701-2719、2702-2720、2706-2724、2709-2727、2710-2728、2711-2729、2712-2730、2713-2731、2714-2732、2715-2733、2716-2734、2717-2735、2719-2737、2721-2739、2722-2740、2725-2743、2726-2744、2727-2745、2731-2749、2732-2750、2733-2751、2734-2752、2735-2753、2736-2754、2738-2756、2740-2758、2743-2761、2744-2762、2745-2763、2746-2764、2747-2765、2749-2767、2751-2769、2752-2770、2754-2772、2755-2773、2756-2774、2757-2775、2781-2799、2783-2801、376-400、371-395、381-405、382-406、383-407、388-412、389-413、390-414、391-415、426-450、470-494、496-520、497-521、499-523、517-541、518-542、533-557、534-558、535-559、537-561、538-562、539-563、540-564、541-565、542-566、559-583、631-655、632-656、633-657、641-665、682-706、693-717、718-742、719-743、721-745、722-746、723-747、724-748、726-750、802-826、803-827、806-830、807-831、808-832、809-833、810-834、811-835、812-836、815-839、866-890、869-893、893-917、994-1018、1176-1200、1218-1242、1262-1286、1313-1337、1366-1390、1372-1396、1403-1427、1404-1428、1405-1429、1406-1430、1409-1433、1413-1437、1414-1438、1415-1439、1421-1445、1422-1446、1423-1447、1424-1448、1425-1449、1426-1450、1430-1454、1432-1456、1454-1478、1455-1479、1456-1480、1457-1481、1458-1482、1459-1483、1460-1484、1461-1485、1463-1487、1527-1551、1606-1630、1607-1631、1609-1633、1610-1634、1673-1697、1742-1766、1759-1783、1777-1801、1814-1838、1816-1840、1817-1841、1818-1842、1819-1843、1820-1844、1823-1847、1831-1855、1839-1863、1847-1871、1850-1874、1851-1875、1852-1876、1854-1878、1855-1879、1859-1883、1860-1884、1867-1891、1874-1898、1875-1899、1876-1900、1877-1901、1879-1903、1880-1904、1883-1907、1890-1914、1891-1915、1892-1916、1893-1917、1894-1918、1897-1921、1898-1922、1899-1923、1900-1924、1902-1926、1931-1955、1932-1956、1933-1957、1934-1958、1967-1991、1981-2005、2036-2060、2037-2061、2038-2062、2109-2133、2110-2134、2113-2137、2114-2138、2115-2139、2136-2160、2137-2161、2138-2162、2140-2164、2184-2208、2287-2311、2290-2314、2294-2318、2295-2319、2300-2324、2302-2326、2327-2351、2333-2357、2339-2363、2419-2443、2420-2444、2421-2445、2422-2446、2425-2449、2426-2450、2428-2452、2433-2457、2435-2459、2441-2465、2442-2466、2469-2493、2471-2495、2477-2501、2485-2509、2486-2510、2490-2514、2492-2516、2493-2517、2496-2520、2513-2537、2515-2539、2516-2540、2518-2542、2519-2543、2557-2581、2558-2582、2559-2583、2560-2584、2562-2586、2565-2589、2568-2592、2569-2593、2570-2594、2571-2595、2572-2596、2575-2599、2583-2607、2584-2608、2585-2609、2588-2612、2592-2616、2595-2619、2596-2620、2597-2621、2599-2623、2602-2626、2603-2627、2606-2630、2612-2636、2613-2637、2614-2638、2615-2639、2616-2640、2635-2659、2654-2678、2655-2679、2656-2680、2657-2681、2660-2684、2680-2704、2684-2708、2688-2712、2689-2713、2693-2717、2695-2719、2697-2721、2698-2722、2699-2723、2703-2727、2706-2730、2707-2731、2708-2732、2709-2733、2710-2734、2711-2735、2712-2736、2713-2737、2714-2738、2716-2740、2718-2742、2719-2743、2722-2746、2723-2747、2724-2748、2728-2752、2729-2753、2730-2754、2731-2755、2732-2756、2733-2757、2735-2759、2737-2761、2740-2764、2741-2765、2742-2766、2743-2767、2744-2768、2746-2770、2748-2772、2749-2773、2751-2775、2752-2776、2753-2777、2754-2778、2778-2802、2780-2804、373-403、368-398、378-408、379-409、380-410、385-415、386-416、387-417、388-418、423-453、467-497、493-523、494-524、496-526、514-544、515-545、530-560、531-561、532-562、534-564、535-565、536-566、537-567、538-568、539-569、556-586、628-658、629-659、630-660、638-668、679-709、690-720、715-745、716-746、718-748、719-749、720-750、721-751、723-753、799-829、800-830、803-833、804-834、805-835、806-836、807-837、808-838、809-839、812-842、863-893、866-896、890-920、991-1021、1173-1203、1215-1245、1259-1289、1310-1340、1363-1393、1369-1399、1400-1430、1401-1431、1402-1432、1403-1433、1406-1436、1410-1440、1411-1441、1412-1442、1418-1448、1419-1449、1420-1450、1421-1451、1422-1452、1423-1453、1427-1457、1429-1459、1451-1481、1452-1482、1453-1483、1454-1484、1455-1485、1456-1486、1457-1487、1458-1488、1460-1490、1524-1554、1603-1633、1604-1634、1606-1636、1607-1637、1670-1700、1739-1769、1756-1786、1774-1804、1811-1841、1813-1843、1814-1844、1815-1845、1816-1846、1817-1847、1820-1850、1828-1858、1836-1866、1844-1874、1847-1877、1848-1878、1849-1879、1851-1881、1852-1882、1856-1886、1857-1887、1864-1894、1871-1901、1872-1902、1873-1903、1874-1904、1876-1906、1877-1907、1880-1910、1887-1917、1888-1918、1889-1919、1890-1920、1891-1921、1894-1924、1895-1925、1896-1926、1897-1927、1899-1929、1928-1958、1929-1959、1930-1960、1931-1961、1964-1994、1978-2008、2033-2063、2034-2064、2035-2065、2106-2136、2107-2137、2110-2140、2111-2141、2112-2142、2133-2163、2134-2164、2135-2165、2137-2167、2181-2211、2284-2314、2287-2317、2291-2321、2292-2322、2297-2327、2299-2329、2324-2354、2330-2360、2336-2366、2416-2446、2417-2447、2418-2448、2419-2449、2422-2452、2423-2453、2425-2455、2430-2460、2432-2462、2438-2468、2439-2469、2466-2496、2468-2498、2474-2504、2482-2512、2483-2513、2487-2517、2489-2519、2490-2520、2493-2523、2510-2540、2512-2542、2513-2543、2515-2545、2516-2546、2554-2584、2555-2585、2556-2586、2557-2587、2559-2589、2562-2592、2565-2595、2566-2596、2567-2597、2568-2598、2569-2599、2572-2602、2580-2610、2581-2611、2582-2612、2585-2615、2589-2619、2592-2622、2593-2623、2594-2624、2596-2626、2599-2629、2600-2630、2603-2633、2609-2639、2610-2640、2611-2641、2612-2642、2613-2643、2632-2662、2651-2681、2652-2682、2653-2683、2654-2684、2657-2687、2677-2707、2681-2711、2685-2715、2686-2716、2690-2720、2692-2722、2694-2724、2695-2725、2696-2726、2700-2730、2703-2733、2704-2734、2705-2735、2706-2736、2707-2737、2708-2738, 2709-2739, 2710-2740, 2711-2741, 2713-2743, 2715-2745, 2716-2746, 2719-2749, 2720-2750, 2721-2751, 2725-2755, 2726-2756, 2727-2757, 2728-2758, 2729-2759, 2730-2760 2732-2762, 2734-2764, 2737-2767, 2738-2768, 2739-2769, 2740-2770, 2741-2771, 2743-2773, 2745-2775, 2746-2776, 2748-2778, 2749-2779, 2750-2780, 2751-2781, 2775-2805, or 2777-2807.
[0010] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 nucleotides differing from any of the nucleotide sequences in SEQ ID NO:1 by no more than 0, 1, 2, or 3 nucleotides. Continuous nucleotides: 378-398, 383-403, 391-411, 472-492, 499-519, 535-555, 536-556, 537-557, 539-559, 542-562, 561-581, 684-704, 723-743, 724-744, 725-745, 808-828, 809-829, 810-830, 811-831, 812-832, 813-833, 814-834, 817-837, 868-888, 1264-1284, 1368-1388, 1405- 1425, 1406-1426, 1407-1427, 1416-1436, 1417-1437, 1426-1446, 1427-1447, 1428-1448, 1434-1454, 1456-1476, 1458-1478, 1461-1481, 1462-1482, 1463-1483, 1465-1485, 1529-1549, 1608-1628, 1609-1629, 1611-1631, 1612-1632, 1675-1695, 1744-1764, 1818-1838, 1819-1839, 1820-1840, 1821-1841, 1822-1842, 1833-1853, 1854-1874, 1856-1876, 1857-1877, 1861-1881, 1862-1882, 1876-1896, 1877-1897, 1878-1898, 1879-1899, 1885-1905, 1893-1913, 1895-1915, 1899-1919, 1900-1920, 1901-1921, 1934-1954, 1935-1955, 2038- 2058, 2039-2059, 2111-2131, 2115-2135, 2116-2136, 2138-2158, 2139-2159, 2302-2322, 2335-2355, 2422-2442, 2437-2457, 2443-2463, 2444-2464, 2471-2491, 2473-2493, 2488-2508, 2492-2512, 2495-2515, 2518-2538, 2521-2541, 2562-2582, 2571-2591, 2587-2607,2590-2610、2594-2614、2608-2628、2614-2634、2682-2702、2686-2706、2710-2730、2711-2731、2712-2732、2714-2734、2715-2735、2716-2736、2720-2740、2731-2751、2732-2752、2733-2753、2737-2757、2742-2762、2743-2763、2744-2764、2745-2765、2746-2766、2750-2770、2782-2802、1178-1198、1220-1240、1969-1989、2186-2206、2329-2349、373-393、384-404、385-405、390-410、392-412、393-413、428-448、498-518、501-521、519-539、520-540、540-560、541-561、543-563、544-564、633-653、634-654、635-655、643-663、695-715、720-740、721-741、726-746、728-748、804-824、805-825、871-891、895-915、996-1016、1315-1335、1374-1394、1408-1428、1411-1431、1415-1435、1423-1443、1424-1444、1425-1445、1432-1452、1457-1477、1459-1479、1460-1480、1761-1781、1779-1799、1816-1836、1825-1845、1841-1861、1849-1869、1852-1872、1853-1873、1869-1889、1879-1899、1881-1901、1882-1902、1892-1912、1894-1914、1896-1916、1901-1921、1902-1922、1904-1924、1933-1953、1936-1956、1983-2003、2040-2060、2112-2132、2116-2136、2117-2137、2140-2160、2142-2162、2289-2309、2292-2312、2296-2316、2297-2317、2304-2324、2341-2361、2421-2441、2423-2443、2424-2444、2427-2447、2428-2448、2430-2450、2435-2455、2479-2499、2487-2507、2494-2514、2498-2518、2515-2535、2517-2537、2520-2540、2559-2579、2560-2580、2561-2581、2564-2584、2567-2587、2570-2590、2572-2592、2573-2593、2574-2594、2577-2597、2585-2605、2586-2606、2597-2617、2598-2618、2599-2619、2601-2621、2604-2624、2605-2625、2615-2635、2616-2636、2617-2637、2618-2638、2637-2657、2656-2676、2657-2677、2658-2678、2659-2679、2662-2682、2690-2710、2691-2711、2695-2715、2697-2717、2699-2719、2700-2720、2701-2721、2705-2725、2708-2728、2709-2729、2713-2733、2718-2738、2721-2741、2724-2744、2725-2745、2726-2746、2730-2750、2734-2754、2735-2755、2739-2759、2748-2768、2751-2771、2753-2773、2754-2774、2755-2775、2756-2776、2780-2800、2782-2802、379-397、374-392、384-402、385-403、386-404、391-409、392-410、393-411、394-412、429-447、473-491、499-517、500-518、502-520、520-538、521-539、536-554、537-555、538-556、540-558、541-559、542-560、543-561、544-562、545-563、562-580、634-652、635-653、636-654、644-662、685-703、696-714、721-739、722-740、724-742、725-743、726-744、727-745、729-747、805-823、806-824、809-827、810-828、811-829、812-830、813-831、814-832、815-833、818-836、869-887、872-890、896-914、997-1015、1179-1197、1221-1239、1265-1283、1316-1334、1369-1387、1375-1393、1406-1424、1407-1425、1408-1426、1409-1427、1412-1430、1416-1434、1417-1435、1418-1436、1424-1442、1425-1443、1426-1444、1427-1445、1428-1446、1429-1447、1433-1451、1435-1453、1457-1475、1458-1476、1459-1477、1460-1478、1461-1479、1462-1480、1463-1481、1464-1482、1466-1484、1530-1548、1609-1627、1610-1628、1612-1630、1613-1631、1676-1694、1745-1763、1762-1780、1780-1798、1817-1835、1819-1837、1820-1838、1821-1839、1822-1840、1823-1841、1826-1844、1834-1852、1842-1860、1850-1868、1853-1871、1854-1872、1855-1873、1857-1875、1858-1876、1862-1880、1863-1881、1870-1888、1877-1895、1878-1896、1879-1897、1880-1898、1882-1900、1883-1901、1886-1904、1893-1911、1894-1912、1895-1913、1896-1914、1897-1915、1900-1918、1901-1919、1902-1920、1903-1921、1905-1923、1934-1952、1935-1953、1936-1954、1937-1955、1970-1988、1984-2002、2039-2057、2040-2058、2041-2059、2112-2130、2113-2131、2116-2134、2117-2135、2118-2136、2139-2157、2140-2158、2141-2159、2143-2161、2187-2205、2290-2308、2293-2311、2297-2315、2298-2316、2303-2321、2305-2323、2330-2348、2336-2354、2342-2360、2422-2440、2423-2441、2424-2442、2425-2443、2428-2446、2429-2447、2431-2449、2436-2454、2438-2456、2444-2462、2445-2463、2472-2490、2474-2492、2480-2498、2488-2506、2489-2507、2493-2511、2495-2513、2496-2514、2499-2517、2516-2534、2518-2536、2519-2537、2521-2539、2522-2540、2560-2578、2561-2579、2562-2580、2563-2581、2565-2583、2568-2586、2571-2589、2572-2590、2573-2591、2574-2592、2575-2593、2578-2596、2586-2604、2587-2605、2588-2606、2591-2609、2595-2613、2598-2616、2599-2617、2600-2618、2602-2620、2605-2623、2606-2624、2609-2627、2615-2633、2616-2634、2617-2635、2618-2636、2619-2637、2638-2656、2657-2675、2658-2676、2659-2677、2660-2678、2663-2681、2683-2701、2687-2705、2691-2709、2692-2710、2696-2714、2698-2716、2700-2718、2701-2719、2702-2720、2706-2724、2709-2727、2710-2728、2711-2729、2712-2730、2713-2731、2714-2732、2715-2733、2716-2734、2717-2735、2719-2737、2721-2739、2722-2740、2725-2743、2726-2744、2727-2745、2731-2749、2732-2750、2733-2751、2734-2752、2735-2753、2736-2754、2738-2756、2740-2758、2743-2761、2744-2762、2745-2763、2746-2764、2747-2765、2749-2767、2751-2769、2752-2770、2754-2772、2755-2773、2756-2774、2757-2775、2781-2799、2783-2801、376-400、371-395、381-405、382-406、383-407、388-412、389-413、390-414、391-415、426-450、470-494、496-520、497-521、499-523、517-541、518-542、533-557、534-558、535-559、537-561、538-562、539-563、540-564、541-565、542-566、559-583、631-655、632-656、633-657、641-665、682-706、693-717、718-742、719-743、721-745、722-746、723-747、724-748、726-750、802-826、803-827、806-830、807-831、808-832、809-833、810-834、811-835、812-836、815-839、866-890、869-893、893-917、994-1018、1176-1200、1218-1242、1262-1286、1313-1337、1366-1390、1372-1396、1403-1427、1404-1428、1405-1429、1406-1430、1409-1433、1413-1437、1414-1438、1415-1439、1421-1445、1422-1446、1423-1447、1424-1448、1425-1449、1426-1450、1430-1454、1432-1456、1454-1478、1455-1479、1456-1480、1457-1481、1458-1482、1459-1483、1460-1484、1461-1485、1463-1487、1527-1551、1606-1630、1607-1631、1609-1633、1610-1634、1673-1697、1742-1766、1759-1783、1777-1801、1814-1838、1816-1840、1817-1841、1818-1842、1819-1843、1820-1844、1823-1847、1831-1855、1839-1863、1847-1871、1850-1874、1851-1875、1852-1876、1854-1878、1855-1879、1859-1883、1860-1884、1867-1891、1874-1898、1875-1899、1876-1900、1877-1901、1879-1903、1880-1904、1883-1907、1890-1914、1891-1915、1892-1916、1893-1917、1894-1918、1897-1921、1898-1922、1899-1923、1900-1924、1902-1926、1931-1955、1932-1956、1933-1957、1934-1958、1967-1991、1981-2005、2036-2060、2037-2061、2038-2062、2109-2133、2110-2134、2113-2137、2114-2138、2115-2139、2136-2160、2137-2161、2138-2162、2140-2164、2184-2208、2287-2311、2290-2314、2294-2318、2295-2319、2300-2324、2302-2326、2327-2351、2333-2357、2339-2363、2419-2443、2420-2444、2421-2445、2422-2446、2425-2449、2426-2450、2428-2452、2433-2457、2435-2459、2441-2465、2442-2466、2469-2493、2471-2495、2477-2501、2485-2509、2486-2510、2490-2514、2492-2516、2493-2517、2496-2520、2513-2537、2515-2539、2516-2540、2518-2542、2519-2543、2557-2581、2558-2582、2559-2583、2560-2584、2562-2586、2565-2589、2568-2592、2569-2593、2570-2594、2571-2595、2572-2596、2575-2599、2583-2607、2584-2608、2585-2609、2588-2612、2592-2616、2595-2619、2596-2620、2597-2621、2599-2623、2602-2626、2603-2627、2606-2630、2612-2636、2613-2637、2614-2638、2615-2639、2616-2640、2635-2659、2654-2678、2655-2679、2656-2680、2657-2681、2660-2684、2680-2704、2684-2708、2688-2712、2689-2713、2693-2717、2695-2719、2697-2721、2698-2722、2699-2723、2703-2727、2706-2730、2707-2731、2708-2732、2709-2733、2710-2734、2711-2735、2712-2736、2713-2737、2714-2738、2716-2740、2718-2742、2719-2743、2722-2746、2723-2747、2724-2748、2728-2752、2729-2753、2730-2754、2731-2755、2732-2756、2733-2757、2735-2759、2737-2761、2740-2764、2741-2765、2742-2766、2743-2767、2744-2768、2746-2770、2748-2772、2749-2773、2751-2775、2752-2776、2753-2777、2754-2778、2778-2802、2780-2804、373-403、368-398、378-408、379-409、380-410、385-415、386-416、387-417、388-418、423-453、467-497、493-523、494-524、496-526、514-544、515-545、530-560、531-561、532-562、534-564、535-565、536-566、537-567、538-568、539-569、556-586、628-658、629-659、630-660、638-668、679-709、690-720、715-745、716-746、718-748、719-749、720-750、721-751、723-753、799-829、800-830、803-833、804-834、805-835、806-836、807-837、808-838、809-839、812-842、863-893、866-896、890-920、991-1021、1173-1203、1215-1245、1259-1289、1310-1340、1363-1393、1369-1399、1400-1430、1401-1431、1402-1432、1403-1433、1406-1436、1410-1440、1411-1441、1412-1442、1418-1448、1419-1449、1420-1450、1421-1451、1422-1452、1423-1453、1427-1457、1429-1459、1451-1481、1452-1482、1453-1483、1454-1484、1455-1485、1456-1486、1457-1487、1458-1488、1460-1490、1524-1554、1603-1633、1604-1634、1606-1636、1607-1637、1670-1700、1739-1769、1756-1786、1774-1804、1811-1841、1813-1843、1814-1844、1815-1845、1816-1846、1817-1847、1820-1850、1828-1858、1836-1866、1844-1874、1847-1877、1848-1878、1849-1879、1851-1881、1852-1882、1856-1886、1857-1887、1864-1894、1871-1901、1872-1902、1873-1903、1874-1904、1876-1906、1877-1907、1880-1910、1887-1917、1888-1918、1889-1919、1890-1920、1891-1921、1894-1924、1895-1925、1896-1926、1897-1927、1899-1929、1928-1958、1929-1959、1930-1960、1931-1961、1964-1994、1978-2008、2033-2063、2034-2064、2035-2065、2106-2136、2107-2137、2110-2140、2111-2141、2112-2142、2133-2163、2134-2164、2135-2165、2137-2167、2181-2211、2284-2314、2287-2317、2291-2321、2292-2322、2297-2327、2299-2329、2324-2354、2330-2360、2336-2366、2416-2446、2417-2447、2418-2448、2419-2449、2422-2452、2423-2453、2425-2455、2430-2460、2432-2462、2438-2468、2439-2469、2466-2496、2468-2498、2474-2504、2482-2512、2483-2513、2487-2517、2489-2519、2490-2520、2493-2523、2510-2540、2512-2542、2513-2543、2515-2545、2516-2546、2554-2584、2555-2585、2556-2586、2557-2587、2559-2589、2562-2592、2565-2595、2566-2596、2567-2597、2568-2598、2569-2599、2572-2602、2580-2610、2581-2611、2582-2612、2585-2615、2589-2619、2592-2622、2593-2623、2594-2624、2596-2626、2599-2629、2600-2630、2603-2633、2609-2639、2610-2640、2611-2641、2612-2642、2613-2643、2632-2662、2651-2681、2652-2682、2653-2683、2654-2684、2657-2687、2677-2707、2681-2711、2685-2715、2686-2716、2690-2720、2692-2722、2694-2724、2695-2725、2696-2726、2700-2730、2703-2733、2704-2734、2705-2735、2706-2736、2707-2737、2708-2738、2709-2739、2710-2740、2711-2741、2713-2743、2715-2745, 2716-2746, 2719-2749, 2720-2750, 2721-2751, 2725-2755, 2726-2756, 2727-2757, 2728-2758, 2729-2759, 2730-2760, 2732-2762, 2734-2764, 2737- 2767, 2738-2768, 2739-2769, 2740-2770, 2741-2771, 2743-2773, 2745-2775, 2746-2776, 2748-2778, 2749-2779, 2750-2780, 2751-2781, 2775-2805, or 2777-2807.
[0011] In some embodiments, the dsRNA agent includes at least one modified nucleotide. In some embodiments, at least one modified nucleotide includes: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-open-ring nucleotide mimic, locked nucleotide, unlocked nucleic acid nucleotide (UNA), glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, baseless nucleotide, ribitol, reverse nucleotide, reverse baseless nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotide, isomannitol nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotide including 5'-thiophosphate group, 5'-phosphonate-modified nucleotide, nucleotide modified with 5'-phosphate or 5'-phosphate mimic, or terminal nucleotide linked to a cholesterol derivative or dodecanoic acid bisdecamide group, 2'-amino-modified nucleotide, phosphoramide, or nucleotide including a non-natural base.
[0012] In some embodiments, all or substantially all nucleotides of the sense strand are modified nucleotides. In some embodiments, all or substantially all nucleotides of the antisense strand are modified nucleotides. In some embodiments, all or substantially all nucleotides of both the sense and antisense strands are modified nucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides, 2'-fluoronucleotides, and UNA modified nucleotides, wherein fewer than 6 of the modified nucleotides are 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 3 or 5 2'-fluoronucleotides, preferably 5 2'-fluoronucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, wherein fewer than 4 of the modified nucleotides are 2'-fluoronucleotides. In some embodiments, the sense strand comprises 3 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 15 or more modifying nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, wherein at least 14 of the modifying nucleotides are 2'-O-methylnucleotides, and the nucleotides at positions 2, 5, 7, 12, 14, and / or 16, counting from the first matching position at the 5' end of the antisense strand, are independently 2'-fluoronucleotides. In some embodiments, the antisense strand comprises at least one UNA-modified nucleotide and five 2'-fluoronucleotides. In some embodiments, the antisense strand comprises one UNA-modified nucleotide at position 7, counting from the first matching position at the 5' end of the antisense strand, and five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 16, with the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 7, 12, 14, and 16, counting from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, preferably, wherein at least 18 of the modified nucleotides are 2'-O-methyl nucleotides, and the nucleotides at positions 9, 11 and / or 13, counting from the first matching position at the 3' end of the sense strand, are 2'-fluoro nucleotides.
[0013] In some embodiments, the dsRNA agent comprises one or more nucleotides modified with a 5'-phosphate or a 5'-phosphate mimic. In some embodiments, the phosphate mimic is 5'-vinylphosphonate (VP). In some embodiments, the dsRNA agent comprises an E-vinylphosphonate nucleotide at the 5' end of the guide strand.
[0014] In some embodiments, the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linker groups. In some embodiments, the one or more targeting groups or linker groups target receptors, such as hydrophilic ligands, delivered to CNS tissues. In some embodiments, the one or more targeting groups or linker groups target brain tissue, such as the striatum. In some embodiments, the one or more targeting groups or linker groups bind to a sense strand. In some embodiments, the one or more targeting groups or linker groups bind to an antisense strand. In some embodiments, the one or more targeting groups or linker groups are conjugated to the end of a sense strand. In some embodiments, the one or more targeting groups or linker groups are conjugated to one or more internal positions of a sense strand. In some embodiments, the one or more targeting groups or linker groups are conjugated to one or more internal positions of an antisense strand. In some embodiments, the internal positions do not include cleavage sites of the sense strand. In some embodiments, the internal positions do not include cleavage sites of the antisense strand. In some embodiments, the targeting group or linker group comprises N-acetylgalactosamine (GalNAc). In some embodiments, the targeting group has a structure of formula (X):
[0015] Formula (X)
[0016] Each n'' is independently selected from 1 or 2.
[0017] In some embodiments, the targeting group has the following structure:
[0018]
[0019]
[0020]
[0021]
[0022] In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand. In some embodiments, the dsRNA agent includes a targeting group conjugated to the 3' end of the sense strand. In some embodiments, the antisense strand includes an inverted abase residue at the 3' end. In some embodiments, the sense strand includes one or two inverted abase residues and / or one or two Imann residues at the 3' and / or 5' ends. In some embodiments, each end of the sense strand includes an inverted abase residue. In some embodiments, each end of the sense strand includes an Imann residue. In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand includes a 3' overhang of at least one nucleotide. In some embodiments, at least one strand includes a 3' overhang of at least two nucleotides.
[0023] In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand, preferably, the targeting group being selected from GLO-1 to GLO-16 and GLS-1. To GLS-16 Any of the above, more preferably, the targeting group is the aforementioned GLS-15 In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand. In some embodiments, the antisense strand includes an inverted abase residue at the 3' end. In some embodiments, the sense strand includes one or two inverted abase residues and / or one or two Imann residues at the 3' and / or 5' ends. In some embodiments, the 3' and 5' ends of the sense strand each independently include an inverted abase residue. In some embodiments, the 3' and 5' ends of the sense strand each independently contain an Imann residue. In some embodiments, the sense strand contains two inverted abase residues at the 3' and 5' ends, and the residue at the 3' or 5' end further binds to a targeting group, preferably the aforementioned GLS-15. In some embodiments, the sense chain includes a reverse abase-free residue at the 3'-terminus, and the 5'-terminus is further bound to a targeting group, preferably the aforementioned GLS-15. In some embodiments, the sense strand contains two imann residues at the 3' and 5' ends, and the residues at the 3' or 5' end further bind to a targeting group, preferably the aforementioned GLS-15. .
[0024] In some embodiments, the dsRNA agent includes at least one phosphate-thioester nucleoside internucleotide bond. In some embodiments, the sense strand includes at least one phosphate-thioester nucleoside internucleotide bond. In some embodiments, the antisense strand includes at least one phosphate-thioester nucleoside internucleotide bond. In some embodiments, the sense strand includes 1, 2, 3, 4, 5, or 6 phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the antisense strand includes 1, 2, 3, 4, 5, or 6 phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the antisense strand includes 1, 2, 3, 4, 5, or 6 phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the 5' end of the antisense strand includes 2 phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the 3' end of the antisense strand includes 2 phosphate-thioester nucleoside internucleotide bonds. In some embodiments, the 5' end and the 3' end of the antisense strand independently include 2 phosphate-thioester nucleoside internucleotide bonds.
[0025] In some embodiments, at least one linking bond of the sense strand and / or antisense strand is a phosphodiester (PO) bond. In some embodiments, at least one linking bond of the sense strand and / or antisense strand is a modified bond. In some embodiments, at least one linking bond of the sense strand and / or antisense strand is a phosphate thioester (PS) bond. In some embodiments, at least one phosphate thioester (PS) bond is introduced at the 5' end, 3' end, or both ends of the sense strand and / or antisense strand. In some embodiments, 1, 2, 3, 4, 5, or 6 phosphate thioester (PS) bonds are independently introduced at the 5' end, 3' end, or both ends of the sense strand and / or antisense strand. In some embodiments, at least two modified or unmodified nucleotides at one or both ends of the antisense strand are linked by phosphate thioester bonds. In some embodiments, three modified or unmodified nucleotides at one or both ends of the antisense strand are linked by phosphate thioester bonds. In some embodiments, at least two modified or unmodified nucleotides at one or both ends of the sense strand are linked by phosphate thioester bonds. In some embodiments, three modified or unmodified nucleotides at the ends of one or both ends of the sense strand are linked by phosphate thioester bonds. In some embodiments, three modified or unmodified nucleotides at the 5' end of the sense strand are linked by phosphate thioester bonds, and two modified or unmodified nucleotides at the 3' end of the sense strand are linked by phosphate thioester bonds. In some embodiments, one or more inverted abase residues or one or more Imann residues are attached to either or both ends of the sense strand by phosphate thioester bonds. In some embodiments, a targeting group is further attached to either end of the sense strand by a phosphate thioester bond. In some embodiments, a targeting group is further attached to the 5' end of the sense strand by a phosphate thioester bond.
[0026] In some embodiments, the sense strand sequence of the dsRNA agent of the present invention can be represented by formula (I):
[0027]
[0028] Where: each N' F Represents nucleotides with 2'-fluorine modification; each N' N1 N' N2 N' N3 N' N4 N' N5 、 and N' N6 Independently representing modified or unmodified nucleotides; each N' L Each nucleotide can be used independently to represent a modified or unmodified nucleotide, but not a nucleotide with 2'-fluorine modification, and m' and n' are each an independent integer from 0 to 7.
[0029] In some embodiments, each N' N1 、N' N2 、N' N3 、N' N4 、N' N5 and N' N6 Independently represents a 2'-fluorine modified nucleotide or a 2'-O-methyl nucleotide.
[0030] In some embodiments, each N' L Independently represents 2'-O-methyl nucleotide.
[0031] In some embodiments, N' N4 and N' N5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0032] In some embodiments, N' N2 and N' N4 Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0033] In some embodiments, N' N4 and N' N5 Each of these represents a 2'-fluorinated nucleotide independently, m' being 2, and each N' L 、N' N1 、N' N2 、N' N3 and N' N6 Independently represents 2'-O-methyl nucleotide.
[0034] In some embodiments, N' N2 and N' N4 Each of these represents a 2'-fluorinated nucleotide independently, m' being 4, and each N' L 、N' N1 、N' N3 、N' N5 and N'N6 Independently represents 2'-O-methyl nucleotide.
[0035] In some embodiments, m' is 4 and n' is 3.
[0036] In some embodiments, m' is 2 and n' is 3, or m' is 2 and n' is 4, or m' is 2 and n' is 5.
[0037] In some embodiments, the antisense strand sequence of the dsRNA agent of the present invention can be independently represented by formula (II):
[0038]
[0039] Where: each N F This indicates a nucleotide with 2'-fluorine modification; each N M1 N M2 N M3 N M4 N M5 N M6 N M7 and N M8 Independently representing modified or unmodified nucleotides; each N L Independently represents a modified or unmodified nucleotide, but not a 2'-fluorinated nucleotide, and n is an integer from 0 to 7.
[0040] In some embodiments, each N M1 N M2 N M3 N M4 N M5 N M6 N M7 and N M8 Independently represents a 2'-fluorine modified nucleotide, a 2'-O-methyl nucleotide, an UNA modified nucleotide, or a nucleotide containing a phosphate ester mimic.
[0041] In some embodiments, each N L Independently represents 2'-O-methyl nucleotide.
[0042] In some embodiments, the modified nucleotide is the modified nucleotide as defined above.
[0043] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide, a 2'-fluorine modified nucleotide, an UNA modified nucleotide, or a nucleotide containing a phosphate ester mimic.
[0044] In some embodiments, N M2 N M3 and N M6Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0045] In some embodiments, N M2 N M3 and N M7 Each independently represents a 2'-fluorinated nucleotide, and N M6 This indicates a nucleotide modified with UNA.
[0046] In some embodiments, N M2 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide, and each N M1 N M4 N M5 N M7 N M8 and N L Independently represents 2'-O-methyl nucleotide.
[0047] In some embodiments, N M2 N M3 and N M7 Each independently represents a 2'-fluorinated nucleotide, N M6 This indicates a nucleotide modified with UNA, and each N M1 N M4 N M5 N M8 and N L Independently represents 2'-O-methyl nucleotide.
[0048] In some embodiments, n is 1, or n is 2, or n is 3.
[0049] In some embodiments, N M6 N M3 and N M2 They are all nucleotides modified with 2'-fluorine.
[0050] In some embodiments, the dsRNA double strand of the present invention can be represented by formula (III), and the complementary region comprises at least 15 consecutive nucleotides, wherein,
[0051]
[0052] Each chain is approximately 17 to 30 nucleotides in length.
[0053] Each N F and N' F Independently represents a nucleotide modified with 2'-fluorine; N M1 N M2 N M3 N M4N M5 N M6 N M7 N M8 、N' N1 、N' N2 、N' N3 、N' N4 、N' N5 、N' N6 and N Z Each N represents a modified or unmodified nucleotide independently; L and N' L Each nucleotide can be used independently to represent a modified or unmodified nucleotide, but not a nucleotide with 2'-fluorine modification, and each of m', n' and n can be an integer from 0 to 7.
[0054] In some embodiments, the modified nucleotide is the modified nucleotide as defined above.
[0055] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide, a 2'-fluorine modified nucleotide, an UNA modified nucleotide, or a nucleotide containing a phosphate ester mimic.
[0056] In some embodiments, n' is 1 and m' is 2, n' is 2 and m' is 2, or n' is 1 and m' is 4, or n' is 3 and m' is 2, or n' is 3 and m' is 4, or n' is 4 and m' is 2, or n' is 5 and m' is 2.
[0057] In some embodiments, each N' N1 、N' N2 、N' N3 、N' N4 、N' N5 and N' N6 Independently represents a 2'-fluorine modified nucleotide or a 2'-O-methyl nucleotide.
[0058] In some embodiments, each N' L Independently represents 2'-O-methyl nucleotide.
[0059] In some embodiments, N' N2 and N' N4 Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0060] In some embodiments, N' N4 and N' N5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0061] In some embodiments, N' N4 and N' N5Each independently represents a 2'-fluorinated nucleotide, m' being 2 and each N' L 、N' N1 、N' N2 、N' N3 and N' N6 Independently represents 2'-O-methyl nucleotide.
[0062] In some embodiments, N' N2 and N' N4 Each independently represents a 2'-fluorinated nucleotide, m' being 4 and each N' L 、N' N1 、N' N3 、N' N5 and N' N6 Independently represents 2'-O-methyl nucleotide.
[0063] In some embodiments, n is 1, or n is 2, or n is 3.
[0064] In some embodiments, each N M1 N M2 N M3 N M4 N M5 N M6 N M7 and N M8 Independently represents a 2'-fluorine modified nucleotide, a 2'-O-methyl nucleotide, an UNA modified nucleotide, or a nucleotide containing a phosphate ester mimic.
[0065] In some embodiments, each N L Independently represents 2'-O-methyl nucleotide.
[0066] In some embodiments, N M2 N M3 and N M6 Each independently represents a 2'-fluorine-modified nucleotide; in some embodiments, N M2 N M3 and N M6 All are nucleotides modified with 2'-fluorine.
[0067] In some embodiments, N M2 N M3 and N M7 Each independently represents a 2'-fluorinated nucleotide, and N M6 This indicates a nucleotide modified with UNA.
[0068] In some embodiments, N M2 N M3 and N M6Each independently represents a 2'-fluorinated nucleotide, and each N M1 N M4 N M5 N M7 N M8 and N L Independently represents 2'-O-methyl nucleotide.
[0069] In some embodiments, N M2 N M3 and N M7 Each independently represents a 2'-fluorinated nucleotide, N M6 This indicates a nucleotide modified with UNA, and each N M1 N M4 N M5 N M8 and N L Independently represents 2'-O-methyl nucleotide.
[0070] In some embodiments of formula (II) or (III), the antisense strand includes a reverse abase residue at its 3' end. In some embodiments of formula (I) or (III), the sense strand includes one or two reverse abase residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, the 3' and 5' ends of the sense strand each independently include a reverse abase residue. In some embodiments of formula (I) or (III), the 3' and 5' ends of the sense strand each independently include an imann residue. In some embodiments of formula (I) or (III), the sense strand includes a reverse abase residue at its 3' end and the 5' end is further conjugated with a targeting group (e.g., a hydrophilic ligand) mediating delivery to CNS or liver tissue, optionally the aforementioned GLS-15. In some embodiments of formula (I) or (III), the sense chain includes an inverted abase-free residue at the 3' and 5' ends, respectively, and either residue at the 3' or 5' end is further conjugated to a targeting group (e.g., a hydrophilic ligand) that mediates delivery to central nervous system tissue or liver tissue, said hydrophilic ligand optionally being the aforementioned GLS-15. In some embodiments of formula (I) or (III), the sense chain includes an imann residue at both the 3' and 5' ends, and either residue at the 3' or 5' end is further conjugated to a targeting group (e.g., a hydrophilic ligand) that mediates delivery to central nervous system tissue or liver tissue, said hydrophilic ligand optionally being the aforementioned GLS-15. In some embodiments, the above-described dsRNA agent has two blunt ends. In some embodiments of formula (I), (II), or (III), at least one strand includes a 3' overhang of at least one nucleotide. In some embodiments of formula (I), (II), or (III), at least one strand includes a 3' overhang of at least two nucleotides.
[0071] In some embodiments of formula (I), (II), or (III), N M1 N M2 N M3 N M4 N M5 N M6 N M7 N M8 、N' N1 、N' N2 、N' N3 、N' N4 、N' N5 、N' N6 、N' L and N L Each nucleotide is independently linked to an adjacent nucleotide via a phosphodiester (PO) bond. In some embodiments of formula (I), (II), or (III), N M1 N M2 N M3 N M4 N M5 N M6 N M7 N M8 N M9 、N' N1 、N' N2 、N' N3 、N' N4 、N' N5 、N' N6 、N' L and N LAt least one of the nucleotides is linked to an adjacent nucleotide via a phosphate thioester (PS) bond. In some embodiments of formula (I), (II), or (III) above, including a reverse abase residue, an imann residue, and / or a targeting group, the linking bonds at positions 1-10 of the terminal position of each end of the chain independently contain 1, 2, 3, 4, 5, or 6 phosphate thioester (PS) bonds. In some embodiments of formula (I), (II), or (III) above, including a reverse abase residue, an imann residue, and / or a targeting group, the linking bonds at positions 1-5 of the terminal position of each end of the chain independently contain 1, 2, or 3 phosphate thioester (PS) bonds. In some embodiments of formula (I), (II), or (III) above, including a reverse abase residue, an imann residue, and / or a targeting group, the linking bonds at positions 1-3 of the terminal position of each end of the chain independently contain 1 or 2 phosphate thioester (PS) bonds.
[0072] In some embodiments, the modified sense chain has any of the modification patterns shown in Tables 2-3. In some embodiments, the modified antisense chain has any of the modification patterns shown in Tables 2-3.
[0073] In some embodiments, any of the meaningful chains in Table 1 may be further modified according to the pattern shown in formula (I) or (III) above.
[0074] In some embodiments, any of the antisense chains in Table 1 may be further modified according to the pattern shown in formula (II) or (III) above.
[0075] In some embodiments, any of the double strands in Table 1 may be further modified according to the pattern shown in formula (III) above.
[0076] In some embodiments, the antisense strand length of the dsRNA agent is independently 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the sense strand length of the dsRNA agent is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, both the sense and antisense strands are 23 nucleotides long. In some embodiments, both the sense and antisense strands are 21 nucleotides long.
[0077] In some embodiments, the dsRNA agent of the present invention targets the corresponding portions of the APP mRNA transcripts disclosed in Table 1 and / or the target regions of the aforementioned APP mRNA transcripts.
[0078] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region complementary to the mRNA encoding APP, the region comprising at least 15 consecutive nucleotides differing from any antisense sequence listed in Tables 1-3 by no more than 1, 2, or 3 nucleotides. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region complementary to the mRNA encoding APP, the complementary region comprising at least 15 consecutive nucleotides of any antisense sequence listed in Tables 1-3.
[0079] In some embodiments, the dsRNA agent includes a sense strand and an antisense strand, wherein nucleotide positions 2-18 in the antisense strand include a region complementary to the APP RNA transcript, wherein the complementary region includes at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing from one of the antisense sequences listed in one of Tables 1-3 by 0, 1, 2, or 3 nucleotides, and optionally includes a targeting ligand.
[0080] In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any of the target regions of SEQ ID NO: 1 and is provided in any of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent is completely complementary to any of the target regions of SEQ ID NO: 1 and is provided in any of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense strand sequence as described in any of Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises a sense strand sequence as described in any of Tables 1-3, wherein the sense strand sequence is completely complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence as described in any of Tables 1-3. In some embodiments, the modified sense strand is a modified sense strand sequence as described in any of Tables 2-3. In some embodiments, the modified antisense strand is a modified antisense strand sequence as described in any of Tables 2-3.
[0081] According to one aspect of the invention, a composition is provided comprising any of the embodiments described above regarding the dsRNA agents of the invention. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents. In some embodiments, the composition is packaged in a kit, container, package, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous administration, intrathecal administration, or intravenous (IV) administration.
[0082] According to another aspect of the invention, a cell is provided comprising any embodiment of the dsRNA agent described above. In some embodiments, the cell is a mammalian cell, optionally a human cell. In some embodiments, the cell is a neuron (e.g., a primary sensory neuron).
[0083] According to another aspect of the present invention, a method for inhibiting APP gene expression in cells is provided, the method comprising: (i) preparing cells containing an effective amount of any embodiment of the dsRNA agent of the present invention described above or any embodiment of the composition of the present invention described above. In some embodiments, the method further comprises: (ii) maintaining the prepared cells for a sufficient time to allow degradation of the mRNA transcript of the APP gene, thereby inhibiting APP gene expression in the cells. In some embodiments, the cells are in a subject, and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cells are in a subject, and the dsRNA agent is administered to the subject intravenously. In some embodiments, the cells are in a subject, and the dsRNA agent is administered to the subject intrathecally. In some embodiments, the method further comprises assessing the inhibition of the APP gene after administration of the dsRNA agent to the subject, wherein the assessment method comprises: (i) determining one or more physiological characteristics of an APP-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with a pre-treatment baseline of physiological characteristics of the APP-related disease or condition and / or a control physiological characteristic of the APP-related disease or condition, wherein the comparison indicates the presence or absence of inhibition of APP gene expression in the subject. In some embodiments, the physiological characteristics are one or more of the following: APP mRNA levels and APP protein levels (including APP cleavage products). Decreased APP expression can also be indirectly assessed by measuring a decrease in APP biological activity, for example, a decrease in one or more of the following: various forms of APP (e.g., APPα, APPβ, Aβ, Aβ40 and / or Aβ42, etc.), APP C-terminal fragment (CTF) peptides (e.g., α-CTF and / or β-CTF), and / or MAPT peptides, etc.
[0084] Another aspect of this disclosure provides a method for identifying whether a subject has or is at risk of having a disease or condition characterized by enlarged neuronal endosomes and for selecting a treatment method for the subject, the method comprising: a) obtaining a nucleic acid sample from the subject; b) identifying whether the subject has an amyloid precursor (APP) mutation associated with enlarged neuronal endosomes with an APP mutation; and c) selecting an amyloid precursor (APP)-targeting double-stranded RNA inhibitor (dsRNAi) and administering it to the subject in an amount sufficient to reduce APP levels in the subject's neurons, thereby identifying whether the subject has or is at risk of having a disease or condition characterized by enlarged neuronal endosomes and for selecting a treatment method for the subject.
[0085] According to another aspect of the present invention, a method for inhibiting APP gene expression in a subject is provided, the method comprising administering to the subject an effective amount of an embodiment of the above-described dsRNA agent of the present invention or an embodiment of the above-described composition of the present invention. In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the dsRNA agent is administered to the subject intravenously. In some embodiments, the dsRNA agent is administered intrathecally to the subject. In some embodiments, the method further comprises: assessing the inhibition of the APP gene after administration of the dsRNA agent, wherein the assessment method comprises: (i) determining one or more physiological characteristics of an APP-related disease or condition in the subject, and (ii) comparing the determined physiological characteristics with a pre-treatment baseline of physiological characteristics of the APP-related disease or condition and / or a control physiological characteristic of the APP-related disease or condition, wherein the comparison indicates the presence or absence of one or more of the inhibition of APP gene expression in the subject. In some embodiments, APP gene expression may be assessed based on the level or level change of any variable associated with APP gene expression, such as APP mRNA level or APP protein level (including APP cleavage products). Decreased APP expression can also be indirectly assessed by measuring the decrease in the biological activity of APP, for example, various forms of APP (e.g., APPα, APPβ, Aβ, Aβ40 and / or Aβ42, etc.), APP C-terminal fragment (CTF) peptides (e.g., α-CTF and / or β-CTF) and / or MAPT peptides, etc.
[0086] According to another aspect of the invention, a method for treating a disease or condition associated with the presence of the APP protein is provided, the method comprising administering to a subject an effective amount of any of the above-described embodiments of the dsRNA agent of the invention or any of the above-described compositions of the invention to inhibit APP gene expression. In some embodiments, the APP-related disease, condition, or symptom is selected from: cerebral amyloid angiopathy (CAA), Down syndrome (DS), and Alzheimer's disease (AD), including hereditary CAA, early-onset familial Alzheimer's disease (EOFAD or eFAD), late-onset AD (LOAD), as well as amyotrophic lateral sclerosis (ALS), frontotemporal dementia, Huntington's disease, Parkinson's disease, spinocerebellum, prions, Lafra disease, stroke, or other neurodegenerative diseases or abnormalities associated with APP.
[0087] In some embodiments, the method further includes administering an additional treatment regimen to the subject. In some embodiments, the additional treatment regimen includes treating APP-related diseases or conditions. In some embodiments, the additional treatment regimen includes administering one or more APP antisense polynucleotides of the present invention to the subject, administering a non-APP dsRNA therapeutic agent to the subject, and inducing behavioral changes in the subject. In some embodiments, the non-APP dsRNA therapeutic agent is one or more of the following: cholinesterase inhibitors (e.g., donepezil, rivastigmine, and galantamine), memantine, BACE1i, immunotherapy, secretase inhibitors (e.g., gamma secretase inhibitors), acetylcholinesterase inhibitors, NMDA receptor antagonists, antibodies against abeta (e.g., aducanumab), agents against tau protein, anti-synuclein antibodies, fumarate compounds, anti-inflammatory agents, anti-fatty degeneration agents, antiviral agents and / or antifibrotic agents, or other agents for treating AD (including EOAAD) and / or CAA in subjects disclosed herein or known in the art. In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the dsRNA agent is administered to the subject intravenously. In some embodiments, the dsRNA agent is administered to the subject intrathecally. In some embodiments, the dsRNA agent and the non-APP dsRNA therapeutic agent may be administered simultaneously and / or in the same combination, or the non-APP dsRNA therapeutic agent may be administered as part of a single composition or at different times and / or by another method known in the art or described herein. In some embodiments, the method further includes determining the efficacy of the administered double-stranded RNA (dsRNA) agent in the subject. In some embodiments, the method of determining the efficacy of the treatment in the subject includes: (i) determining one or more physiological characteristics of the subject’s APP-related disease or condition, and (ii) comparing the determined physiological characteristics to a pre-treatment baseline of the APP-related disease or condition, wherein the comparison indicates one or more of the presence, absence, and efficacy level of the double-stranded RNA (dsRNA) agent administered to the subject. In some embodiments, APP gene expression can be assessed based on the level or level changes of any variable associated with APP gene expression, such as APP mRNA levels or APP protein levels (including APP cleavage products) in subjects, or various forms of APP (e.g., APPα, APPβ, Aβ, Aβ40 and / or Aβ42, etc.), APP C-terminal fragment (CTF) peptides (e.g., α-CTF and / or β-CTF) and / or MAPT peptides, etc.
[0088] According to another aspect of the invention, a method for reducing APP protein levels in a subject is provided, the method comprising administering to the subject an effective amount of any of the above-described dsRNA agents of the invention or any of the above-described compositions of the invention to reduce APP gene expression levels, compared to a baseline APP protein level in the subject prior to treatment. In some embodiments, the dsRNA agent is administered to the subject subcutaneously, intrathecally, or intravenously.
[0089] According to another aspect of the invention, a method is provided for altering the physiological characteristics of a subject with APP-related disease or condition, the method comprising administering to the subject an effective amount of any of the above-described dsRNA agents of the invention or any of the above-described compositions of the invention to alter the physiological characteristics of the subject with APP-related disease or condition, compared to a pre-treatment baseline of the subject's physiological characteristics with APP-related disease or condition. In some embodiments, the dsRNA agent is administered subcutaneously, intrathecally, or intravenously to the subject. In some embodiments, the physiological characteristics are one or more of the following: the subject's APP mRNA level or APP protein level (including APP cleavage products), or various forms of APP (e.g., APPα, APPβ, Aβ, Aβ40, and / or Aβ42, etc.), APP C-terminal fragment (CTF) peptides (e.g., α-CTF and / or β-CTF), and / or MAPT peptides, etc.
[0090] According to another aspect of the invention, a method is provided for using the above-described dsRNA agent to treat diseases or conditions associated with the presence of APP protein. In some embodiments, the disease or condition is one or more of the following: cerebral amyloid angiopathy (CAA), Down syndrome (DS), and Alzheimer's disease (AD), including hereditary CAA, early-onset familial Alzheimer's disease (EOFAD or eFAD), late-onset AD (LOAD), as well as amyotrophic lateral sclerosis (ALS), frontotemporal dementia, Huntington's disease, Parkinson's disease, spinocerebellum, prions, Lafra disease, stroke, or other neurodegenerative diseases or abnormalities related to APP.
[0091] According to another aspect of the invention, an antisense polynucleotide agent for inhibiting APP protein expression is provided, the agent comprising 10 to 30 consecutive nucleotides, wherein at least one consecutive nucleotide is a modified nucleotide, and wherein the nucleotide sequence of the agent is approximately 80% complementary over its entire length to an equivalent region of the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the equivalent region is any of the target regions in SEQ ID NO: 1, and the complementary sequence is a sequence provided in one of Tables 1-3. In some embodiments, the antisense polynucleotide agent comprises one of the antisense sequences provided in one of Tables 1-3.
[0092] According to another aspect of the invention, a composition comprising any of the antisense polynucleotide agents described above is provided. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents for treating APP-related diseases or conditions. In some embodiments, the composition is packaged in a kit, container, package, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous, intrathecal, or intravenous administration.
[0093] According to another aspect of the invention, a cell comprising any of the antisense polynucleotide agents described above is provided. In some embodiments, the cell is a mammalian cell, optionally a human cell.
[0094] According to another aspect of the present invention, a method for inhibiting APP gene expression in cells is provided, the method comprising: (i) preparing cells containing an effective amount of any of the above-described antisense polynucleotide agents. In some embodiments, the method further comprises (ii) maintaining the cells prepared in (i) for a sufficient time to allow degradation of the mRNA transcript of the APP gene, thereby inhibiting the expression of the APP gene in the cells.
[0095] According to another aspect of the invention, a method for inhibiting APP gene expression in a subject is provided, the method comprising administering to the subject an effective amount of any of the above-described antisense polynucleotide agents.
[0096] According to another aspect of the invention, a method for treating a disease or condition associated with the presence of the APP protein is provided, the method comprising administering to a subject an effective amount of any of the above-described antisense polynucleotide agents or any of the above-described compositions of the invention to inhibit APP gene expression. In some embodiments, the disease or condition is one or more of the following: cerebral amyloid angiopathy (CAA), Down syndrome (DS), and Alzheimer's disease (AD), including hereditary CAA, early-onset familial Alzheimer's disease (EOFAD or eFAD), late-onset AD (LOAD), as well as amyotrophic lateral sclerosis (ALS), frontotemporal dementia, Huntington's disease, Parkinson's disease, spinocerebellum, prions, Lafora disease, stroke, or other neurodegenerative diseases or abnormalities associated with APP.
[0097] According to another aspect of the invention, a method for reducing APP protein levels in a subject is provided, the method comprising administering to the subject an effective amount of any of the above-described antisense polynucleotide agents or any of the above-described compositions of the invention, to reduce APP gene expression levels compared to baseline levels in the subject prior to treatment. In some embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously, intrathecally, or intravenously.
[0098] According to another aspect of the invention, an antisense polynucleotide agent for inhibiting APP gene expression is provided, the agent comprising 10 to 30 consecutive nucleotides, wherein at least one consecutive nucleotide is a modified nucleotide, and wherein the nucleotide sequence of the agent is complementary to about 80% or about 85% of the equivalent region of the nucleotide sequence of SEQ ID NO: 1 over its entire length.
[0099] According to another aspect of the invention, a method is provided for altering the physiological characteristics of a subject with APP-related disease or condition, the method comprising, compared to a baseline of pre-treatment physiological characteristics of the subject with APP-related disease or condition, administering to the subject an effective amount of any of the above-described antisense polynucleotide agents or any of the above-described compositions of the invention to alter the physiological characteristics of the subject's APP disease or condition. In some embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously, intrathecally, or intravenously. In some embodiments, the physiological characteristics are one or more of the following: the subject's APP mRNA level or APP protein level (including APP cleavage products), or various forms of APP (e.g., APPα, APPβ, Aβ, Aβ40 and / or Aβ42, etc.), APP C-terminal fragment (CTF) peptides (e.g., α-CTF and / or β-CTF), and / or MAPT peptides, etc.
[0100] Brief description of the sequence
[0101] SEQ ID NO: 1 and SEQ ID NO: 2 (reverse complementary) are Homo sapiens amyloid β precursor protein (APP) mRNA [NCBI reference sequence: NM_000484.4].
[0102] SEQ ID NO: 3 and SEQ ID NO: 4 (reverse complementary) are predicted precursor amyloid β protein (APP) mRNAs from cynomolgus monkeys [NCBI reference sequence: XM_005548883.3].
[0103] SEQ ID NO: 5 and SEQ ID NO: 6 (reverse complementary) are predicted rhesus monkey amyloid β precursor protein (APP) mRNA [NCBI reference sequence: XM_015133068.2].
[0104] SEQ ID NO: 7 and SEQ ID NO: 8 (reverse complementary) are rat amyloid β precursor protein (APP) mRNA [NCBI reference sequence: NM_019288.2].
[0105] SEQ ID NO: 9-524, 1779-1832, as shown in Table 1, are sense strand sequences.
[0106] SEQ ID NO: 525-1040, 1833-1886, as shown in Table 1, are antisense sequences.
[0107] SEQ ID NO: 1041-1556, as shown in Table 2, are chemically modified sequences.
[0108] SEQ ID NO: 1557-1778 are shown in Table 3. The delivery molecule is indicated as "GLX-__" at the 3' or 5' end of each sense strand. Detailed Implementation
[0109] This invention includes RNAi agents, such as, but not limited to, double-stranded (ds) RNAi agents, which can inhibit the expression of the amyloid precursor (APP) gene. This invention also includes compositions comprising an APP RNAi agent and methods of using the composition. The APP RNAi agents disclosed herein can be attached to a delivery compound for delivery to cells, including CNS (e.g., brain) cells and hepatocytes. Pharmaceutical compositions of this invention may include at least one dsRNAi APP agent and a delivery compound. In some embodiments of the compositions and methods of this invention, the delivery compound is a GalNAc-containing delivery compound. The APP RNAi agent delivered to cells can inhibit APP gene expression, thereby reducing the activity of the APP protein product of this gene in cells. The dsRNAi agents of this invention can be used to treat APP-related diseases and conditions.
[0110] In some embodiments of the invention, reducing APP expression in cells or subjects treats diseases or conditions associated with APP expression in cells or subjects. In some embodiments, dsRNA leads to a reduction in APP gene mRNA in one or more of the hippocampus, striatum, cortex, cerebellum, thalamus, hypothalamus, and spinal cord. Non-limiting examples of diseases and conditions that can be treated by reducing APP activity include: cerebral amyloid angiopathy (CAA), Down syndrome (DS), and Alzheimer's disease (AD), including hereditary CAA, early-onset familial Alzheimer's disease (EOFAD or eFAD), late-onset AD (LOAD), as well as amyotrophic lateral sclerosis (ALS), frontotemporal dementia, Huntington's disease, Parkinson's disease, spinocerebellum, prions, Lafra disease, stroke, or other diseases where reducing the level and activity of APP protein is medically beneficial.
[0111] As used herein, “G,” “C,” “A,” and “U” typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, it should be understood that the term “ribonucleotide” or “nucleotide” can also refer to modified nucleotides (described further below) or substitutional portions. Those skilled in the art will understand that guanine, cytosine, adenine, and uracil can be substituted with other portions without significantly altering the base-pairing properties of the oligonucleotide containing such substituted portions. For example, but not limited to, nucleotides containing inosine as a base can pair with nucleotides containing adenine, cytosine, or uracil. Therefore, in the nucleotide sequences of this invention, nucleotides containing uracil, guanine, or adenine can be substituted with nucleotides containing, for example, inosine. Sequences containing such substitutional portions are embodiments of this invention.
[0112] As used herein, “amyloid precursor” is used interchangeably with the term “APP” and refers to a natural gene encoding an amyloid precursor from any vertebrate or mammalian source, including but not limited to humans, cattle, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys, and guinea pigs, unless otherwise stated. The term also refers to fragments and variants of natural APP that retain at least one in vivo or in vitro activity of the natural APP. The amino acid reference sequence and the complete coding sequence of the human APP gene can be found, for example, in GenBank Ref Seq Accession No. NM_000484.4 (SEQ ID NO: 1 and SEQ ID NO: 2). Mammal orthologs of the human APP gene can be found, for example, in GenBank reference sequence XM_005548883.3, cynomolgus monkey (SEQ ID NO:3 and SEQ ID NO:4), GenBank reference sequence XM_015133068.2, rhesus monkey (SEQ ID NO:5 and SEQ ID NO:6), GenBank reference sequence NM_019288.2, and rat (SEQ ID NO:7 and SEQ ID NO:8). Other examples of APP mRNA sequences are readily available using public databases such as GenBank, UniProt, Ensembl, and OMIM.
[0113] The following describes how to prepare and use compositions comprising APP single-stranded (ssRNA) and dsRNA agents to inhibit APP gene expression, as well as compositions and methods for treating diseases and conditions caused by or regulated by APP gene expression. The term "RNAi" is also known in the art and may be referred to as "siRNA".
[0114] As used herein, the term "RNAi" refers to an agent that contains RNA and mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. As known in the art, an RNAi target region is a contiguous portion of the nucleotide sequence of an mRNA molecule formed during gene transcription, including messenger RNA (mRNA), which is the product of primary transcription of RNA processing. The target portion of the sequence will be at least long enough to serve as a substrate for RNAi-guided cleavage in or near that portion. The target sequence can be 8–30 nucleotides (including end values), 10–30 nucleotides (including end values), 12–25 nucleotides (including end values), 15–23 nucleotides (including end values), 16–23 nucleotides (including end values), or 18–23 nucleotides (including end values), including all shorter lengths within each of these ranges. In some embodiments of the invention, the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the target sequence is 9 to 26 nucleotides in length (including end values), encompassing all subranges and integers therebetween. For example, although not intended to be limiting, in some embodiments of the invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, and the sequence is fully complementary or at least substantially complementary to at least a portion of the RNA transcript of the APP gene. Some aspects of the invention include pharmaceutical compositions comprising one or more APP dsRNA agents and a pharmaceutically acceptable carrier. In some embodiments of the invention, APP RNAi, as described herein, inhibits the expression of the APP protein.
[0115] As used herein, "dsRNA agents" refers to compositions containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules capable of degrading or inhibiting the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. While not wishing to be limited to a particular theory, the dsRNA agents of this invention may function through RNA interference mechanisms (i.e., by interacting with RNA interference pathways in mammalian cells, such as RNA-induced silencing complexes or RISC) or through any alternative mechanisms or pathways. Methods well known in the art for silencing genes in plant, invertebrate, and vertebrate cells [see, for example (Sharp et al., Genes Dev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188)], the entire contents of each of which are incorporated herein by reference. Gene silencing procedures known in the art can be used in conjunction with the disclosures provided herein to suppress APP expression.
[0116] The dsRNA agents disclosed herein consist of a sense strand and an antisense strand, including but not limited to: short interfering RNA (siRNA), RNAi agents, microRNAs (miRNAs), short hairpin RNAs (shRNAs), and cleavage enzyme substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the target mRNA. dsRNA double-stranded structures of varying lengths are known in the art for the purpose of inhibiting target gene expression. For example, dsRNAs with double-stranded structures of 19, 20, 21, 22, and 23 base pairs are known to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). Shorter or longer RNA double-stranded structures are also known in the art to effectively induce RNA interference. In some embodiments, the sense and antisense strands may be the same or different in length. In some embodiments, each strand is no more than 40 nucleotides long. In some embodiments, each strand is no more than 30 nucleotides long. In some embodiments, each strand is no more than 25 nucleotides long. In some embodiments, the length of each strand does not exceed 23 nucleotides. In some embodiments, the length of each strand does not exceed 21 nucleotides. In some embodiments, the lengths of the sense and antisense strands of the RNAi agent can be 15 to 49 nucleotides, respectively. In some embodiments, the length of the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of the sense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, the length of both the sense and antisense strands is 21 nucleotides. In some embodiments, the sense strand and antisense strand are complementary or substantially complementary, and the length of the complementary region is 15 to 23 nucleotides. In some embodiments, the length of the complementary region is 19-21 nucleotides. In some embodiments, the length of the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments of the invention, the APP dsRNA may comprise at least one strand of at least 21 nt in length, or may have a shorter duplex based on one of the sequences listed in any of Tables 1-3, but it may also be effective to reduce one, two, three, or four nucleotides at one or both ends compared to the dsRNAs listed in Tables 1-3.In some embodiments of the present invention, the APP dsRNA agent may have a partial sequence of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotides from one or more sequences in Tables 1-3, and its ability to inhibit APP gene expression differs from the inhibition level produced by dsRNA containing the complete sequence by no more than 5%, 10%, 15%, 20%, 25% or 30%. The sense sequences, antisense sequences and duplexes disclosed in Tables 1-3 may be referred to herein as “parental” sequences, meaning that the sequences disclosed in Tables 1-3 may be modified, shortened, lengthened, or included in substitutions as described herein, and the resulting sequences retain all or at least a portion of the efficacy of their parental sequences in the methods and compositions of the present invention. The sense and antisense strands included in the dsRNA of the present invention are independently selected. As used herein, the term “independently selected” means that each of two or more similar elements can be selected independently of the selection of other elements. For example, although not intended to be limiting, “elements” in both strands may be selected to be included in a duplex when preparing the dsRNA of the present invention. One selected element, the meaningful sequence, may be SEQ ID NO: 1041 (as shown in Table 2), while the other selected element, the antisense sequence, may be SEQ ID NO: 1299, or may be SEQ ID NO: 1299 that has been modified, shortened, lengthened, and / or includes one, two, or three substitutions compared to its parent sequence SEQ ID NO: 1299. It should be understood that the double strands of the present invention do not necessarily include both the paired meaningful and antisense sequences shown in Tables 1-3 simultaneously. Each meaningful and antisense strand sequence in the tables is immediately followed by its SEQ ID NO.
[0117] Some embodiments of the compositions and methods of the present invention include single-stranded RNA in the composition and / or administered to a subject. For example, the antisense strand listed in any of the tables in Tables 1-3 may be a composition or a composition administered to a subject to reduce APP peptide activity and / or APP gene expression in the subject. Table 1 shows the core extension base sequences of the antisense and sense strands of certain APP dsRNA agents. Single-stranded antisense molecules that may be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as “single-stranded antisense agents” or “antisense polynucleotide agents”. Single-stranded sense molecules that may be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as “single-stranded sense agents” or “sense polynucleotide agents”. The term “base sequence” is used herein to refer to a polynucleotide sequence that is not chemically modified or delivers a compound. For example, the sense strand UUCCUGACAAGUGCAAAUUCA (SEQ ID NO: 15) shown in Table 1 is the base sequence of SEQ ID NO: 1047 in Table 2 and SEQ ID NO: 1557 in Table 3, where SEQ ID NO: 1047 and SEQ ID NO: 1557 show their chemical modifications and delivery compounds. The sequences disclosed herein can be assigned identifiers. For example, a single-stranded sense sequence can be identified as “sense strand SS#”; a single-stranded antisense sequence can be identified as “antisense strand AS#”; and a double-stranded sequence including both sense and antisense strands can be identified as “double-stranded AD# / AV#”.
[0118] Table 1 includes positive and antisense strands and provides the identifiers for the bistrands formed by the positive and antisense strands in the same row of Table 1. In some embodiments of the invention, the antisense sequence includes nucleobase u or nucleobase a at antisense sequence position 1. In some embodiments of the invention, the antisense sequence includes nucleobase u at antisense sequence position 1. As used herein, the term "matching position" in positive and antisense strands refers to the "paired" position in each strand when the two strands are bistranded. For example, in a 21-nucleobase positive strand and a 21-nucleobase antisense strand, the nucleobase at position 1 of the positive strand and the nucleobase at position 21 of the antisense strand are at a "matching position". In yet another non-limiting example, in a 23-nucleobase sense strand and a 23-nucleobase antisense strand, nucleobase 2 of the sense strand and position 22 of the antisense strand are at a matching position. In yet another non-limiting example, in both the 18-base sense strand and the 18-base antisense strand, the 1-base position of the sense strand and the 18-base position of the antisense strand are matched, as are the 4-base position of the sense strand and the 15-base position of the antisense strand. Those skilled in the art will understand how to identify the matching positions in both double-stranded and paired sense and antisense strands.
[0119] The last column in Table 1 represents a bichain AV# containing the meaningful and antisense sequences from the same row. For example, Table 1 discloses a bichain designated as bichain AV# AV00622.um, which contains the meaningful chain SEQ ID NO: 9 and the antisense chain SEQ ID NO: 525. Therefore, each row in Table 1 identifies a bichain of the present invention, each bichain containing the meaningful and antisense sequences shown in the same row, with the assignment identifier for each bichain displayed in the first column of the row.
[0120] In some embodiments of the method of the present invention, an RNAi agent comprising any one of the polynucleotide sequences shown in Tables 1-3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a duplex comprising at least one base sequence listed in Table 1, including any one of the following sequence modifications: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24. In some embodiments of the method of the present invention, an RNAi agent comprising any one of the polynucleotide sequences shown in Tables 1-3 is attached to a delivery molecule, a non-limiting example of which is a GalNAc compound or GLS-15. Delivery of compounds.
[0121] Table 1: Unmodified APP RNAi antisense and sense strand sequences. All sequences are shown in 5' to 3' orientation. The double-stranded AV# is the identifier assigned to the two strands in the same row of the table.
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142] Table 2 shows the antisense and sense sequences of certain chemically modified APP RNAi agents of the present invention. In some embodiments of the method of the present invention, the RNAi agent having the polynucleotide sequences shown in Table 2 is administered to cells and / or a subject. In some embodiments of the method of the present invention, the RNAi agent having the polynucleotide sequences shown in Table 2 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises the double strand identified in the first row of Table 2 and includes sequence modifications in the sense and antisense sequences shown in the third and sixth columns of the same row of Table 2, respectively. In some embodiments of the method of the present invention, the sequences shown in Table 2 may be attached to (also referred to herein as "bound to") a compound capable of delivering the RNAi agent to the cells and / or tissues of a subject. Non-limiting examples of delivery compounds that may be used in certain embodiments of the present invention are compounds containing GalNAc or containing (GLS-15) The compounds are listed in Table 2. In Table 2, the first column represents the double-stranded AV# of the base sequences shown in Table 1. Table 2 discloses the double-stranded AV# and also shows the chemical modifications contained in the sense and antisense sequences of the double strands. For example, Table 1 shows the single-stranded base sequences SEQ ID NO: 9 (sense) and SEQ ID NO: 525 (antisense), which together constitute a double strand identified as: double-stranded AV#AV00622.um, and Table 2 lists the double-stranded AV#AV00622, indicating that the double strands of SEQ ID NO: 1041 and SEQ ID NO: 1299 contain the base sequences of SEQ ID NO: 9 and SEQ ID NO: 525, respectively, but have the chemical modifications shown in the sense and antisense sequences shown in columns 3 and 6, respectively. The “sense strand SS#” in the second column of Table 2 is the assignment identifier for the sense sequence (including modifications) shown in column 3 of the same row. The “Ansense Chain AS#” in the fifth column of Table 2 is the assignment identifier for the ansense sequence (including modifications) shown in the sixth column.
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151] Table 3 shows the antisense and sense strand sequences of certain chemically modified APP RNAi agents of the present invention. In some embodiments of the methods of the present invention, the RNAi agents shown in Table 3 are administered to cells and / or subjects. In some embodiments of the methods of the present invention, RNAi agents having the polynucleotide sequences shown in Table 3 are administered to subjects. In some embodiments of the present invention, the RNAi agent administered to the subject comprises the double strand identified in the row of the first column of Table 3, and comprises the sequence modification and / or delivery compounds shown in the sense and antisense strand sequences, respectively, in the third and sixth columns of the same row of Table 3. These sequences are used in certain in vivo assay studies described elsewhere herein. In some embodiments of the methods of the present invention, the sequences shown in Table 3 may be attached to (also referred to herein as “bound to”) a compound for delivery, a non-limiting example of which is a GalNAc-containing compound, wherein the delivery compound is identified as “GLX-n” on the sense strand in the third column of Table 3. As used herein, “GLX-n” is used to represent “GLS-n”. The term "GLX-n" or "GLO-n" refers to a delivery compound ("X" can be "S" or "O") that can be attached to the 3' end of an oligonucleotide during synthesis. As used herein and shown in Table 3, "GLX-n" is used to indicate that the attached GalNAc-containing compound is compound GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 Any one of GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each compound being provided elsewhere herein. Those skilled in the art will be able to prepare and use the dsRNA compounds of the present invention, wherein the linked delivery compound is GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 Any one of GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The first column of Table 3 provides the double-stranded AD# assigned to the double-stranded sequences in that row for the meaningful and antisense sequences. For example, double-stranded AD# AD00488 is a double-stranded sequence with meaningful SEQ ID NO: 1557 and antisense SEQ ID NO: 1604. Each row in Table 3 provides one meaningful strand and one antisense strand, and discloses the double-stranded sequences of the meaningful and antisense strands shown. The “Sensitive Strand SS#” in the second column of Table 3 is the assignment identifier for the meaningful sequence (including modifications) shown in the third column of the same row. In Table 3, the “Ansense Chain AS#” in column 5 is the assignment identifier for the ansense sequence (including modifications) shown in column 6. Some appended GalNAc sequences contain “GLO-n” or “GLS-n”. The compound's identifier is displayed as GLS-5. Or GLS-15 The resulting compounds are included in the embodiments of the methods and / or compositions of the present invention.
[0152]
[0153]
[0154]
[0155]
[0156]
[0157] In some embodiments of the invention, the dsRNA (also referred to herein as a “double strand”) is the dsRNA disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a double strand comprising the sense and antisense sequences of that row. In addition to the double strands disclosed in Tables 1-3, it should be understood that in some embodiments, the double strands of the invention may comprise the sense and antisense sequences shown in Tables 1-3 that differ from the sequences shown in Tables 1-3 by zero, one, two, or three nucleotides. Therefore, as a non-limiting example, in some embodiments, the antisense strand in the double strand of the present invention may be SEQ ID NO: 1605, 1606, 1607, 1608, 1609, 1610, 1611 or 1612, or may have zero, one, two or three different nucleotides from the nucleotides in SEQ ID NO: 1605, 1606, 1607, 1608, 1609, 1610, 1611 or 1612, respectively.
[0158] It should be understood that the sense and antisense sequences in the double strands of the present invention can be selected independently. Therefore, the dsRNA of the present invention may include the sense and antisense strands of the double strands disclosed in the same row of Tables 1-3. Alternatively, in the dsRNA of the present invention, one or both of the selected sense and antisense strands may include the sequences shown in Tables 1-3, but one or both of the sense and antisense strands may include 1, 2, 3, or more nucleobase substitutions from the parental sequence. In some embodiments, the selected sequence may be longer or shorter than its parental sequence. Therefore, the dsRNA agents included in the present invention may, but do not necessarily, include the exact sequences of the sense and antisense strand pairs disclosed as double strands in Tables 1-3.
[0159] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotide positions 2 to 18 of the antisense strand contain a region complementary to the APP RNA transcript, wherein the complementary region contains at least 15 consecutive nucleotides differing from one of the antisense sequences listed in any one of Tables 1-3 by 0, 1, 2, or 3 nucleotides, and optionally contains a targeting ligand. In some cases, the region complementary to the APP RNA transcript contains at least 15, 16, 17, 18, or 19 consecutive nucleotides differing from one of the antisense sequences listed in any one of Tables 1-3 by no more than 3 nucleotides. In some embodiments of the dsRNA agent of the present invention, the antisense strand of the dsRNA is at least substantially complementary to any of the target regions of SEQ ID NO: 1, and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent of the present invention is completely complementary to any of the target regions of SEQ ID NO: 1, and is provided in any one of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense sequence listed in any of Tables 1-3, and the sense sequence is at least substantially complementary to the antisense sequence in the dsRNA agent. In other embodiments, the dsRNA agent of the present invention comprises a sense sequence listed in any of Tables 1-3, and the sense sequence is completely complementary to the antisense sequence in the dsRNA agent. In some cases, the dsRNA agent of the present invention comprises an antisense sequence shown in any of Tables 1-3. Some embodiments of the dsRNA agent of the present invention comprise sense and antisense sequences disclosed as duplexes in any of Tables 1-3. As described herein, it should be understood that the sense and antisense strands in the duplexes of the present invention can be selected independently.
[0160] Mismatch
[0161] Those skilled in the art will know that mismatches in dsRNA are tolerable for efficacy, especially mismatches in the terminal regions of dsRNA. Some mismatches are even more tolerable, for example, mismatches of the wobble base pairs G:U and A:C are tolerable for efficacy (Du et al., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Doi: 10.1093 / nar / gki312. Nucleic Acids Res. 2005;33(11):3698). In some embodiments of the methods and compounds of the present invention, the APP dsRNA agent may contain one or more mismatches with the APP target sequence. In some embodiments, the APP dsRNA agent of the present invention does not contain mismatches. In some embodiments, the APP dsRNA agent of the present invention contains no more than one mismatch. In some embodiments, the APP dsRNA agent of the present invention contains no more than two mismatches. In some embodiments, the APP dsRNA agent of the present invention contains no more than three mismatches. In some embodiments of the present invention, the antisense strand of the APP dsRNA agent contains mismatches with the APP target sequence, and these mismatches are not located at the center of the complementary region. In some embodiments, the antisense strand of the APP dsRNA agent contains 1, 2, 3, 4 or more mismatches, and these mismatches are located within the last 5, 4, 3, 2 or 1 nucleotides of one or both of the 5' or 3' ends of the complementary region. The methods described herein and / or methods known in the art can be used to determine whether an APP dsRNA agent containing mismatches with the APP target sequence effectively inhibits the expression of the APP gene.
[0162] Complementarity
[0163] As used herein, unless otherwise stated, the term "complementarity" when used to describe a first nucleotide sequence (e.g., an APP dsRNA sense strand or targeting APP mRNA) relative to a second nucleotide sequence (e.g., an APP dsRNA antisense strand or a single-stranded antisense polynucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize with an oligonucleotide or polynucleotide comprising the second nucleotide sequence [forming base-pair hydrogen bonds under mammalian physiological conditions (or similar in vitro conditions)] and, under certain conditions, to form a double-stranded or double-helix structure. Other conditions may be applied, such as physiologically relevant conditions that may be encountered in vivo. Those skilled in the art will be able to determine the set of conditions most suitable for testing the complementarity of the two sequences based on the final application of the hybridized nucleotides. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, including native or modified nucleotides or nucleotide mimics, at least to the extent that the hybridization requirements described above are met. Sequence identity or complementarity is independent of modification.
[0164] Complementary sequences, for example, within the APP dsRNA described herein, include oligonucleotides or polynucleotides comprising a first nucleotide sequence and oligonucleotides or polynucleotides comprising a second nucleotide sequence, with bases paired along the entire length of one or both nucleotide sequences. Such sequences may be referred to herein as “perfectly complementary” to each other. It should be understood that, in embodiments, when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs are not considered mismatches for the purposes of this complementarity determination. For example, an APP dsRNA comprising one 19-nucleotide oligonucleotide and another 20-nucleotide oligonucleotide, wherein the longer oligonucleotide comprises a 19-nucleotide sequence perfectly complementary to the shorter oligonucleotide, may still be referred to as “perfectly complementary” for the purposes described herein. Therefore, “perfectly complementary” as used herein means that all (100%) bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide. The sequential sequence may include all or part of the first or second nucleotide sequence.
[0165] As used herein, the term "substantially complementary" means that in the hybridized nucleobase sequence pairs, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (but not all) of the bases in the first polynucleotide sequence will hybridize with the same number of bases in the second polynucleotide sequence. The term "substantially complementary" can be used to refer to the first sequence relative to the second sequence if the two sequences, when hybridizing to form a duplex of up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp), include one or more mismatched base pairs, such as at least 1, 2, 3, 4, or 5 mismatched base pairs, while maintaining the ability to hybridize under conditions most relevant to its final application, such as repressing APP gene expression via a RISC pathway.
[0166] The term "partial complementarity" may be used herein to refer to hybridized nucleobase sequence pairs in which at least 75% (but not all) of the bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide. In some embodiments, "partial complementarity" means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide.
[0167] As used herein, the terms “complementary,” “fully complementary,” “fundamentally complementary,” and “partially complementary” refer to base matching between the positive and antisense strands of the APP dsRNA agent, between the antisense strand of the APP dsRNA agent and the target APP mRNA sequence, or between a single-stranded antisense oligonucleotide and the target APP mRNA sequence. It should be understood that the term “antisense strand of the APP dsRNA agent” can refer to the same sequence as an “APP antisense polynucleotide agent.”
[0168] As used herein, the terms "substantially identical" or "substantially identical" when referring to a nucleic acid sequence mean a nucleic acid sequence containing at least about 85% or more sequence identity with a reference sequence, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%. The percentage of sequence identity is determined by comparing two best-aligned sequences in a comparison window. The percentage is calculated by determining the number of positions in both sequences where the same nucleic acid bases occur to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100. The invention disclosed herein covers nucleotide sequences substantially identical to the nucleotide sequences disclosed herein (e.g., in Tables 1-3). In some embodiments, the sequences disclosed herein are identical to, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, the sequences disclosed herein (e.g., Tables 1-3).
[0169] As used herein, the term "chain containing a sequence" refers to an oligonucleotide containing a nucleotide chain described by a sequence indicated using standard nucleotide nomenclature. The term "double-stranded RNA" or "dsRNA" as used herein refers to an RNAi comprising an RNA molecule or molecular complex having a hybrid double-stranded region comprising two antiparallel and substantially or completely complementary nucleic acid strands with "sense" and "antisense" orientations relative to the target APP RNA. The double-stranded region can be of any length, as long as it allows for specific degradation of the desired target APP RNA via the RISC pathway, but typically ranges in length from 9 to 30 base pairs, for example, 15–30 base pairs. Considering double strands between 9 and 30 base pairs, the length of the double strand can be within this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29. Or 30, and any subrange thereof, including but not limited to, 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18- APP dsRNA agents produced in cells via processing with Dicer and similar enzymes are typically 19-22 base pairs long. One strand of the double-stranded region of the APP dsRNA agent contains a sequence substantially complementary to the region of the target APP RNA. (Note: The original text contains several typographical errors and inconsistencies, which have been omitted from the translation.) The two strands forming a double-stranded structure can originate from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. When the double-stranded region is formed from the two strands of a single molecule, the molecule can have a double-stranded region separated by a single-stranded nucleotide chain (referred to herein as a "hairpin loop") between the 3' end of one strand and the 5' end of the other strand forming the double-stranded structure.In some embodiments of the invention, the hairpin structure comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. When the two substantially complementary strands of an APP dsRNA agent consist of separate RNA molecules, these molecules do not need to be, but can be, covalently linked. When the two strands are covalently linked in a manner other than a hairpin loop, the linking structure is called a “connector.” The term “siRNA” is also used herein to refer to the dsRNA agent described herein.
[0170] In some embodiments of the present invention, the APP dsRNA agent may include sense and antisense sequences without unpaired nucleotides or nucleotide analogs at one or both ends of the dsRNA agent. An end without unpaired nucleotides is called a "blunt end," and there are no nucleotide protrusions. If both ends of the dsRNA agent are blunt ends, the dsRNA is called a "blunt end." In some embodiments of the present invention, the first end of the dsRNA agent is blunt end; in some embodiments, the second end of the dsRNA agent is blunt end; and in some embodiments of the present invention, both ends of the APP dsRNA agent are blunt end.
[0171] In some embodiments of the dsRNA agent of the present invention, the dsRNA does not have one or two blunt ends. In this case, the end of the dsRNA agent chain has at least one unpaired nucleotide. For example, a nucleotide overhang is present when the 3' end of one strand of the dsRNA extends beyond the 5' end of another strand, or vice versa. The dsRNA may contain at least 1, 2, 3, 4, 5, 6 or more nucleotide overhangs. The nucleotide overhangs may comprise or consist of nucleotide / nucleoside analogs (including deoxynucleotides / nucleosides). It should be understood that in some embodiments, the nucleotide overhangs are located on the sense strand of the dsRNA agent, on the antisense strand of the dsRNA agent, or at both ends of the dsRNA agent, and the nucleotides of the overhangs may be present at the 5' end, 3' end, or both ends of the antisense strand or sense strand of the dsRNA. In some embodiments of the present invention, one or more nucleotides in the overhangs are replaced by nucleoside phosphate thioesters.
[0172] As used herein, the terms "antisense strand" or "guide strand" refer to the strand of the APP dsRNA agent that includes regions substantially complementary to the APP target sequence. The terms "sense strand" or "passenger strand" refer to the strand of the APP dsRNA agent that includes regions substantially complementary to the antisense strand region of the APP dsRNA agent.
[0173] Modification
[0174] In some embodiments of the present invention, the RNA of the APP RNAi agent is chemically modified to enhance stability and / or one or more other beneficial properties. The nucleic acids in some embodiments of the present invention may be synthesized and / or modified by methods well established in the art, for example, as described in “Current protocols in Nucleic Acid Chemistry,” Beaucage, SL et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications that may be present in some embodiments of the APP dsRNA agent of the present invention include, for example, (a) terminal modifications, such as 5' terminal modifications (phosphorylation, conjugation, reverse linkage, etc.) and 3' terminal modifications (conjugation, DNA nucleotides, reverse linkage, etc.), (b) base modifications, such as substitution, removal (base-free nucleotides), or binding of bases with stable bases, unstable bases, or bases paired with an extended library of bases, (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitution, and (d) backbone modifications, including modification or substitution of phosphodiester bonds. Specific examples of RNA compounds that can be used in certain embodiments of the APPdsRNA agents, APP antisense polynucleotides, and APP sense polynucleotides of the present invention include, but are not limited to, RNA comprising a modified backbone or RNA without natural nucleoside internucleotide bonds. As a non-limiting example, RNA with a modified backbone may not have a phosphorus atom in its backbone. RNA without a phosphorus atom in its internucleotide backbone may be referred to as an oligonucleotide. In certain embodiments of the present invention, the modified RNA has a phosphorus atom in its internucleotide backbone.
[0175] It should be understood that the terms "RNA molecule" or "RNA" or "ribonucleic acid molecule" not only cover RNA molecules expressed or found in nature, but also include RNA analogs and derivatives containing one or more ribonucleotide / ribonucleoside analogs or derivatives described herein or known in the art. The terms "ribonucleoside" and "ribonucleotide" are used interchangeably herein. RNA molecules may be modified in their nucleobase structure or ribose-phosphate backbone structure, as described below, and molecules containing ribonucleoside analogs or derivatives must retain the ability to form double strands. As a non-limiting example, RNA molecules may also include at least one modified ribonucleoside, including but not limited to 2'-O-methyl modified nucleosides, nucleosides containing a 5'-thiophosphate group, terminal nucleosides linked to cholesterol derivatives or dodecanoic acid bis(decanoic acid) groups, locked nucleosides, baseless nucleosides, 2'-deoxy-2'-fluoro modified nucleosides, 2'-amino modified nucleosides, 2'-alkyl modified nucleosides, morpholino nucleosides, aminophosphates, or nucleosides containing non-natural bases, or any combination thereof. In some embodiments of the invention, the RNA molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more full-length APP dsRNA molecule ribonucleotides, which are modified ribonucleotides. The modifications of each of these plurality of modified ribonucleotides in the RNA molecule need not be identical.
[0176] In some embodiments, the dsRNA agents, APP antisense polynucleotides, and / or APP sense polynucleotides of the present invention may contain one or more independently selected modified nucleotides and / or one or more independently selected nonphosphodiester bonds. The terms “nucleotide bond,” “nucleoside bond,” “bond,” “backbone bond,” and “linker” used herein are used interchangeably to refer to the linking group in the dsRNA backbone of the present invention, which may specifically refer to bonds between unmodified or modified nucleosides in an oligonucleotide chain, and / or bonds between unmodified or modified nucleosides and one or more residues, and / or bonds between unmodified or modified nucleosides and one or more target groups. In some embodiments, the link may be independently selected from phosphodiester (PO) links, phosphate thioester (PS) links, and / or phosphate dithioester (PS2) links of dinucleotides at any position in a single-stranded or double-stranded oligonucleotide. The term “independently selected” used herein with respect to selected elements (e.g., modified nucleotides, nonphosphodiester links, etc.) means that two or more selected elements may, but do not necessarily, be the same as each other.
[0177] As used herein, “nucleotide base,” “nucleotide,” or “nucleobase” refers to a heterocyclic pyrimidine or purine compound, a standard component of all nucleic acids, including the bases that form the nucleotides adenine, guanine, cytosine, thymine, and uracil. Nucleobases may be further modified to include (but are not limited to): universal bases, hydrophobic bases, hybrid bases, size-enlarged bases, and fluorinated bases. The terms “ribonucleotide” or “nucleotide” may be used herein to refer to an unmodified nucleotide, a modified nucleotide, a nucleotide analog, or a substituted moiety. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil may be substituted with other moieties without significantly altering the base-pairing properties of oligonucleotides containing nucleotides with such substituted moieties.
[0178] As used herein, “optionally” or “optionally” means that the event or environment described thereafter may, but is not necessarily, occur, including the possibility that the event or environment may or may not occur. For example, “C1-6 alkyl group optionally substituted with halogen or cyano” means that halogen or cyano group may, but is not necessarily present, including the case where the alkyl group is substituted with halogen or cyano group and the case where the alkyl group is not substituted with halogen or cyano group.
[0179] As used herein, in the chemical structure of the compounds disclosed in this invention, the bond... This indicates an unspecified configuration, meaning that if a chiral isomer exists in the chemical structure, then the bond... It can be " " or" ", or it could be " "and" "Two configurations. Although some of the above structural formulas are described as isomers for simplicity, the present invention can include all isomers, such as tautomers, rotational isomers, and mixtures thereof. Suitable chiral compounds include geometric isomers, diastereomers, racemates, and enantiomers."
[0180] As used herein, the chemical formulas used in the disclosure of this invention refer to " "or" "It can be connected to any one or more groups according to the scope of the invention described herein."
[0181] In one embodiment, the modified RNA used in the methods and compositions described herein is considered to be a peptide nucleic acid (PNA) that has the ability to form the desired double-stranded structure and allows or mediates the specific degradation of the target RNA via a RISC pathway. In some embodiments of the invention, the APP RNA disruptor comprises single-stranded RNA that interacts with the target APP RNA sequence to guide the cleavage of the target APP RNA.
[0182] The modified RNA backbone may include, for example, thiophosphates, chiral thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkylphosphonates (including 3'-alkylphosphonates and chiral phosphonates), phosphonites, aminophosphates (including 3'-aminoaminophosphates and aminoalkylaminophosphates), thiophosphates, thioalkylphosphonates, thioalkyl phosphate triesters, and borophosphates having normal 3'-5' bonds, such 2'-5' linker analogs, and borophosphates having reverse polarity, wherein adjacent nucleoside pairs are linked in a 3'-5' to 5'-3' or 2'-5' to 5'-2' manner. Various salts, mixed salts, and free acid forms are also included. Methods for preparing phosphorus-containing bonds are conventional in the art, and such methods can be used to prepare certain modified APP dsRNA agents, certain modified APP antisense polynucleotides, and / or certain modified APP sense polynucleotides of the present invention.
[0183] The phosphorus-free modified RNA backbone has a backbone formed by short-chain alkyl or cycloalkyl nucleoside bonds, mixed heteroatoms and alkyl or cycloalkyl nucleoside bonds, or one or more short-chain heteroatoms or heterocyclic nucleoside bonds. These include backbones with morpholine bonds (partially formed from the sugar moiety of the nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formyl and thioformyl backbones; methyleneformyl and thioformyl backbones; olefin-containing backbones; aminosulfonate backbones; methyleneimino and methylenehydrazine backbones; sulfonate and sulfonamide backbones; amide backbones; and other backbones with mixed N, O, S, and CH2 components. Methods for preparing phosphorus-free modified RNA backbones are conventional in the art, and such methods can be used to prepare certain modified APP dsRNA agents, certain modified APP antisense polynucleotides, and / or certain modified APP sense polynucleotides of the present invention.
[0184] In some embodiments of the invention, the RNA mimic includes APP dsRNA, APP antisense polynucleotides, and / or APP sense polynucleotides, for example, but not limited to, replacing the sugar and nucleoside bonds of the nucleotide units, i.e., the backbone, with novel groups. In such embodiments, the base units are retained to hybridize with suitable APP nucleic acid target compounds. One such oligomeric compound, an RNA mimic that has shown excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. Nucleobases are retained and bind directly or indirectly to the aza-nitrogen atoms of the amide portion of the backbone. Methods for preparing RNA mimics are conventional practice in the art, and such methods can be used to prepare certain modified APP dsRNA agents of the present invention.
[0185] Some embodiments of the present invention include RNAs with a phosphate thioester backbone and oligonucleotides with a heteroatom backbone, particularly -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as the methylene (methylimino) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2- [wherein the native phosphodiester backbone is represented as -OPO-CH2-]. Methods for preparing RNAs with a phosphate thioester backbone and oligonucleotides with a heteroatom backbone are conventional practices in the art, and such methods can be used to prepare certain modified APPdsRNA agents, certain APP antisense polynucleotides, and / or certain APP sense polynucleotides of the present invention.
[0186] The modified RNA may also contain one or more substituted sugar moieties. The APP dsRNA, APP antisense polynucleotide, and / or APP sense polynucleotide of the present invention may contain one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl, and alkynyl groups may be substituted or unsubstituted C1 to C2 groups. 10 Alkyl or C2 to C 10 Alkenyl and ynyl groups. Exemplary suitable modifications include O[(CH2)] n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n CH3)]2, where n and m are 1 to approximately 10. In other embodiments, the dsRNA at the 2' position includes one of the following: C1 to C 10Lower alkyl groups, substituted lower alkyl groups, alkylaryl groups, aryl alkyl groups, O-alkylaryl or O-aryl alkyl groups, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocyclic alkyl groups, heterocyclic alkylaryl groups, aminoalkylamino groups, polyalkylamino groups, substituted silyl groups, RNA cleaving groups, reporter groups, intercalating agents, groups used to improve the pharmacokinetic properties of APP dsRNA agents, or groups used to improve the pharmacodynamic properties of APP dsRNA agents, APP antisense polynucleotides and / or APP sense polynucleotides, and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., alkoxy-alkoxy. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., the O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in the examples below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Methods for preparing the modified RNA are conventional practices in the art, and such methods can be used to prepare certain modified APP dsRNA agents of the present invention.
[0187] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), and 2'-fluorine (2'-F). Similar modifications can also be made at other positions on the RNA of the APP dsRNA agents, APP antisense polynucleotides, and / or APP sense polynucleotides of the present invention, particularly at the 3' position of the sugar in the 3' terminal nucleotide or the 2'-5' linked APP dsRNA, APP antisense polynucleotide, or APP sense polynucleotide, and at the 5' position of the 5' terminal nucleotide. The APP dsRNA agents, APP antisense polynucleotides, and / or APP sense polynucleotides may also have sugar mimics, for example, replacing the pentofuranose sugar with a cyclobutyl moiety. Methods for preparing modified RNAs (e.g., those described) are conventional practice in the art, and such methods can be used to prepare certain modified APP dsRNA agents, APP antisense polynucleotides, and / or APP sense polynucleotides of the present invention.
[0188] In some embodiments, APP dsRNA agents, APP antisense polynucleotides, and / or APP sense polynucleotides may include nucleobase (generally referred to in the art simply as "bases") modifications or substitutions. As used herein, "unmodified" or "native" nucleobases include purine bases adenine and guanine, and pyrimidine bases thymine, cytosine, and uracil. Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halogenuridine and cytosine, 5-propyneuridine and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, and 5-halogen (especially 5-bromine). 5-Trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deadenine and 7-deadenine, and 3-deadenine and 3-deadenine. Other nucleosides known in the art that may be included in certain embodiments of the APP dsRNA agent of the present invention can be found, for example: Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science and Engineering, pages 858-859; Kroschwitz, J. L, Ed. JohnWiley & Sons, 1990; English et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302; Crooke, ST and Lebleu, B., Ed., CRC Press, 1993.Methods for preparing dsRNAs, APP antisense polynucleotides, and / or APP sense polynucleotides containing nucleobase modifications and / or substitutions (such as those described herein) are conventional practices in the art, and such methods can be used to prepare certain modified APP dsRNAs, APP sense polynucleotides, and / or APP antisense polynucleotides of the present invention.
[0189] Some embodiments of the APP dsRNA agents, APP antisense polynucleotides, and / or APP sense polynucleotides of the present invention comprise RNA modified to include one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety containing an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in a 3'-inner structural conformation. The addition of locked nucleic acids to the APP dsRNA agents, APP antisense polynucleotides, and / or APP sense polynucleotides of the present invention increases stability in serum and reduces off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for preparing dsRNA agents containing locked nucleic acids, APP antisense polynucleotides, and / or APP sense polynucleotides are conventional practices in the art, and such methods can be used to prepare certain modified APP dsRNA agents of the present invention.
[0190] Some embodiments of the APPdsRNA compounds, sense polynucleotides, and / or antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide includes: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seco nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotide containing a 5'-thiophosphate group, nucleotide containing a vinylphosphonate, nucleotide containing adenine, etc. Nucleotides of glycoside-glycol nucleic acid (GNA), nucleotides containing the S-isomer of thymidine-glycol nucleic acid (GNA), nucleotides containing 2-hydroxymethyl-tetrahydrofuran-5-phosphate, nucleotides containing 2'-deoxythymidine-3'-phosphate, nucleotides containing 2'-deoxyguanosine-3'-phosphate, nucleotides containing 2'-deoxyadenosine-3'-phosphate, nucleotides containing 2'-deoxycytidine-3'-phosphate, nucleotides containing 2'-deoxyuridine-3'-phosphate, or terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bis(decanoic acid) amide group, 2'-amino-modified nucleotides, phosphoramides, or nucleotides containing non-natural bases. In some embodiments, the APP dsRNA compound includes an E-vinylphosphonate nucleotide, also referred to herein as the guide strand, at the 5'-terminus of the antisense strand.
[0191] Some embodiments of the APP dsRNA compound of the present invention, the 3' and 5' ends of the sense polynucleotide and / or the 3' end of the antisense polynucleotide, include at least one modified nucleotide, wherein the at least one modified nucleotide includes: abase-free nucleotide, ribitol, inverted nucleotide, inverted abase-free nucleotide, inverted 2'-OMe nucleotide, inverted 2'-deoxy nucleotide. It is known to those skilled in the art that including abase-free or inverted abase-free nucleotide at the end of an oligonucleotide can enhance stability (Czauderna et al. Structural variations and stabilizing modifications of synthetic siRNAs in mammalian cells. Nucleic Acids Res. 2003;31(11):2705-2716. doi:10.1093 / nar / gkg393). In some embodiments, the APP dsRNA compound includes one or more inverted abase-free residues (invabs) at the 3' or 5' end, or both the 3' and 5' ends. Exemplary inverted abase-free residues (invabs) include, but are not limited to, the following:
[0192]
[0193] Some embodiments of the APP dsRNA compound, the 3' and 5' ends of the sense polynucleotide and / or the 3' end of the antisense polynucleotide of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide includes: isomannitol nucleotide or a stereoisomer of said isomannitol nucleotide. Specific examples of isomannitol nucleotide or stereoisomers of said isomannitol nucleotide include, but are not limited to:
[0194]
[0195] The polynucleotide moiety is shown. Exemplary isomannitol residues (imann) include, but are not limited to, the following:
[0196] .
[0197] In some embodiments, isomannitol nucleotides may be further conjugated to one or more targeting groups or delivery molecules, such as the GalNAc moiety.
[0198] Some embodiments of the antisense polynucleotide APP dsRNA compounds of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide includes unlocked nucleic acid (UNA) and / or glycol nucleic acid (GNA). It is known to those skilled in the art that UNA and GNA are thermally unstable chemical modifications that can significantly improve the off-target properties of siRNA compounds (Janas et al., Selection of GalNAc-coupled siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018;9(1):723. doi:10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to boost siRNA performance in vitro and in vivo. Mol BioSyst. 2010;6:862–70).
[0199] Some embodiments of APP dsRNA agents include at least one lipophilic moiety, which includes, for example, but not limited to, saturated or unsaturated C464. 16 Hydrocarbon chain (e.g., linear C16 alkyl or alkenyl). This application provides a lipophilic moiety included at any position in the dsRNA agent. In some embodiments, the lipophilic moiety is bound to a nucleobase, sugar moiety, or nucleoside bond of the double-stranded iRNA agent. For example, C 16Some can bind to the 2'-oxygen of ribonucleotides, as shown in the following structure: .
[0200] As used herein, “lipophilic” or “lipophilic moiety” broadly refers to any compound or chemical moiety that has an affinity for lipids. One way to characterize the lipophilicity of a lipophilic moiety is by means of the octanol-water partition coefficient logKow, where Kow is the ratio of the concentration of the chemical substance in the octanol phase to its concentration in the aqueous phase in a two-phase system at equilibrium. The octanol-water partition coefficient is a laboratory-measured property of a substance. However, it can also be predicted by using coefficients attributed to the structural composition of the chemical substance, which are calculated using first-principles or empirical methods (see, for example, Tetko et al., J. Chem.Inf. Comput. Sci.41:1407-21 (2001), which is incorporated herein by reference in its entirety). It provides a thermodynamic measure of a substance’s tendency to favor a non-aqueous or oily environment over water (i.e., its hydrophilic / lipophilic balance). In principle, a substance is lipophilic when its logKow is greater than 0.
[0201] Another modification that may be included in the RNA of certain embodiments of the APP dsRNA agent, APP antisense polynucleotide, and / or APP sense polynucleotide of the present invention includes chemically linking one or more ligands, portions, or conjugates to the RNA, said ligands, portions, or conjugates enhancing one or more properties of the APP dsRNA agent, APP antisense polynucleotide, and / or APP sense polynucleotide, respectively. Non-limiting examples of properties that can be enhanced include: activity of the APP dsRNA agent, APP antisense polynucleotide, and / or APP sense polynucleotide, cellular distribution, delivery of the APP dsRNA agent, pharmacokinetic properties of the APP dsRNA agent, and cellular uptake of the APP dsRNA agent. In some embodiments of the present invention, the APP dsRNA agent comprises one or more targeting groups or linking groups, which, in certain embodiments of the APP dsRNA agent of the present invention, are conjugated to the sense chain. Non-limiting examples of targeting groups are compounds comprising N-acetylgalactosamine (GalNAc). The terms “targeting group,” “targeting agent,” “linker,” “targeting compound,” “delivery molecule,” “delivery compound,” and “targeting ligand” are used interchangeably herein. In some embodiments of the invention, the APP dsRNA agent comprises a targeting compound conjugated to the 5' end of the sense strand. In some embodiments of the invention, the APP dsRNA agent comprises a targeting compound conjugated to the 3' end of the sense strand. In some embodiments of the invention, the APP dsRNA agent comprises a targeting group containing GalNAc. In some embodiments of the invention, the APP dsRNA agent comprises a targeting group containing a lipophilic moiety. In some embodiments of the invention, the APP dsRNA agent does not include a targeting compound attached to one or both ends of the 3' and 5' ends of the sense strand. In some embodiments of the invention, the APP dsRNA agent does not include a GalNAc-containing targeting compound attached to one or both ends of the 3' and 5' ends of the sense strand.
[0202] Other targeting agents and linkers are well known in the art. For example, targeting agents and linkers that can be used in certain embodiments of the present invention include, but are not limited to, lipid moieties, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:6553-6556), bile acids (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), and thioethers, such as beryl-S-triphenylmethylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306-309; Manoharan et al.). E., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (Oberhauser et al.) Such polypeptides include, but are not limited to: polypeptide chains, for example, hexadecyl-isopentyl-1,2-dihydroxy-2,3-dione or hexadecyl-2-one residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54); polypeptide chains, for example, hexadecyl-isopentyl-1,2-di-O-hexadecyl-isopentyl-1,2-dihydroxy-2,3-dione or hexadecyl-2-one-triethylammonium phosphate (Manoharan et al., Tetrahedron). Lett., 1995, 36: 3651-3654; Shea et al., J. Mol. Biol. 2009, 37: 4771-4776); and polypeptide chains, such as hexadecyl-isopentyl-1,2-di-O-hexadecyl-isopentyl-1,2-dihydroxy-2,3-dione or hexadecyl-2-one-3-phosphate triethylammonium (Steinrich et al., J. Mol. Biol. 2009, 37: 4771-4776).Such polypeptides include, but are not limited to: cyclohexane (Manoharan et al., Nucl. Acids Res., 1990, 18: 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14: 969-973), or adamantaneacetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36: 3651-3654), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264: 229-237), or octadecylamine or hexylaminocarbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277: 923-937).
[0203] Some embodiments of compositions comprising APP dsRNA agents, APP antisense polynucleotides, and / or APP sense polynucleotides may include ligands that alter the distribution, targeting, etc., of the APP dsRNA agent. In some embodiments of compositions comprising the APP dsRNA agent of the present invention, the ligand increases affinity for selected targets (e.g., molecules, cells or cell types, compartments (e.g., cellular or organ compartments), tissues, organs, or body regions) compared to species where such ligands are absent. Ligands that can be used in the compositions and / or methods of the present invention can be naturally occurring substances, such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, such as synthetic polyamino acids or polyamines. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazene. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide polyamines, peptide mimicry polyamines, dendritic polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides.
[0204] The ligands included in the compositions and / or methods of the present invention may contain a targeting group, non-limiting examples of which are cell or tissue targets, such as lectins, glycoproteins, lipids, or proteins, such as antibodies that bind to specific cell types (e.g., CNS cells, kidney cells, or hepatocytes). The targeting group may be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polylactose, polygalactose, N-acetylgalactosamine, N-acetylglucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptides or RGD peptide mimics.
[0205] Other examples of ligands include dyes, intercalators (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, tecosafrine, safeline), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrene), lysine-tyrosine-lysine tripeptides, aminoglycosides, guanidinoaminoglycosides, artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol (and its thio analogues)), cholic acids, cholanonic acids, lithocholic acids, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, and glycerols (e.g., esters such as mono-, di-, or tri-fatty acid esters, e.g., C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20). Fatty acids) and their ethers, such as C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 alkyl groups; such as 1,3-bis-O-hexadecylglycerol, 1,3-bis-O-octadecylglycerol, geranyloxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, stearic acid (e.g., distearate), oleic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, such inhibitors include, but are not limited to, dimethoxytriphenylmethyl or phenoxazine) and peptide conjugates (e.g., anthelmintic peptides, Tat Peptides), alkylating agents, phosphates, amino groups, thiol groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled substances, enzymes, haptens (e.g., biotin), transport / absorption promoters (e.g., aspirin, naproxen, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, diimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, tetraza macrocyclic Eu3+ complexes), dinitrophenyl, HRP, or AP.
[0206] The ligands included in the compositions and / or methods of the present invention may be proteins, such as glycoproteins or peptides, molecules having a specific affinity for an accessory ligand, or antibodies, such as antibodies that bind to a specific cell type (e.g., cancer cells, endothelial cells, cardiomyocytes, or osteocytes). Useful ligands in embodiments of the compositions and / or methods of the present invention may be hormones or hormone receptors. Useful ligands in embodiments of the compositions and / or methods of the present invention may be lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, or polyvalent fucose. Useful ligands in embodiments of the compositions and / or methods of the present invention may be substances capable of increasing the entry of APP dsRNA agents into cells, for example, by disrupting the cellular cytoskeleton, for example, by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. Non-limiting examples of this type of drug include: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.
[0207] In some embodiments, the ligand linked to the APP dsRNA agent of the present invention acts as a pharmacokinetic (PK) modulator. Examples of PK modulators that can be used in the compositions and methods of the present invention include, but are not limited to: lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, cholic acids, lithocholic acids, dialkyl glycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, aptamers that bind serum proteins, etc. Oligonucleotides containing a large number of thiophosphate bonds are also known to bind serum proteins; therefore, short oligonucleotides (e.g., oligonucleotides of about 5, 10, 15, or 20 bases) containing multiple thiophosphate bonds in their main chain can also be used as ligands in the compositions and / or methods of the present invention.
[0208] APP dsRNA agent composition
[0209] In some embodiments of the invention, the APP dsRNA agent is present in the composition. The compositions of the invention may include one or more APP dsRNA agents, and optionally one or more pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable markers, etc. Non-limiting examples of potentially useful targeting agents according to the method of the invention include targeting agents that direct the APP dsRNA agent of the invention to cells to be treated and / or to cells to be treated. The choice of targeting agent will depend on factors such as the nature of the APP-related disease or condition and the type of cells targeted. In non-limiting examples, in some embodiments of the invention, it may be desirable to target and / or direct the APP dsRNA agent to hepatocytes. In non-limiting examples, in some embodiments of the invention, it may be desirable to target and / or direct the APP dsRNA agent to brain cells. In non-limiting examples, in some embodiments of the invention, it may be desirable to target and / or target spinal cord cells. It should be understood that in some embodiments of the method of the present invention, the therapeutic agent comprises an APP dsRNA agent having only a delivery agent, such as a delivery agent containing N-acetylgalactosamine (GalNAc) or a lipophilic moiety, without any additional attaching element. For example, in some aspects of the present invention, the APP dsRNA agent may be attached to a delivery compound containing GalNAc and contained in a composition comprising a pharmaceutically acceptable carrier, and administered to cells or a subject without any detectable marker or target attached to the APP dsRNA agent.
[0210] When the APP dsRNA agent of the present invention is applied together with and / or attached to one or more delivery agents, targeting agents, labeling agents, etc., those skilled in the art will understand and be able to select and use agents suitable for the methods of the present invention. Labeling agents can be used in certain methods of the present invention to determine the location of the APP dsRNA agent in cells and tissues, and can be used to determine the location of cells, tissues, or organs containing a therapeutic composition having been applied in the methods of the present invention. Procedures for attaching and using labeling agents (e.g., enzyme labeling, dyes, radiolabeling, etc.) are well known in the art. It should be understood that in some embodiments of the compositions and methods of the present invention, the labeling agent is attached to one or both of the sense polynucleotides and antisense polynucleotides contained in the APP dsRNA agent.
[0211] Delivery of APP dsRNA and APP antisense polynucleotide drugs
[0212] Some embodiments of the method of the present invention involve delivering an APP dsRNA agent into cells. As used herein, the term "delivery" refers to promoting or influencing cellular uptake or absorption. Absorption or uptake of the APP dsRNA agent can occur through processes involving unassisted diffusion or cell activation, or through the use of a delivery agent, targeting agent, etc., that may be associated with the APP dsRNA agent of the present invention. Delivery methods suitable for the method of the present invention include, but are not limited to, in vivo delivery, wherein the APP dsRNA agent is injected into a tissue site or administered systemically. In some embodiments of the present invention, the APP dsRNA agent is attached to a delivery agent.
[0213] Non-limiting examples of methods that can be used to deliver APP dsRNA agents to cells, tissues, and / or subjects include: APP dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been successfully used in the art to deliver therapeutic RNAi agents for the treatment of a variety of diseases and conditions, such as, but not limited to: neurodegenerative diseases, liver diseases, acute intermittent porphyria (AIP), hemophilia, pulmonary fibrosis, etc. Details of the various delivery methods can be found in the following publications: Nikam, RR & KR Gore (2018) Nucleic Acid Ther, 28(4), 209-224 Aug 2018; Springer AD & SF Dowdy (2018) Nucleic Acid Ther. Jun1; 28(3): 109–118; Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874; Nair, JK et al., (2014) J. Am. Chem. Soc. 136:16958-16961; Imran Sajid M. et al., (2023) Adv Drug Deliv Rev. 199:114968; and Padmakumar S. et al., (2022) J ControlRelease. 352:121-145; all of which are incorporated herein by reference.
[0214] Some embodiments of the present invention include the use of lipid nanoparticles (LNPs) to deliver the APP dsRNA agents of the present invention to cells, tissues, and / or subjects. LNPs are commonly used for in vivo delivery of APP dsRNA agents, including therapeutic APP dsRNA agents. One advantage of using LNPs or other delivery agents is increased stability when delivering APP RNA agents to subjects using LNPs or other delivery agents. In some embodiments of the present invention, the LNP comprises a cationic LNP carrying one or more APP RNAi molecules of the present invention. When an LNP containing APP RNAi molecules is administered to a subject, the LNP and its attached APP RNAi molecules are absorbed by cells via endocytosis, and their presence leads to the release of RNAi-triggered molecules, thereby mediating RNAi.
[0215] Some embodiments of the present invention include using the functional portion to deliver the APP dsRNA agent of the present invention to cells, tissues and / or subjects.
[0216] The functional portion is a molecule that imparts one or more additional activities to an RNA silencer. In some embodiments, the functional portion enhances cellular uptake by target cells (e.g., neurons). Therefore, this disclosure includes RNA silencers conjugated to or unconjugated to another portion (e.g., a non-nucleic acid portion, such as a peptide), an organic compound (e.g., a dye), etc. (e.g., at its 5' and / or 3' ends). Conjugation can be accomplished by methods known in the art, for example, using Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describing nucleic acids loaded onto polyalkyl cyanoacrylate (PACA) nanoparticles); Fattal et al., J. Control Release 53(1-3): 137-43 (1998) (describing nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (describing nucleic acids conjugated to intercalators, hydrophobic groups, polycations, or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (describing nucleic acids conjugated to nanoparticles).
[0217] In one embodiment, the functional portion is a hydrophobic portion. In one embodiment, the hydrophobic portion is selected from fatty acids, steroids, open-ring steroids, lipids, gangliosides and nucleoside analogs, endocannabinoids, and vitamins. In one embodiment, the steroid is selected from the group consisting of cholesterol and lithocholic acid (LCA). In one embodiment, the fatty acid is selected from the group consisting of eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and docosuccinic acid (DCA). In one embodiment, the vitamin is selected from the group consisting of choline, vitamin A, vitamin E, and their derivatives or metabolites. In one embodiment, the vitamin is selected from the group consisting of retinoic acid and α-tocopherol succinate.
[0218] In one embodiment, the disclosed RNA silencer binds to a lipophilic moiety. In one embodiment, the lipophilic moiety is a ligand comprising a cationic group. In another embodiment, the lipophilic moiety is attached to one or both strands of the siRNA. In an exemplary embodiment, the lipophilic moiety is attached to one end of the sense strand of the siRNA. In another exemplary embodiment, the lipophilic moiety is attached to the 3' end of the sense strand. In some embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin E, vitamin K, vitamin A, folic acid, and cationic dyes (e.g., Cy3). In an exemplary embodiment, the lipophilic moiety is cholesterol. Other lipophilic moieties include cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O-hexadecylglycerol, geranyoxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytriphenylmethyl, or phenoxazine.
[0219] In some embodiments, the functional portion may include one or more ligands linked to the RNA silencer to improve stability, hybridization thermodynamics with the target nucleic acid, targeting of a specific tissue or cell type, or cell permeability, for example, through endocytosis-dependent or non-endocytosis-dependent mechanisms. The ligand and associated modifications may also increase sequence specificity and thus reduce ectopic targeting. The linked ligand may include one or more modified bases or sugars that can be used as intercalators. These may be located in internal regions, such as protrusions in the RNA silencer / target double strand. The intercalator may be an aromatic compound, such as a polycyclic aromatic compound or a heterocyclic aromatic compound. Polycyclic intercalators may have stacking capabilities and may include systems with 2, 3, or 4 fused rings. The universal bases described herein may be included on the ligand. In one embodiment, the ligand may include a cleavage group that facilitates the suppression of the target gene by cleaving the target nucleic acid. The cleavage group can be, for example, bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2), pyrene, phenanthroline (e.g., O-phenanthroline), polyamine, tripeptide (e.g., lys-tyr-lys tripeptide), or a metal ion chelating group. The metal ion chelating group can include, for example, Lu(III) or EU(III) macrocyclic complexes, Zn(II) 2,9-dimethylphenanthroline derivatives, Cu(II) terpyridine, or acridine, which can promote the selective cleavage of target RNA by free metal ions (e.g., Lu(III)) at the protrusion site. In some embodiments, the peptide ligand can be linked to an RNA silencing agent to promote the cleavage of target RNA, for example, in the protrusion region. For example, 1,8-dimethyl-1,3,6,8,10,13-hexaazacyclotetradecane (cyclam) can bind to a peptide (e.g., via an amino acid derivative) to promote the cleavage of target RNA. The linker ligand can be an aminoglycoside ligand, which can impart improved hybridization properties or improved sequence specificity to the RNA silencer. Exemplary aminoglycosides include glycosylated polylysine, galactosylated polylysine, neomycin B, tobramycin, kanamycin A, and acridine conjugates of aminoglycosides, such as neo-N-acrididine, neo-S-acrididine, neo-C-acrididine, tobramycin-N-acrididine, and kanamycin-AN-acrididine. Using acridine analogs can increase sequence specificity. For example, neomycin B has a high affinity for RNA compared to DNA, but low sequence specificity. The acridine analog neo-5-acrididine has increased affinity for HIV Rev response elements (RREs). In some embodiments, a guanidine analog of the aminoglycoside ligand (guanidinoglycoside) binds to the RNA silencer. In a guanidinoglycoside, the amino group on the amino acid is exchanged for a guanidino group. The attachment of guanidine analogs can enhance the cellular permeability of RNA silencing agents. The binding ligands can be polyarginine peptides, peptide-like compounds, or peptide mimics, which can enhance the cellular uptake of oligonucleotide agents.
[0220] Exemplary ligands are coupled directly or indirectly to a ligand-binding vector via an intermediate linker. In some embodiments, coupling occurs via a covalent bond. In some embodiments, the ligand is linked to the vector via an intermediate linker. In some embodiments, the ligand alters the distribution, targeting, or lifetime of the RNA silencing agent it binds to. In some embodiments, the ligand provides enhanced affinity to selected targets (e.g., molecules, cells or cell types, compartments (e.g., cellular or organ compartments), tissues, organs, or body regions) compared to species where such ligands are not present.
[0221] Exemplary ligands can improve transport, hybridization, and specificity properties, and can also improve the nuclease resistance of resulting natural or modified RNA silencers or polymer molecules containing any combination of monomers and / or natural or modified ribonucleotides described herein. Ligands can typically include therapeutic modifiers, such as those for enhancing absorption; diagnostic compounds or reporter groups, such as those for monitoring distribution; cross-linking agents; portions that confer nuclease resistance; and natural or uncommon nucleobases. Common examples include lipophilic substances, lipids, steroids (e.g., ursolicol, sea cucumber saponins, diosgenin), terpenes (e.g., triterpenes, such as sasaponins, friedrin, epifriedlandol-derived lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein binders, integrin targeting molecules, polycations, peptides, polyamines, and peptide mimics. Ligands can include naturally occurring substances (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); amino acids; or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, including synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymers, or polyphosphazene. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptide mimic polyamine, dendritic polyamine, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides.
[0222] Ligands may also include targeting groups, such as cell or tissue targets, such as lectins, glycoproteins, lipids, or proteins, such as antibodies, that bind to specific cell types (e.g., kidney cells). Targeting groups can be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polylactose, polygalactose, N-acetylgalactosamine (GalNAc) or its derivatives, N-acetylglucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, biotin, or RGD peptides or RGD peptide mimics. Other examples of ligands include dyes, intercalators (e.g., acridine and substituted acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, tecosafrine, safeline), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrene), lysine-tyrosine-lysine tripeptides, aminoglycosides, guanidinoaminoglycosides, artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol (and its thioanalytes), cholic acids, cholanonic acids, lithocholic acids, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, glycerols (e.g., esters such as mono-, di-, or tri-fatty acid esters, e.g., C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20). Fatty acids) and their ethers, such as C10, C11, C12, C13, C14, C15, C16, C17, C18, C19 or C20 alkyl groups; such as 1,3-bis-O-(hexadecyl)glycerol, 1,3-bis-O-(octadecyl)glycerol), geranyoxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, stearic acid (e.g., distearate), oleic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytriphenylmethyl or phenoxazine) and peptide conjugates (e.g., the ligands mentioned include, but are not limited to: antenna foot peptide, Tat peptide), alkyl The ligands include phosphate esters, amino groups, thiol groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled substances, enzymes, haptens (e.g., biotin), transport / absorption promoters (e.g., aspirin, naproxen, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, diimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, tetraza macrocyclic Eu3+ complexes), dinitrophenyl, HRP, or AP. In some embodiments, the ligand is GalNAc or a derivative thereof.
[0223] Ligands can be proteins, such as glycoproteins, or peptides, such as molecules with a specific affinity for an accessory ligand, or antibodies, such as antibodies that bind to specific cell types (e.g., cancer cells, endothelial cells, or osteocytes). Ligands can also include hormones and hormone receptors. They can also include non-peptide substances, such as lipids, lectins, carbohydrates, vitamins, cofactors, polylactose, polygalactose, N-acetylgalactosamine, N-acetylglucosamine, polymannose, or polyfucose.
[0224] In some embodiments, the functional portion is attached to the 5' end and / or the 3' end of the RNA silencer of this disclosure. In some embodiments, the functional portion is attached to the 5' end and / or the 3' end of the antisense strand of the RNA silencer of this disclosure. In some embodiments, the functional portion is attached to the 5' end and / or the 3' end of the sense strand of the RNA silencer of this disclosure. In some embodiments, the functional portion is attached to the 3' end of the sense strand of the RNA silencer of this disclosure.
[0225] In some embodiments, the functional portion is linked to an RNA silencing agent via a adapter. In some embodiments, the functional portion is linked to an antisense strand and / or a sense strand via a adapter. In some embodiments, the functional portion is linked to the 3' end of the sense strand via a adapter. In some embodiments, the adapter comprises a divalent or trivalent adapter. In some embodiments, the adapter comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphodiester, a thiophosphate, an aminophosphate, an amide, a carbamate, or a combination thereof.
[0226] Another non-limiting example of a delivery agent that can be used in embodiments of the present invention to deliver the APP dsRNA agent of the present invention to cells, tissues, and / or subjects is a drug containing GalNAc, which is linked to the APP dsRNA agent of the present invention and delivers the APP dsRNA agent to cells, tissues, and / or subjects. Examples of additional delivery agents containing GalNAc that can be used in certain embodiments of the methods and compositions of the present invention are disclosed in PCT applications: WO2020191183A1 and WO2023045995 (into this document). A non-limiting example of a GalNAc targeting ligand that can be used in the compositions and methods of the present invention to deliver the APP dsRNA agent to cells is a cluster of targeting ligands. Examples of targeting ligand clusters described herein are referred to as: GalNAc ligands having a phosphodiester linkage (GLO) and GalNAc ligands having a thiophosphate linkage (GLS). The term "GLX-n" may be used herein to indicate that the linked GalNAc-containing compound is compound GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 Any one of GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, wherein the structure of each compound is shown below, with the linker position of the GalNAc targeting ligand shown below at the far right of each RNAi agent of the present invention (denoted by "GLO-1"). (Display). It should be understood that any RNAi and dsRNA molecules of the present invention can be ligated to GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 , GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, GLO-1 to GLO-16 and GLS-1 to GLS-16 structures are as follows.
[0227]
[0228]
[0229]
[0230]
[0231] In some embodiments, the above-described isomannitol nucleotides may be further conjugated to one or more GalNAc targeting ligands. Specific examples of isomannitol nucleotides conjugated to GalNAc targeting ligands include, but are not limited to:
[0232] , The phrase “olig” independently represents each polynucleotide portion.
[0233] In some embodiments of the invention, in vivo delivery may also be performed using β-glucan delivery systems, such as those described in U.S. Patent Nos. 5,032,401 and 5,607,677 and U.S. Publication No. 2005 / 0281781, which are incorporated herein by reference in their entirety. APP RNAi agents can also be introduced into cells in vitro using methods known in the art, such as electroporation and lipid transfection. In some embodiments of the methods of the invention, APP dsRNA is delivered without a target agent. These RNAs can be delivered as “naked” RNA molecules. As a non-limiting example, the APP dsRNA of the invention can be administered to a subject in the form of a pharmaceutical composition comprising an RNAi agent but not a target agent (e.g., a GalNAc targeting compound) to treat the subject’s APP-related disease or condition (e.g., AD).
[0234] In addition to certain delivery methods described herein, it should be understood that RNAi delivery methods (such as, but not limited to, those described herein and those used in the art) may be used in conjunction with embodiments of the APP RNAi agents and treatment methods described herein.
[0235] The APP dsRNA agents of the present invention can be administered to subjects in a quantity and manner that effectively reduces the level and activity of APP peptides in cells and / or subjects. In some embodiments of the methods of the present invention, one or more APP dsRNA agents are administered to cells and / or subjects to treat diseases or conditions associated with APP expression and activity. In some embodiments, the methods of the present invention include administering one or more APP dsRNA agents to subjects requiring such treatment to reduce diseases or conditions associated with APP expression in the subjects. The APP dsRNA agents or APP antisense polynucleotide reagents of the present invention can be administered to reduce APP expression and / or activity in one or more cells in vitro, ex vivo, and in vivo.
[0236] In some embodiments of the invention, the level of APP peptides in cells is reduced, thereby decreasing their activity, by delivering (e.g., introducing) APP dsRNA agents or APP antisense polynucleotide agents into cells. Targeting agents and methods can be used to facilitate the delivery of APP dsRNA agents or APP antisense polynucleotide agents to specific cell types, cell subtypes, organs, spatial regions, and / or intracellular subcellular regions within a subject. In some methods of the invention, APP dsRNA agents can be administered alone or in combination with one or more other APP dsRNA agents. In some embodiments, two, three, four, or more independently selected APP dsRNA agents are administered to the subject.
[0237] In some embodiments of the invention, an APP dsRNA agent is administered to a subject in conjunction with one or more additional treatment regimens for treating APP-related diseases or conditions. Non-limiting examples of additional treatment regimens include: administration of one or more of the APP antisense polynucleotides of the invention, administration of a non-APP dsRNA therapeutic agent, and behavioral modification. The additional treatment regimen may be administered at one or more of the following times: before, simultaneously with, and after administration of the APP dsRNA agent of the invention. It should be understood that “simultaneously” as used herein means within five minutes, ten minutes, thirty minutes, forty-five minutes, and sixty minutes from time zero, where “time zero” refers to the time at which the APP dsRNA agent of the invention is administered to the subject. Non-limiting examples of non-APP dsRNA therapeutics include: cholinesterase inhibitors (e.g., donepezil, rivastigmine, and galantamine), memantine, BACE1i, immunotherapy, secretase inhibitors (e.g., gamma secretase inhibitors), acetylcholinesterase inhibitors, NMDA receptor antagonists, antibodies against abeta (e.g., aducanumab), agents against tau protein, anti-synuclein antibodies, fumarate compounds, anti-inflammatory agents, anti-fatty denaturation agents, antiviral agents, and / or antifibrotic agents, or other agents disclosed herein or known in the art for treating AD (including EOFAD) and / or CAA in subjects. Non-limiting examples of behavior modifiers include: dietary programs, counseling, and exercise programs. These and other therapeutics and behavior modifiers are known in the art for treating APP-related diseases or conditions in subjects and can be administered to subjects in combination with one or more APP dsRNA agents of the present invention to treat APP-related diseases or conditions. The APP dsRNA agent of the present invention, administered to cells or subjects to treat APP-related diseases or conditions, may synergize with one or more other therapeutic agents or activities and enhance the effectiveness of one or more therapeutic agents or activities and / or enhance the effectiveness of the APP dsRNA agent in treating APP-related diseases or conditions.
[0238] The treatment methods of the present invention include the administration of APP dsRNA agents, which can be used before the onset of APP-related disease or condition and / or while APP-related disease or condition is present, including the early, middle, and late stages of the disease or condition, as well as all times before and after these stages. The methods of the present invention can also be used to treat subjects who have previously been treated with one or more other therapeutic agents and / or treatment activities that were unsuccessful, had a low success rate, and / or are no longer successful in treating the subject's APP-related disease or condition.
[0239] vector-encoded dsRNA
[0240] In some embodiments of the invention, APP dsRNA agents can be delivered into cells using vectors. The APP dsRNA agent transcription unit can be contained in a DNA or RNA vector. The preparation and use of vectors encoding transgenes to deliver sequences into cells and / or subjects is well known in the art. Vectors can be used in the methods of the invention to result in transient expression of APP dsRNA, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more hours, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks. The length of transient expression can be determined using conventional methods based on elements such as, but not limited to, the selected specific vector construct and the target cells and / or tissues. Such transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrative or non-integrative vectors. Transgenes can also be constructed to allow their inheritance as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).
[0241] The APP dsRNA agent, either single-stranded or multi-stranded, can be transcribed from a promoter on an expression vector. When expressing two separate strands to produce, for example, dsRNA, two separate expression vectors can be co-introduced into the cell using methods such as transfection or infection. In some embodiments, each separate strand of the APP dsRNA agent of the present invention can be transcribed from a promoter contained on the same expression vector. In some embodiments of the present invention, the APP dsRNA agent is expressed as an inverted repeat polynucleotide linked by a linker polynucleotide sequence, such that the APP dsRNA agent has a stem and loop structure.
[0242] Non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. The expression vectors useful in the embodiments of the present invention are compatible with eukaryotic cells. Eukaryotic cell expression vectors are routinely used in the art and are available from many commercial sources. Delivery of the APP dsRNA expression vector can be systemic, such as by intravenous or intramuscular administration, by administration to target cells removed from the subject and then reintroduced into the subject, or by any other means that allows for the introduction of the desired target cells.
[0243] Viral vector systems that may be included in embodiments of the method include, but are not limited to: (a) adenovirus vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) piconemavirus vectors; (i) poxvirus vectors, such as orthopoxvirus vectors or fowlpoxvirus vectors, such as canarypoxvirus vectors or chickenpoxvirus vectors; and (j) helper-dependent or enterovirus-free adenoviruses. Constructs for recombinant expression of APP dsRNA agents may include regulatory elements, such as promoters, enhancers, etc., which may be selected to provide constitutive or regulated / inducible expression. The use of viral vector systems, promoters, and enhancers, etc., is conventional in the art and may be used in conjunction with the methods and compositions described herein.
[0244] Some embodiments of the present invention include the use of viral vectors to deliver APP dsRNA agents into cells. Various adenovirus-based delivery systems are conventionally used in the art for delivery to, for example, the lungs, liver, central nervous system, endothelial cells, and muscle. Non-limiting examples of viral vectors that can be used in the methods of the present invention are: AAV vectors, poxviruses (e.g., vaccinia virus), modified ankara virus (MVA), NYVAC, and fowlpox (e.g., chickenpox or canarypox).
[0245] Some embodiments of the present invention include a method for delivering APP dsRNA agents into cells using a vector, and such a vector may be located in a pharmaceutically acceptable carrier that may, but does not necessarily, include a sustained-release matrix into which a gene delivery vector is embedded. In some embodiments, a vector for delivering APP dsRNA can be generated from recombinant cells, and the pharmaceutical compositions of the present invention may include one or more cells that generate an APP dsRNA delivery system.
[0246] Pharmaceutical compositions containing APP dsRNA or ssRNA reagents
[0247] Some embodiments of the present invention include pharmaceutical compositions using an APP dsRNA agent or an APP antisense polynucleotide agent and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing an APP dsRNA agent or an APP antisense polynucleotide agent can be used in the methods of the present invention to reduce APP gene expression and APP activity in cells, and can be used to treat APP-related diseases or conditions. Such pharmaceutical compositions can be formulated according to the route of administration. Non-limiting examples of formulations for delivery methods are: formulations for subcutaneous delivery, formulations for intrathecal delivery, formulations for systemic administration via parenteral delivery, formulations for intravenous (IV) delivery, formulations for direct delivery to the brain, etc. Administration of the pharmaceutical compositions of the present invention to deliver an APP dsRNA agent or an APP antisense polynucleotide agent into cells can be performed using one or more methods, such as: topically (e.g., via a transdermal patch), pulmonaryly, for example, by inhalation or blowing in powder or aerosol, including via a nebulizer; intraventricularly, intratracheally, intranasally, epidermally and transdermally, orally or parenterally. Parenteral administration includes intravenous, intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneous, for example, via an implanted device; or intracranial, for example, via intraparenchymal, intrathecal, or intraventricular administration. APP dsRNA agents or APP antisense polynucleotide agents may also be delivered directly to target tissues, such as the liver, kidneys, etc. It should be understood that "delivery of APP dsRNA agents" or "delivery of APP antisense polynucleotide agents" into cells includes, respectively, the direct delivery of APP dsRNA agents or APP antisense polynucleotide agents and the expression of APP dsRNA agents in cells from a coding vector delivered to the cells, or the presence of APP dsRNA or APP antisense polynucleotide agents in cells by any suitable means. Methods for preparing and using formulations and delivering repressive RNA are well known in the art and are routinely used.
[0248] As used herein, a “pharmaceutical composition” comprises a pharmacologically effective amount of the APP dsRNA agent or APP antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term “pharmaceuticalally acceptable carrier” refers to a carrier used for administering the therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. This term explicitly excludes cell culture media. For orally administered pharmaceuticals, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorants, and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginate are suitable disintegrants. Binders may include starch and gelatin, while lubricants (if present) are typically magnesium stearate, stearic acid, or talc. If desired, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay gastrointestinal absorption. Pharmaceutical agents contained in pharmaceutical formulations will be further described below.
[0249] As used herein, terms such as “pharmacologically effective amount,” “therapeuticly effective amount,” and “effective amount” refer to the amount of the APP dsRNA agent or APP antisense polynucleotide agent of the present invention that produces the intended pharmacological, therapeutic, or preventative outcome. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or condition is reduced by at least 10%, then the therapeutically effective amount of a drug used to treat that disease or condition is the amount required to reduce that parameter by at least 10%. For example, a therapeutically effective amount of an APP dsRNA agent or APP antisense polynucleotide agent can reduce APP protein levels by at least 10%.
[0250] Effective amount
[0251] The method of the present invention includes, in some aspects, contacting cells with an effective amount of an APP dsRNA agent or an APP antisense polynucleotide agent to reduce APP gene expression in the contacted cells. Some embodiments of the method of the present invention include administering an effective amount of an APP dsRNA agent or an APP antisense polynucleotide agent to a subject to reduce APP gene expression in the subject and treat the subject with an APP-related disease or condition. An “effective amount” for reducing APP expression and / or treating an APP-related disease or condition is an amount required or sufficient to achieve the desired biological effect. For example, an effective amount of an APP dsRNA agent or an APP antisense polynucleotide agent for treating an APP-related disease or condition may be an amount required to (i) slow or stop the progression of the disease or condition; or (ii) reverse, reduce, or eliminate one or more symptoms of the disease or condition. In some aspects of the present invention, an effective amount is an amount that produces a therapeutic response that prevents and / or treats the disease or condition when the APP dsRNA agent or the APP antisense polynucleotide agent is administered to a subject requiring treatment for an APP-related disease or condition. According to some aspects of the invention, an effective amount is the amount that produces a therapeutic response to prevent and / or treat the APP dsRNA agent or APP antisense polynucleotide agent of the invention when administered to a subject in combination with or in combination with another treatment for an APP-related disease or condition. In some embodiments of the invention, the biological effect of treating a subject with the APP dsRNA agent or APP antisense polynucleotide agent of the invention may be improvement and / or complete elimination of symptoms caused by the APP-related disease or condition. In some embodiments of the invention, the biological effect is the complete elimination of the APP-related disease or condition, for example, by diagnostic testing indicating that the subject has no APP-related disease or condition. Non-limiting examples of detectable physiological symptoms include a decrease in APP levels in the liver of a subject after administration of the agent of the invention. Other methods known in the art for assessing the status of an APP-related disease or condition may be used to determine the effect of the agent and / or method of the invention on the APP-related disease or condition.
[0252] An effective amount of an APP dsRNA agent or APP antisense polynucleotide agent that reduces APP peptide activity to a level sufficient to treat APP-related diseases or conditions is used to determine the effective dose in a blinded study compared to a control population. In some embodiments, the effective amount will result in a desired response, such as a reduction in the amount of APP-related disease or condition in cells, tissues, and / or subjects with the disease or condition. Therefore, an effective amount of an APP dsRNA agent or APP antisense polynucleotide agent that can treat APP-related diseases or conditions by reducing APP peptide activity can be an amount that, upon administration, reduces the amount of APP peptide activity in a subject to less than the amount present in cells, tissues, and / or subjects without administration of the APP dsRNA agent or APP antisense polynucleotide agent. In some aspects of the invention, the APP peptide activity and / or APP gene expression level present in cells, tissues, and / or subjects not exposed to or administered the APP dsRNA agent or APP antisense polynucleotide agent of the invention is referred to as a “control” amount. In some embodiments of the method of the present invention, the control dose for the subject is the subject's pre-treatment dose; in other words, the subject's level before administration of the APP agent can be the subject's control level and compared with the APP peptide activity and / or APP gene expression level in the subject after administration of siRNA. In the treatment of APP-related diseases or conditions, the desired response may be a reduction or elimination of one or more symptoms of the disease or condition in cells, tissues, and / or the subject. The reduction or elimination may be temporary or permanent. It should be understood that methods such as determining APP peptide activity, APP gene expression, symptom assessment, and clinical testing can be used to monitor the status of APP-related diseases or conditions. In some aspects of the present invention, the desired response to the treatment of APP-related diseases or conditions is to delay the onset of the disease or condition or even prevent its onset.
[0253] The effective amount of a compound that reduces APP peptide activity can also be determined by assessing the physiological effects of administration of an APP dsRNA agent or APP antisense polynucleotide agent on cells or subjects (e.g., reduction of APP-related disease or symptoms after administration). The efficacy of the APP dsRNA agent or APP antisense polynucleotide agent of the present invention (which may be administered in the form of the pharmaceutical compounds of the present invention) and whether or not there is a response to treatment can be determined using subject assays and / or symptom monitoring. Non-limiting examples are one or more tests known in the art for APPα, APPβ, and / or Aβ.
[0254] Some embodiments of the present invention include methods for determining the efficacy of the dsRNA agent or APP antisense polynucleotide agent of the present invention administered to a subject, said methods being determined by assessing and / or monitoring one or more “physiological features” of APP-related disease or condition in the subject. Non-limiting examples of physiological features of APP-related disease or condition are APP mRNA levels, APP protein levels (including APP cleavage products) or various forms of APP (e.g., APPα, APPβ, Aβ, Aβ40 and / or Aβ42, etc.), APP C-terminal fragment (CTF) peptides (e.g., α-CTF and / or β-CTF) and / or MAPT peptides, etc. Standard methods for determining such physiological features are known in the art, including but not limited to blood tests, imaging studies, physical examinations, etc.
[0255] It should be understood that the amount of APP dsRNA agent or APP antisense polynucleotide agent administered to the subject can be modified, at least in part, based on the determination of the subject's disease and / or condition and / or physiological characteristics. The therapeutic dose can be varied, for example, by increasing or decreasing the amount of APP-dsRNA agent or APP antisense polynucleotide agent, by changing the composition of the APP dsRNA agent or APP antisense polynucleotide agent administered respectively, by changing the route of administration, by changing the time of administration, etc. The effective amount of APP dsRNA agent or APP antisense polynucleotide agent will vary depending on the specific condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of treatment, the nature of any concurrent therapies, the specific route of administration, and other factors within the knowledge and expertise of the healthcare practitioner. For example, the effective amount may depend on the required APP peptide activity and / or APP gene expression level for effective treatment of APP-related diseases or conditions. Those skilled in the art can determine the effective amount of a specific APP dsRNA agent or APP antisense polynucleotide agent used in the methods of the present invention based on experience without excessive experimentation. Based on the teachings provided herein, an effective preventative or therapeutic regimen for a specific subject can be planned by selecting from the various APP dsRNA agents or APP antisense polynucleotide agents of the present invention and weighing factors such as potency, relative bioavailability, patient weight, severity of adverse side effects, and preferred route of administration. As used in the embodiments of the present invention, the effective amount of the APP dsRNA agent or APP antisense polynucleotide agent of the present invention can be the amount that produces the desired biological effect in the cell upon contact with the cell.
[0256] It should be recognized that APP gene silencing can be determined in any cell expressing APP, whether constitutively or through genome engineering, and by any appropriate assay. In some embodiments of the invention, by administration of the APP dsRNA agent of the invention, APP gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments of the invention, by administration of the APP dsRNA agent of the invention, APP gene expression is reduced by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100%, or 50% to 100%.
[0257] Dosage
[0258] The APP dsRNA agent and the APP antisense polynucleotide agent are delivered in the pharmaceutical composition at a dose sufficient to inhibit APP gene expression. In some embodiments of the invention, the dose of the APP dsRNA agent or the APP antisense polynucleotide agent is in the range of 0.01 to 200.0 mg per kg body weight per day for the recipient, typically in the range of 1 to 50 mg, 5 to 40 mg, 10 to 30 mg, 1 to 20 mg, 1 to 10 mg, 4 to 15 mg per kg body weight per day, including daily doses. For example, APP dsRNA or APP antisense polynucleotides can be administered at the following doses per unit body weight: 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3.0 mg / kg, 3.1 mg / kg, 3.2 mg / kg, 3.3 mg / kg, 3.4 mg / kg, 3.4 mg / kg, 3.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3.0 mg / kg, 3.1 mg / kg, 3.2 mg / kg, 3.3 mg / kg, 3.4 mg / kg, 3.5 mg / kg, 3.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3.0 ...3.7 mg / kg, 2 mg / kg, 3.5 mg / kg, 3.6 mg / kg, 3.7 mg / kg, 3.8 mg / kg, 3.9 mg / kg, 4 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 mg / kg, 7 mg / kg, 7.1 mg / kg, 7.2 mg / kg, 7.3 mg / kg, 7.4 mg / kg, 7.5 mg / kg, 7.6 mg / kg, 7.7 mg / kg, 7.8 mg / kg, 7.9 mg / kg, 8 mg / kg, 8.1 mg / kg, 8.2 mg / kg, 8.3 mg / kg, 8.4 mg / kg, 8.5 mg / kg, 8.6 mg / kg, 8.7 mg / kg, 8.8 mg / kg, 8.9 mg / kg, 9 mg / kg, 9.1 mg / kg, 9.2 mg / kg, 9.3 mg / kg, 9.4 mg / kg, 9.5 mg / kg, 9.6 mg / kg, 9.7 mg / kg, 9.8 mg / kg, 9.9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, up to 50 mg / kg. .
[0259] Various factors can be considered when determining the dosage and timing of administration of the APP dsRNA agent of the present invention. The absolute amount of the APP dsRNA agent or APP antisense polynucleotide agent administered will depend on various factors, including concurrent treatment, number of doses, and individual subject parameters, including age, physical condition, body size, and weight. These are factors well known to those skilled in the art and can be resolved through routine experiments. In some embodiments, a maximum dose may be used, i.e., the highest safe dose based on reasonable medical judgment.
[0260] In some embodiments, the method of the present invention may include administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses of an APP dsRNA agent or an APP antisense polynucleotide agent. In some cases, the pharmaceutical compound (e.g., containing an APP dsRNA agent or containing an APP antisense polynucleotide agent) may be administered to the subject at least daily, every other day, weekly, every other week, monthly, etc. The dose may be administered once daily or multiple times daily, for example, 2, 3, 4, 5 or more times within a 24-hour period. The pharmaceutical composition of the present invention may be administered once daily, or the APP dsRNA agent or APP antisense polynucleotide agent may be administered in two, three or more sub-dose doses at appropriate intervals throughout the day, or even delivered using continuous infusion or by controlled-release formulation. In some embodiments of the method of the present invention, the pharmaceutical composition of the present invention may be administered to the subject once or more daily, once or more weekly, once or more monthly, or once or more annually.
[0261] In some aspects, the method of the present invention includes administering a pharmaceutical compound alone, in combination with one or more other APP dsRNA agents or APP antisense polynucleotide agents, and / or in combination with other pharmaceutical therapies or treatment activities or regimens administered to a subject suffering from an APP-related disease or condition. The pharmaceutical compound may be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the method of the present invention may be sterile and contains an amount of APP dsRNA agent or APP antisense polynucleotide agent that will reduce the activity of the APP polypeptide to a level sufficient to produce the desired response, expressed in units of weight or volume suitable for administration to the subject. The dose of the pharmaceutical composition, comprising an APP dsRNA agent or APP antisense polynucleotide agent to reduce the activity of the APP protein, administered to the subject may be selected based on various parameters, particularly the route of administration and the condition of the subject. Other factors include the required duration of treatment. If the subject does not respond adequately to the initial dose, a higher dose may be used within the patient's tolerance (or the dose may be effectively increased via a different, more localized route of delivery).
[0262] treat
[0263] The terms “APP-related diseases,” “APP-related diseases and conditions,” and “diseases and conditions caused and / or regulated by APP” as used herein are intended to include any disease associated with the APP gene or protein. Such diseases may be caused by, for example, overproduction of the APP protein, mutations in the APP gene, aberrant cleavage of the APP protein, or aberrant interactions between APP and other proteins or other endogenous or exogenous substances. Exemplary APP-related diseases include, but are not limited to: cerebral amyloid angiopathy (CAA), Down syndrome (DS), and Alzheimer's disease (AD), including hereditary CAA, early-onset familial Alzheimer's disease (EOFAD or eFAD), late-onset AD (LOAD), as well as amyotrophic lateral sclerosis (ALS), frontotemporal dementia, Huntington's disease, Parkinson's disease, spinocerebellum, prions, Lafra disease, stroke, or other APP-related neurodegenerative diseases or abnormalities.
[0264] Hereditary CAA (hCAA) is an angioprotein disorder, and the amyloid treatment hypothesis is relatively simple and clinically testable. It is a devastating rare disease with no current treatment. Biochemical and imaging biomarkers are available for clinical validation of anti-APP siRNA-mediated hCAA therapy.
[0265] One specific type of hCAA under consideration for treatment with the RNAi agents disclosed herein is “Dutch type” APhCAA, with an estimated number of several hundred patients, primarily located in the Netherlands and Western Australia. What makes hCAA unique among APP-related diseases is its purely vascular nature: in CAA, amyloid fibrils are deposited in the arteries and capillaries of the CNS parenchyma and pia mater, leading to cognitive decline in subjects with CAA due to cerebral ischemia and microbleeds. CAA is present in over 80% of AD subjects (of which 25% of AD subjects have moderate to severe CAA), and the incidence of CAA increases with age, reaching approximately 50% in individuals over 70 years of age.
[0266] The following are typical manifestations of hereditary CAA:
[0267] - β-amyloid protein - sporadic CAA, HCHWA-Dutch and Italian types EOFAD, LOAD, Down syndrome;
[0268] - ABri—Family Dementia in the UK;
[0269] - ADan—Danish familial dementia;
[0270] - Cystatin C—HCHWA-Icelandic type (HCHWA-hereditary cerebral hemorrhage with amyloidosis);
[0271] - Gel protein - Familial amyloidosis - Finnish type;
[0272] - Prion proteins—Prion diseases;
[0273] - Transthyretin—hereditary systemic amyloidosis.
[0274] As mentioned above, Aβ-hCAA (also known as APP-hCAA) is a rapidly progressive dementia associated with cerebral hemorrhage. Known indications for CAA include APP-hCAA and sporadic CAA. Other possible indications for CAA include: CAA associated with EOFAD (PSEN1; APP; PSEN2); CAA associated with Down syndrome; and CAA associated with late-onset Alzheimer's disease (as mentioned above, this disease is very common).
[0275] The prevalence of APP-hCAA is unclear; however, pure APP-hCAA is less common than EOFAD (Dutch-type hCAA (involving the APP E693Q mutation) has been reported in hundreds of individuals). Typically, APP-hCAA symptoms develop between 35 and 45 years of age; APP-hCAA usually progresses to severe CVA within 2–5 years, with a peak age of death from CVA at 55 years.
[0276] Sporadic CAA presents with a relatively high prevalence as an indicator: it is a common cause of lobar hemorrhage (ICH) in older adults. It is also a rapidly progressive disease, with 86 out of 316 patients (36%) experiencing recurrent ICH during a mean 5-year follow-up period (Van Etten et al. 2016 Neurology). One study observed a cumulative dementia incidence of 14% at 1 year and 73% at 5 years in sporadic CAA (Xiong et al. 2017 JCerebr Blood Flow Metab). Sporadic CAA also extensively overlaps with Alzheimer's disease (AD), as advanced CAA has been identified in approximately 25% of AD brain cases; however, in reality, less than 50% of CAA cases meet the pathological criteria for AD.
[0277] In some aspects of the invention, the APP dsRNA agent or APP antisense polynucleotide agent of the invention may be administered to a subject at one or more time points before or after the diagnosis of an APP-related disease or condition. In some aspects of the invention, the subject is at risk of having or developing an APP-related disease or condition. A subject at risk of developing an APP-related disease or condition is a subject with an increased probability of developing an APP-related disease or condition compared to a control risk level. In some embodiments of the invention, the risk level may be statistically significant compared to a risk control level. Subjects at risk may include, for example, subjects who are or will have a pre-existing disease and / or genetic abnormality that makes them more susceptible to an APP-related disease or condition than control subjects without a pre-existing disease or genetic abnormality; subjects with a family and / or personal history of an APP-related disease or condition; and subjects who have previously received treatment for an APP-related disease or condition. It should be understood that pre-existing diseases and / or genetic abnormalities that make a subject more susceptible to an APP-related disease or condition may be diseases or genetic abnormalities that have been previously identified as having a higher likelihood of developing an APP-related disease or condition.
[0278] It should be understood that the APP dsRNA agent or APP antisense polynucleotide agent can be administered to the subject based on the individual subject's medical condition. For example, healthcare providers may assess APP levels measured in samples obtained from the subject and determine that it is desirable to reduce the subject's APP levels by administering the APP dsRNA agent or APP antisense polynucleotide agent of the present invention. In this example, APP levels can be considered a physiological characteristic of APP-related diseases, even if the subject has not been diagnosed with any of the APP-related diseases disclosed herein. Healthcare providers may monitor changes in the subject's APP levels as a measure of the efficacy of the administered APP dsRNA agent or APP antisense polynucleotide agent of the present invention. In a non-limiting example, biological samples, such as blood or tissue samples, can be obtained from the subject, and the subject's APP levels can be determined in the samples. The APP dsRNA agent or APP antisense polynucleotide agent is administered to the subject, and a blood sample is obtained from the subject after administration, which is used to determine the APP levels, and the results are compared with those determined in samples taken before (before) administration. The decrease in APP levels in subjects' later samples compared to pre-administration levels indicates that the administered APP dsRNA or APP antisense polynucleotide agent was effective in reducing Aβ levels in subjects.
[0279] Some method embodiments of the present invention include adjusting treatment, including administering the dsRNA agent or APP antisense polynucleotide agent of the present invention to a subject, based at least in part on an assessment of changes in one or more physiological characteristics of the subject’s APP-related disease or condition resulting from the treatment. For example, in some embodiments of the present invention, the effect of the administered dsRNA agent or APP antisense polynucleotide agent of the present invention on the subject may be determined and used to help adjust the amount of the dsRNA agent or APP antisense polynucleotide agent of the present invention subsequently administered to the subject. In a non-limiting example, the dsRNA agent or APP antisense polynucleotide agent of the present invention is administered to a subject, the subject’s APP level is measured after administration, and based at least in part on the measured level, it is determined that a larger amount of the dsRNA agent or APP antisense polynucleotide agent is needed to increase the physiological effect of the administered agent, such as reducing or further reducing the subject’s APP level. In another non-limiting example, the dsRNA agent or APP antisense polynucleotide agent of the present invention is administered to a subject, the subject's APP level is measured after administration, and based at least in part on the measured level, a lower amount of the dsRNA agent or APP antisense polynucleotide agent needs to be administered to the subject.
[0280] Therefore, some embodiments of the present invention include assessing changes in one or more physiological characteristics of a subject resulting from prior treatment in order to adjust the amount of the dsRNA agent or APP antisense polynucleotide agent of the present invention subsequently administered to the subject. Some embodiments of the method of the present invention include 1, 2, 3, 4, 5, 6 or more physiological characterizations of APP-related diseases or conditions to assess and / or monitor the efficacy of the administered APP dsRNA agent or APP antisense polynucleotide agent of the present invention, and optionally using these measurements to adjust one or more of the dosage, administration regimen, and / or administration frequency of the dsRNA agent or APP antisense polynucleotide agent of the present invention to treat the subject's APP-related diseases or conditions. In some embodiments of the method of the present invention, the expected result of administering an effective amount of the dsRNA agent or APP antisense polynucleotide agent of the present invention to a subject is a reduction in the subject's APP mRNA level, APP protein level (including APP cleavage products) or various forms of APP (e.g., APPα, APPβ, Aβ, Aβ40 and / or Aβ42, etc.), APP C-terminal fragment (CTF) peptides (e.g., α-CTF and / or β-CTF) and / or MAPT peptide, compared to a previous or control level determined for the subject.
[0281] As used herein, when referring to APP-related diseases or conditions, the terms “treatment” or “treated” or “being treated” can refer to preventive treatment that reduces the likelihood of a subject developing an APP-related disease or condition, or to treatment administered after a subject has developed an APP-related disease or condition in order to eliminate or reduce the level of the APP-related disease or condition, prevent the APP-related disease or condition from becoming more severe (e.g., more serious), and / or slow the progression of the APP-related disease or condition in the subject compared to untreated subjects, thereby reducing the activity of APP peptides in the subject.
[0282] Certain embodiments of the agents, compositions, and methods of the present invention can be used to inhibit APP gene expression. As used herein with respect to APP gene expression, the terms “inhibit,” “silence,” “reduction,” “downregulation,” and “knockdown” refer to a reduction in APP gene expression compared to control levels of transcribed APP RNA, expressed APP activity, or translated APP from mRNA, when cells, cell populations, tissues, organs, or subjects are contacted (e.g., treated with) the APP dsRNA agent or APP antisense polynucleotide agent of the present invention, as measured by one or more of the following: a reduction in the levels of transcribed RNA, expressed APP activity, and translated APP polypeptides, proteins, or protein subunits from mRNA, respectively, in the cells, cell populations, tissues, organs, or subjects. In some embodiments, the control level is the level in cells, tissues, organs, or subjects that have not been contacted (e.g., treated with) the APP dsRNA agent or APP antisense polynucleotide agent.
[0283] Administration method
[0284] Various routes of administration for APP dsRNA agents or APP antisense polynucleotide agents can be used in the methods of the present invention. The specific route of administration chosen depends at least in part on the specific condition being treated and the dose required to achieve the therapeutic effect. Generally, the methods of the present invention can be implemented using any medically acceptable route of administration, i.e., any route that produces a level of effective treatment for APP-related diseases or conditions without causing clinically unacceptable adverse reactions. In some embodiments of the present invention, the APP dsRNA agents or APP antisense polynucleotide agents can be administered via oral, enteral, mucosal, subcutaneous, and / or parenteral routes. The term "parenteral" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection or infusion techniques. Other routes include, but are not limited to, nasal (e.g., via a gastric tube), skin, vagina, rectum, sublingual, and inhalation. Delivery routes of the present invention can include intrathecal, intraventricular, or intracranial. In some embodiments of the present invention, the APP dsRNA agents or APP antisense polynucleotide agents can be placed in a sustained-release matrix and administered by placing the matrix in the subject. In some aspects of the invention, APP dsRNA agents or APP antisense polynucleotide agents can be delivered to subject cells using nanoparticles coated with delivery agents targeting specific cells or organelles. Various delivery means, methods, and agents are known in the art. Non-limiting examples of delivery methods and agents are also provided elsewhere herein. In some aspects of the invention, the term "delivery" in relation to APP dsRNA agents or APP antisense polynucleotide agents can refer to the administration of one or more "naked" APP dsRNA agent or APP antisense polynucleotide agent sequences to cells or a subject, and in other aspects of the invention, "delivery" refers to administration to cells or a subject via transfection, delivery to a subject of cells containing APP dsRNA agents or APP antisense polynucleotide agents, delivery to cells and / or a subject of a vector encoding APP dsRNA agents or APP antisense polynucleotide agents, etc. Delivery of APP dsRNA agents or APP antisense polynucleotide agents using transfection may include administration of a vector to cells and / or a subject.
[0285] In some methods of the present invention, one or more APP dsRNA agents or APP antisense polynucleotide agents may be administered in formulation form, which may be administered in a pharmaceutically acceptable solution form, typically containing pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the present invention, the APP dsRNA agent or APP antisense polynucleotide agent may be formulated together with another therapeutic agent for simultaneous administration. According to the methods of the present invention, the APP dsRNA agent or APP antisense polynucleotide agent may be administered in the form of a pharmaceutical composition. Typically, the pharmaceutical composition comprises an APP dsRNA agent or APP antisense polynucleotide agent and optionally a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those skilled in the art. As used herein, a pharmaceutically acceptable carrier refers to a non-toxic material that does not interfere with the effectiveness of the bioactivity of the active ingredient (e.g., the ability of the APP dsRNA agent or APP antisense polynucleotide agent to inhibit APP gene expression in cells or subjects). Various methods of administration and delivery of dsRNA agents or APP antisense polynucleotide agents for therapeutic purposes are known in the art and can be used in the methods of the present invention.
[0286] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, and other carriers are known to those skilled in the art. Such formulations may typically contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in pharmaceuticals, salts should be pharmaceutically acceptable, but non-pharmaceuticalally acceptable salts may be readily used to prepare their pharmaceutically acceptable salts, and are not excluded from the scope of this invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc. Furthermore, pharmaceutically acceptable salts may be prepared as alkali metal or alkaline earth salts, such as sodium, potassium, or calcium salts.
[0287] Some embodiments of the method of the present invention include direct administration of one or more APP dsRNA agents or APP antisense polynucleotide agents to tissues. In some embodiments, the tissue to which the compound is administered is a tissue in which APP-related diseases or conditions exist or may occur, a non-limiting example being the heart. Direct tissue administration can be achieved by direct injection or other means. Many orally delivered compounds naturally reach and pass through the liver and kidneys, and some embodiments of the treatment methods of the present invention include oral administration of one or more APP dsRNA agents to a subject. APP dsRNA agents or APP antisense polynucleotide agents, whether administered alone or in combination with other therapeutic agents, can be administered once or in multiple doses. If administered multiple times, APP dsRNA agents or APP antisense polynucleotide agents can be administered via different routes. For example, although not intended to be limiting, the first (or first few) doses can be administered subcutaneously, and one or more additional doses can be administered orally and / or systemically.
[0288] For embodiments of the present invention requiring systemic administration of APP dsRNA agents or APP antisense polynucleotide agents, the APP dsRNA agents or APP antisense polynucleotide agents may be formulated for parenteral administration by injection, such as by bolus or continuous infusion. Injectable formulations may be available in unit dose form, such as ampoules or multi-dose containers, with or without preservatives. APP dsRNA agent formulations (also referred to as pharmaceutical compositions) may be in the form of suspensions, solutions, or emulsions in oily or aqueous carriers, and may contain formulations such as suspending agents, stabilizers, and / or dispersants.
[0289] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffer media. Parenteral carriers include sodium chloride solutions, Ringer's glucose, glucose and sodium chloride, lactated Ringer's solutions, or non-volatile oils. Intravenous carriers include fluids and nutritional supplements, electrolyte supplements (such as Ringer's glucose-based supplements), etc. Preservatives and other additives may also be present, such as antibacterial agents, antioxidants, chelating agents, and inert gases. Other forms of administration (such as intravenous administration) may use lower doses. If a subject does not respond adequately to the initial dose, a higher dose may be used within the patient's tolerance (or a higher dose may be used effectively via a different, more localized route of delivery). Multiple doses can be used daily as needed to achieve appropriate systemic or local levels of one or more APP dsRNA agents or APP antisense polynucleotide agents and to achieve an appropriate reduction in APP protein activity.
[0290] In other embodiments, the method of the present invention includes the use of a delivery carrier, such as biocompatible microparticles, nanoparticles, or implants suitable for implantation into a recipient (e.g., a subject). Exemplary biodegradable implants that may be useful according to this method are described in PCT Publication WO 95 / 24929 (incorporated herein by reference), which describes a biocompatible, biodegradable polymer matrix for containing biomacromolecules.
[0291] In the methods of this invention, non-biodegradable and biodegradable polymer matrices can be used to deliver one or more APP dsRNA agents or APP antisense polynucleotide agents to a subject. In some embodiments, the matrix may be biodegradable. The matrix polymer may be a natural or synthetic polymer. The polymer can be selected based on the desired release time period, typically from a few hours to a year or longer. Typically, release times ranging from a few hours to three to twelve months can be used. The polymer may optionally be in the form of a hydrogel that can absorb up to about 90% of its weight in water, and may further optionally be crosslinked with multivalent ions or other polymers.
[0292] Generally, in some embodiments of the invention, bioerodible implants can be used to deliver APP dsRNA agents or APP antisense polynucleotide agents by diffusion or by degradation of a polymer matrix. Exemplary synthetic polymers for such uses are well known in the art. APP dsRNA agents or APP antisense polynucleotide agents can be delivered using both biodegradable and non-biodegradable polymers by methods known in the art. Bioadhesive polymers such as bioerodible hydrogels (see HS Sawhney, CP Pathak and JA Hubell in Macromolecules, 1993, 26, 581-587, whose teachings are incorporated herein by reference) can also be used to deliver APP dsRNA agents or APP antisense polynucleotide agents to treat APP-related diseases or conditions. Other suitable delivery systems may include timed-release, delayed-release, or sustained-release delivery systems. Such systems avoid repeated administration of APP dsRNA agents or APP antisense polynucleotide agents, thereby increasing convenience for subjects and healthcare professionals. Many types of release delivery systems are available and are known to those skilled in the art. (See, for example: U.S. Patent Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686 (the teachings of each patent are incorporated herein by reference). Additionally, pump-based hardware delivery systems may be used, some of which are suitable for implantation.)
[0293] The use of long-release implants may be suitable for prophylactic treatment in subjects, as well as for subjects at risk of recurrent APP-related diseases or conditions. Long-release, as used herein, refers to an implant constructed and positioned to deliver therapeutic levels of APP dsRNA or APP antisense polynucleotides for at least 10, 20, 30, 60, 90 days, six months, one year, or longer. Long-release implants are well known to those skilled in the art and include some of the release systems described above.
[0294] Therapeutic formulations of APP dsRNA or APP antisense polynucleotide agents can be prepared by mixing a molecule or compound of desired purity with an optional pharmaceutically acceptable carrier, excipient, or stabilizer, and stored as a lyophilized formulation or an aqueous solution [Remington's Pharmaceutical Sciences, 21st edition, (2006)]. Acceptable carriers, excipients, or stabilizers are non-toxic to the recipient at the doses and concentrations used and include buffers such as phosphate esters, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyl dimethyl benzyl ammonium chloride; hexamethyl chloride; benzalkonium chloride, benzyl chloride; phenol, butanol, or benzyl alcohol; alkyl parabens such as methyl or propyl parabens; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); and low molecular weight (less than about 10 residues). Polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants, such as TWEEN. ® PLURONICS ® Or polyethylene glycol (PEG).
[0295] Cells, subjects and controls
[0296] The methods of this invention can be used with cells, tissues, organs, and / or subjects. In some aspects of this invention, the subject is a human or vertebrate mammal, including but not limited to dogs, cats, horses, cattle, goats, mice, rats, and primates such as monkeys. Therefore, this invention can be used to treat APP-related diseases or conditions in human and non-human subjects. In some aspects of this invention, the subject can be a farm animal, zoo animal, domesticated animal, or non-domesticated animal, and the methods of this invention can be used in veterinary prevention and treatment programs. In some embodiments of this invention, the subject is a human, and the methods of this invention can be used in human prevention and treatment programs.
[0297] Non-limiting examples of subjects to whom this invention can be applied are subjects diagnosed with, suspected of having, or at risk of developing a disease or condition associated with higher than expected APP expression and / or activity, also referred to as “elevated APP expression levels.” Non-limiting examples of diseases and conditions associated with higher than expected APP expression and / or activity are described elsewhere herein. The methods of this invention can be applied to subjects diagnosed with a disease or condition associated with higher than expected APP expression and / or activity at the time of treatment, or subjects considered at risk of developing or progressing to a disease or condition associated with higher than expected APP expression and / or activity. In some aspects of this invention, the disease or condition associated with higher than expected APP expression and / or activity is an acute disease or condition, while in other aspects, it is a chronic disease or condition.
[0298] In one non-limiting example, the APP dsRNA agent of the present invention is administered to a subject diagnosed with, suspected of having, or at risk of developing Alzheimer's disease (AD), a disease requiring reduction of APP expression. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects considered to be at risk of developing or progressing to the disease or condition.
[0299] In another non-limiting example, the APP dsRNA agent of the present invention is administered to a subject diagnosed with, suspected of having, or at risk of developing AD, a disease requiring reduction of APP expression. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects considered to be at risk of developing or progressing to the disease or condition.
[0300] Cells to which the methods of this invention can be applied include in vitro, in vivo, and isolated cells. Cells may be present in the subject's body, in cultures and / or suspensions, or in any other suitable state or condition. Cells to which the methods of this invention can be applied may be hepatocytes, hepatocytes, brain cells, spinal cord cells, heart cells, pancreatic cells, cardiovascular cells, kidney cells, or other types of vertebrate cells, including human and non-human mammalian cells. In some aspects of this invention, cells to which the methods of this invention can be applied are healthy, normal cells, which are unknown to be diseased cells. In some embodiments of this invention, the cells to which the methods and compositions of this invention are applied are hepatocytes, hepatocytes, brain cells, spinal cord cells, heart cells, pancreatic cells, cardiovascular cells, and / or kidney cells. In some aspects of this invention, control cells are normal cells, but it should be understood that cells suffering from a disease or condition may also be used as control cells in certain circumstances, such as comparing the results of treated cells suffering from a disease or condition with untreated cells suffering from the same disease or condition.
[0301] According to the method of the present invention, the level of APP peptide activity can be determined and compared with the level of APP peptide activity control. The control can be a predetermined value, which can take various forms. It can be a single cutoff value, such as the median or mean. It can be established based on comparison groups, such as a group with normal levels of APP peptide and / or APP peptide activity and a group with increased levels of APP peptide and / or APP peptide activity. Another non-limiting example of a comparison group can be a group with symptoms or diagnosis of one or more APP-related diseases or conditions; a group without symptoms or diagnosis of one or more diseases or conditions; a group of subjects treated with the siRNA of the present invention; or a group of subjects not treated with the siRNA of the present invention. Typically, the control can be based on seemingly healthy normal individuals or seemingly healthy cells of appropriate age. It should be understood that, in addition to predetermined values, the control according to the present invention can be a material sample tested in parallel with the experimental material. Examples include samples from a control population or control samples generated by manufacturing to be tested simultaneously with the experimental samples. In some embodiments of the present invention, the control may include cells or subjects that have not been exposed to or treated with the APP dsRNA agent of the present invention, and in this case, the control level of APP peptide and / or APP peptide activity may be compared with the APP peptide and / or APP peptide activity level in cells or subjects exposed to the APP dsRNA agent or APP antisense polynucleotide agent of the present invention.
[0302] In some embodiments of the invention, the APP peptide level in a subject may be a comparison of a control level with APP peptide levels measured in the same subject at different times. In a non-limiting example, APP levels are measured in biological samples obtained from subjects who have never received APP treatment according to the invention. In some embodiments, the biological sample is a tissue sample. The APP peptide level measured in the sample obtained from the subject may be used as a baseline or control for the subject. In the treatment method of the invention, after administering one or more APP dsRNA agents to a subject, one or more additional tissue samples may be obtained from the subject, and the APP peptide levels in the subsequent samples may be compared to the subject's control / baseline levels. This comparison can be used to assess the onset, progression, or remission of APP-related disease or condition in the subject. For example, a higher APP peptide level in a baseline sample obtained from a subject than the level obtained from that subject after administering the APP dsRNA agent or APP antisense polynucleotide agent of the invention to the same subject indicates remission of the APP-related disease or condition and indicates the efficacy of the administered APP dsRNA agent of the invention in treating the APP-related disease or condition.
[0303] In certain aspects of the invention, one or more values of APP peptide levels and / or APP peptide activity determined for a subject can be used as control values for later comparison of APP peptide levels and / or APP activity in the same subject, thereby allowing assessment of changes in APP peptide activity in the subject relative to “baseline.” Therefore, an initial APP peptide level and / or initial APP peptide activity level may exist and / or be determined in the subject, and the methods and compounds of the present invention can be used to reduce APP peptide levels and / or APP peptide activity in a subject, wherein the initial level is used as a control level for that subject.
[0304] Using the method of the present invention, the APP dsRNA agent and / or APP antisense polynucleotide agent of the present invention can be administered to a subject. The effectiveness of the administration and treatment of the present invention can be assessed when the APP peptide level in a tissue sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-administration level of the APP peptide in a tissue sample obtained from the subject at a previous time point, or compared to the level of a non-contact control (e.g., the APP peptide level in a control tissue sample). It should be understood that both the level of the APP peptide and the level of APP peptide activity are related to the level of APP gene expression. Certain embodiments of the method of the present invention include administering an effective amount of the APP dsRNA and / or APP antisense agent of the present invention to the subject to inhibit APP gene expression and thereby reduce the subject's APP peptide level and APP peptide activity level.
[0305] Some embodiments of the present invention include determining the presence, absence, and / or amount (also referred to herein as level) of an APP peptide in one or more biological samples obtained from one or more subjects. This determination can be used to evaluate the efficacy of the treatment methods of the present invention. For example, the methods and compositions of the present invention can be used to determine the APP peptide level in biological samples obtained from subjects previously treated with the APP dsRNA agent and / or APP antisense agent of the present invention. An APP peptide level measured in tissue samples obtained from treated subjects that is at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more lower than the pre-treatment APP peptide level determined for the subject or the level in a non-contact control biological sample indicates the efficacy level of the treatment administered to the subject.
[0306] In some embodiments of the invention, the physiological characteristics of APP-related diseases or conditions determined for a subject may be control assays, compared with physiological characteristic assays of the same subject at different times. In a non-limiting example, physiological characteristics of the subject, such as APP mRNA levels, APP protein levels (including APP cleavage products), or various forms of APP (e.g., APPα, APPβ, Aβ, Aβ40, and / or Aβ42, etc.), APP C-terminal fragment (CTF) peptides (e.g., α-CTF and / or β-CTF) and / or MAPT peptides, are determined in biological samples (e.g., tissue samples) obtained from subjects who have never received APP treatment according to the invention. The APP mRNA levels (and / or other physiological characteristics of APP diseases or conditions) determined from samples obtained from the subject may be used as a baseline or control for the subject. In the treatment methods of this invention, after administering one or more APP dsRNA agents to a subject, one or more additional tissue samples may be obtained from the subject, and the APP mRNA levels and / or APP protein levels (including APP cleavage products) in the subsequent samples are compared with the subject's control / baseline levels and / or ratios, respectively. Such comparisons can be used to assess the onset, progression, or regression of APP-related disease or condition in the subject. For example, if the APP mRNA level in the baseline sample obtained from the subject is higher than the APP mRNA level measured in a sample obtained from the same subject after administering the APP dsRNA agent or APP antisense polynucleotide agent of this invention to the subject, it indicates regression of APP-related disease or condition and demonstrates that the administered APP dsRNA agent of this invention is effective in treating APP-related disease or condition.
[0307] In certain aspects of the invention, one or more physiological characteristic values for APP-related diseases or conditions identified in a subject can be used as control values to allow for subsequent comparison of the physiological characteristics of the same subject, thereby allowing assessment of changes in the subject's physiological characteristics relative to a "baseline". Thus, a subject may have and / or have identified initial physiological characteristics, and the methods and compounds of the invention can be used to reduce the APP peptide and / or APP peptide activity levels of a subject, wherein the initial physiological characteristic measurements serve as a control for that subject.
[0308] Using the method of the present invention, the APP dsRNA agent and / or APP antisense polynucleotide agent of the present invention can be administered to a subject in an effective amount to treat APP disease or condition. The effectiveness of the administration and treatment of the present invention can be evaluated by determining changes in one or more physiological characteristics of the APP disease or condition. In a non-limiting example, the APP mRNA level in the tissue sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to the pre-administration APP mRNA level in tissue samples obtained from the subject at a previous time point, or compared to the level in a non-contact control (e.g., the APP mRNA level in a control tissue sample). It should be understood that the levels of APP mRNA, APP protein (including APP cleavage products), or various forms of APP (e.g., APPα, APPβ, Aβ, Aβ40, and / or Aβ42), APP C-terminal fragment (CTF) peptides (e.g., α-CTF and / or β-CTF) and / or MAPT peptides in plasma or tissue samples are all associated with APP gene expression levels. Certain embodiments of the method of the present invention involve administering the APP dsRNA and / or APP antisense agent of the present invention to the subject in amounts that effectively inhibit APP gene expression, thereby reducing the subject's APP mRNA levels, APP protein levels (including APP cleavage products), or otherwise positively influencing the physiological characteristics of the subject's APP-related diseases or conditions.
[0309] Some embodiments of the present invention include using methods to determine the presence, absence, and / or changes in physiological characteristics of APP-related diseases or conditions, such as, but not limited to: (1) assessing the physiological characteristics of one or more biological samples obtained from one or more subjects; (2) imaging the subjects (e.g., but not limited to, acquiring liver images); and (3) performing a physical examination on the subjects. The determination results can be used to evaluate the effectiveness of the treatment methods of the present invention.
[0310] medicine box
[0311] The scope of this invention also includes kits containing one or more APP dsRNA agents and / or APP antisense polynucleotide agents and instructions for their use in the methods of this invention. The kits of this invention may include one or more APP dsRNA agents, APP sense polynucleotides, and APP antisense polynucleotide agents, which can be used to treat APP-related diseases or conditions. Kits containing one or more APP dsRNA agents, APP sense polynucleotides, and APP antisense polynucleotide agents can be prepared for use in the treatment methods of this invention. The components of the kits of this invention may be packaged in an aqueous medium or in lyophilized form. The kits of this invention may include a carrier divided into multiple or a series of container devices, such as test tubes, vials, flasks, bottles, syringes, etc., and tightly confining them therein. A first container device or a series of container devices may contain one or more compounds, such as APP dsRNA agents and / or APP sense or antisense polynucleotide agents. A second container device or a series of container devices may contain targeting agents, labeling agents, delivery agents, etc., which may be included as part of the APP dsRNA agent and / or APP antisense polynucleotide in embodiments of the treatment methods of this invention.
[0312] The kit of the present invention may also include instructions. The instructions are typically in written form and provide guidance on how to implement the treatment contained in the kit and on making decisions based on that treatment.
[0313] The following examples are provided to illustrate specific instances of the practice of the present invention and are not intended to limit the scope of the invention. Those skilled in the art will understand that the present invention is applicable to a variety of compositions and methods. Specific Implementation
[0314] Example 1. Phosphoramide compound 1
[0315]
[0316] Under a N2 atmosphere at 0–5 °C, compound D (607 mg, 3.34 mmol, 3.0 eq) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 eq) were added to a solution of compound B (500 mg, 1.11 mmol, 1.0 eq) in DCM (5.0 mL). The mixture was stirred at 25 °C for 1.0 h. LC-MS showed that compound B was completely consumed, with several new peaks appearing on the LC-MS, indicating that approximately 70.9% of the desired compound was detected. The resulting reaction mixture was cooled to -20 °C and poured into a cold (0–5 °C) saturated NaHCO3 (5.0 mL) solution, and stirred with DCM (5.0 mL). 2) Extraction: The combined organic layers were washed with cold (0-5°C) saturated NaHCO3 / salt water = 1:1 (5.0 mL / 5.0 mL), dried over Na2SO4, and concentrated under vacuum to obtain a residue (~5 mL). The residue was purified by column chromatography (basic Al2O3, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1, 0.1% Et3N) to give compound 1 (280 mg, 471 μmol, yield 42.3%) as a white solid.
[0317] 1H NMR: EC10615-49-P1N (400 MHz, DMSO-d6) δ ppm 7.44 (br d, J=7.63Hz, 2 H), 7.31 (br t, J=7.94 Hz, 6 H), 7.18 - 7.26 (m, 1 H), 6.89 (brd, J=8.00 Hz, 4 H), 4.08 - 4.13 (m, 1 H), 3.95 - 4.03 (m, 1 H), 3.84 - 3.93 (m, 1H), 3.77 - 3.83 (m, 1 H), 3.74 (s, 6 H), 3.43 - 3.53 (m, 3 H), 3.38 (br d, J=6.75 Hz, 1 H), 2.94 - 3.04 (m, 1 H), 2.70 - 2.85 (m, 1 H), 1.09 - 1.15 (m, 12H), 1.07 (br s, 3 H).
[0318] Example 2. Phosphoramide compound 2
[0319]
[0320] A solution of DMTrCl (232 g, 684 mmol, 1.0 equivalent) dissolved in pyridine (400 mL) was added to a solution of isomannitol compound A (100 g, 684 mmol, 1.0 equivalent) dissolved in pyridine (600 mL). The mixture was stirred at 25 °C for 12 hours. LC-MS showed that compound A was completely consumed, and a main peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 mL) and then diluted with DCM (500 mL). 2) Extraction: The combined organic phases were washed with brine (500 mL), dried over Na2SO4, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to give compound B (150 g, 48.9% yield) as a yellow solid.
[0321] 1H NMR: EC4783-404-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.46 (br d, J=7.63Hz, 2 H) 7.28 - 7.37 (m, 6 H) 7.19 - 7.25 (m, 1 H) 6.90 (br d, J=7.88 Hz, 4H) 4.70 (d, J=6.50 Hz, 1 H) 3.99 - 4.09 (m, 6 H) 3.88 - 3.96 (m, 2 H) 3.83 (br dd, J=7.82, 6.94 Hz, 1 H) 3.74 (s, 6 H) 3.41 (br t, J=8.13 Hz, 1H) 3.05 (t, J=8.44 Hz, 1 H) 2.85 (br t, J=7.50 Hz, 1 H).
[0322] Under a N2 atmosphere at 25°C, 2H-tetrazole (0.45 M, 436 mL, 1.1 eq) was added dropwise to a DCM (800 mL) solution of compound B (80.0 g, 178 mmol, 1.0 eq), followed by a DCM (200 mL) solution of compound C (80.6 g, 267 mmol, 85.0 mL, 1.5 eq). The reaction mixture was stirred at 25°C for 1.0 h. LC-MS showed that compound B was completely consumed, and a main peak with the desired mass was detected. The resulting reaction mixture was cooled to -20°C and poured into ice-cold saturated NaHCO3 (500 mL), and then added with DCM (500 mL). 3) Extraction: The combined organic layers were washed with saturated NaHCO3 / salt water at a ratio of 1:1 (300 mL / 300 mL), dried over Na2SO4, and concentrated under vacuum (35°C) to obtain a residue (100 mL). The residue was purified by column chromatography (Al2O3, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to give compound 2 (77 g, 119 mmol, yield 66.5%) as a white solid.
[0323] 1H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.22 (br d, J=7.50Hz, 2 H) 7.05 - 7.14 (m, 6 H) 6.96 - 7.02 (m, 1 H) 6.67 (br dd, J=8.82, 1.81Hz, 4 H) 3.95 - 4.07 (m, 2 H) 3.73 - 3.83 (m, 1 H) 3.62 - 3.72 (m, 2 H) 3.48- 3.53 (m, 6 H) 3.27 - 3.37 (m, 3 H) 3.11 (s, 6 H) 2.82 (td, J=8.54, 2.31 Hz, 1 H) 2.47 - 2.63 (m, 3 H) 2.28 (br d, J=1.63 Hz, 3 H) 0.82 - 1.00 (m, 13 H).
[0324] Other phosphoramides can be prepared according to the methods described herein and / or existing technologies (e.g., but not limited to US426,220 and WO02 / 36743).
[0325] Example 3. Preparation of a solid support containing the phosphorus amide monomer of the present invention
[0326]
[0327] Under nitrogen protection, 19.50 kg of dichloromethane was added to a 50 L glass reactor. Stirring was started, and the temperature was controlled at 20–30 °C. 1.47 kg of DMT Trimann, 1.50 kg of triethylamine, 0.164 kg of 4-dimethylaminopyridine, and 1.34 kg of succinic anhydride were added to the reactor. The mixture was kept at 20–30 °C for 18 h, and a sample was taken to terminate the reaction. 22.50 kg of saturated sodium bicarbonate solution was added to the reaction system, and the mixture was stirred for 10–20 min, resulting in layer separation. The organic phase was separated, and the aqueous phase was extracted twice with dichloromethane. The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum to obtain 1.83 kg of a gray to off-white solid residue.
[0328] Add N,N-dimethylformamide (23.50 kg) to a 100 L glass reactor, stir, and control the temperature at 20-30 °C. Under nitrogen protection, add the previous product O-benzotriazole tetramethylurea hexafluorophosphate (0.33 kg) and N,N-diisopropylethylamine (0.13 kg) to the 100 L glass reactor through a solid feeding funnel, stir for 10-30 minutes, and discharge the material into a 50 L zinc drum for later use. Macroporous amine methyl resin (3.25 kg) (purchased from Tianjin Nankai Synthetic Technology Co., Ltd., batch number HA2X1209, loading 0.48 mmol / g) was added to the 100 L solid-phase synthesis reactor through a solid feed funnel. The temperature was controlled at 20–30 °C. N,N-dimethylformamide (21.00 kg + 21.00 kg) and the reaction solution from the zinc tank in the previous step were added to the solid-phase synthesis reactor. The reaction was maintained at this temperature, and the solid loading was monitored until it reached ≥250 μmol / g. The loading was detected by UV light. The mixture was filtered under nitrogen pressure, and the filter cake was washed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg). The filter cake was then left in the reactor. Add CAP.A (50% acetonitrile and 50% acetic anhydride, 4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (20% pyridine, 30% N-methylimidazole, and 50% acetonitrile, 4.40 kg + 4.40 kg + 4.47 kg) to an 80 L glass reactor and stir for 3-8 min before use. Repeat this operation three times. Cover the reactor and add acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) to a solid-phase synthesis reactor. Purge with nitrogen for 10-30 min and then filter. Repeat this operation four times. Purge the filter cake in the solid-phase synthesis reactor with nitrogen for 2-4 h and then transfer it to a 50 L filter press. Maintain the temperature at 15-30 °C and continue drying. After drying, a yellow to white solid product is obtained, weighing 3.516 kg.
[0329] Isomannitol residues can be added to the 5' or 3' end of the oligonucleotide chain using methods well known to those skilled in the art, such as the invab method, and further added to the target group.
[0330] Example 4. Synthesis of APP RNAi agent.
[0331] The APP RNAi agent duplexes shown in Table 2-3 above were synthesized according to the following general procedure:
[0332] The sense and antisense sequences of siRNA were synthesized on an oligonucleotide synthesizer using a well-established solid-phase synthesis method based on phosphoramide chemistry. The amplification of the oligonucleotide chains was achieved through a four-step cycle: deprotection, coupling, capping, and oxidation or sulfidation steps for adding each nucleotide. Synthesis was performed on a solid support made of controlled-aperture glass (CPG, 1000 Å). The monomeric phosphoramide was commercially available or could be the phosphoramide compound described in Examples 1-2 or WO2023 / 045995. The phosphoramide compound described herein could be attached as a monomeric nucleotide to the 3' end of the CPG or polystyrene solid support. When attached to the 5' end, the phosphoramide compound could be used for the final coupling reaction and could be further bound to a target ligand if desired.
[0333] Phosphoramides (GLPA1, GLPA2, and GLPA15 as non-limiting examples) having GalNAc ligand clusters were synthesized according to the methods shown in Schemes 1 and 2 or according to the method in WO2023 / 045995. In the GalNAc ligand (GLS-5) Or GLS-15 In the case of a phosphorous amide (GLPA1, GLPA2, or GLPA15 as non-limiting examples) attached to the 5' end of the sense chain, GalNAc is used for the final coupling reaction. 3% trichloroacetic acid (TCA) in dichloromethane is used for deprotection of the 4,4'-dimethoxytriphenylmethyl protecting group (DMT). 5-Ethylthio-1H-tetrazole is used as an activator. I2 in THF / Py / H2O and phenylacetyl disulfide (PADS) in pyridine / MeCN are used for oxidation and sulfidation reactions, respectively. After the final solid-phase synthesis step, the oligomer bound to the solid support is cleaved, and the protecting group is removed by treatment with a 1:1 volume mixture of 40 wt.% aqueous methylamine and 28% ammonium hydroxide solution. For the synthesis of siRNA for in vitro screening, the crude mixture is concentrated. The remaining solid was dissolved in 1.0 M NaOAc, and ice-cold EtOH was added to precipitate the single-chain product as a sodium salt, which could be used for annealing without further purification. For the synthesis of multi-target molecules for in vivo testing, the crude single-chain product was further purified by ion-paired reversed-phase high-performance liquid chromatography (IP-RP-HPLC). The purified single-chain oligonucleotide product from IP-RP-HPLC was converted to a sodium salt by dissolving it in 1.0 M NaOAc and precipitating it with ice-cold EtOH. Annealing of equimolar complementary sense and antisense oligonucleotides was carried out in water to form a double-stranded siRNA product, which was then lyophilized to obtain a fluffy white solid.
[0334]
[0335] Option 1
[0336]
[0337] Option 2
[0338]
[0339]
[0340]
[0341] Example 5. In vitro screening of APP siRNA duplexes
[0342] 1) Cells and main reagents
[0343] BE(2)C cell line (provided by WuXi AppTec)
[0344] Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen -13778150)
[0345] TRIzol™ reagent (Invitrogen - 15596018)
[0346] PrimeScript™ RT Kit (with gDNA Eraser) (Perfect Real Time) (TaKaRa-RR047A)
[0347] TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa-RR820A)
[0348] 2) Instruments
[0349] The main instrument used in the study was the QuantStudio™ 7 Flex System (Applied Biosystems).
[0350] 3) Primers
[0351] Primer #3: 5'-3'
[0352] Positive: TGACCATCCAGAACTGGTGC
[0353] Reverse: ACGGTGTGCCAGTGAAGATG
[0354] Actin: 5'-3'
[0355] Positive: GTGGACATCCGCAAAGAC
[0356] Reverse: AAAGGGTGTAACGCAACTAA
[0357] Lipofectamine™ RNAiMax (Invitrogen - 13778150) was used for reverse transfection of oligonucleotides. BE(2)C cells were digested with trypsin and adjusted to an appropriate density, then seeded into 24-well plates at 1×10⁶ cells / well. 5 Cells / well. Simultaneously with seeding, test siRNA was transfected into cells using Lipofectamine RNAiMax (2 μL per well). siRNA was tested at 1 nM and 0.2 nM. Wells transfected with scrambled siRNA served as negative controls.
[0358] 24 hours after transfection, the culture medium was discarded, and the cells were harvested for RNA extraction. Total RNA was extracted using TRIzol™ reagent (Invitrogen-15596018) according to the manufacturer's instructions.
[0359] Synthesize cDNA using the PrimeScript™ RT kit and gDNA Eraser (Perfect RealTime) (TaKaRa-RR047A) according to the manual.
[0360] APP cDNA will be detected by qPCR. Actin cDNA will be detected simultaneously as an internal control. PCR will be performed at 95 °C for 30 seconds, then at 95 °C for 10 seconds, then at 50 °C for 30 seconds, for a total of 40 cycles.
[0361] Inhibition rate % = (Relative amount of control - Relative amount of sample) / Relative amount of control × 100%
[0362] Table 5 presents the results of in vitro studies on the inhibition of APP expression using various APP RNAi agents. The double-stranded sequences used correspond to those shown in Table 2.
[0363]
[0364]
[0365]
[0366] 3) Primers
[0367] APP primer #3: 5'-3'
[0368] Justice: TGACCATCCAGAACTGGTGC
[0369] Antonyms: ACGGTGTGCCAGTGAAGATG
[0370] GAPDH: 5'-3'
[0371] Justice: TCGTGGAAGGACTCATGACC
[0372] Antonyms: TCAGCTCAGGGATGACCTTG
[0373] BE(2)C cells will be reverse-transfected with oligonucleotides using Lipofectamine™ RNAiMax (Invitrogen -13778150) as described below. BE(2)C cells will be trypsinized and adjusted to an appropriate density, then seeded into 96-well plates at 1 × 10⁶ cells / well. 4 Cells / wells. Simultaneously with seeding, test siRNA was transfected into cells using Lipofectamine RNAiMax (0.3 μL / well). siRNA was tested at 10 nM and 1 nM. Wells transfected with scrambled siRNA served as negative controls.
[0374] 24 hours after transfection, the culture medium was removed, and the cells were harvested for RNA extraction. Total RNA was extracted according to the manual.
[0375] APP mRNA will be used as total RNA and detected by qPCR using the Hifair Advanced One Step RT-QpcrSYBR Green Kit (YEASEN, 11175ES70) according to the manual.
[0376] Inhibition rate % = (Relative amount of control - Relative amount of sample) / Relative amount of control × 100%
[0377] Table 6 presents the results of in vitro studies on the inhibition of APP expression using various APP RNAi agents. The double-stranded sequences used correspond to those shown in Table 2.
[0378]
[0379]
[0380]
[0381]
[0382] Example 6. In vivo assay of double-stranded APP siRNA
[0383] On day 1, female C57BL / 6J mice (n=3 per group) were infected intravenously with adeno-associated virus 8 (AAV8) vector solution encoding the human APP and luciferase genes. On day 8, mice were subcutaneously injected with a single dose of 1 mg / kg, 2 mg / kg, 3 mg / kg, or 10 mg / kg APP siRNA reagent or PBS. On day 15, liver tissue samples were collected, and APP mRNA levels were quantified using qPCR. The results are shown in Tables 7-13. All tested APP RNAi reagents showed APP inhibitory effects in APP-transduced mice.
[0384] Table 7 presents the results of in vivo studies using various APP RNAi agents to inhibit APP expression. The double-stranded sequences used correspond to those shown in Table 3.
[0385]
[0386]
[0387] Table 8 presents the results of in vivo studies using various APP RNAi agents to inhibit APP expression. The double-stranded sequences used correspond to those shown in Table 3.
[0388]
[0389] Table 9 presents the results of in vivo studies using various APP RNAi agents to inhibit APP expression. The double-stranded sequences used correspond to those shown in Table 3.
[0390]
[0391] Table 10 presents the results of in vivo studies using various APP RNAi agents to inhibit APP expression. The double-stranded sequences used correspond to those shown in Table 3.
[0392]
[0393]
[0394] Table 11 presents the results of in vivo studies using various APP RNAi agents to inhibit APP expression. The double-stranded sequences used correspond to those shown in Table 3.
[0395]
[0396]
[0397] Table 12 presents the results of in vivo studies using various APP RNAi agents to inhibit APP expression. The double-stranded sequences used correspond to those shown in Table 3.
[0398]
[0399] Table 13 presents the results of in vivo studies using various APP RNAi agents to inhibit APP expression. The double-stranded sequences used correspond to those shown in Table 3.
[0400]
[0401]
[0402]
[0403] equivalent
[0404] Although several embodiments of the invention have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing functions and / or obtaining results and / or one or more advantages described herein, and each of these variations and / or modifications is considered to be within the scope of the invention. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are intended as examples, and actual parameters, dimensions, materials, and / or configurations will depend on the specific application using the teachings of this invention. Those skilled in the art will recognize, or be able to determine, many equivalents of the specific embodiments of the invention described herein using only conventional experimentation. Therefore, it should be understood that the foregoing embodiments are presented by way of example only and within the scope of the appended claims and their equivalents; the invention may be practiced in ways different from the specific descriptions and claims. The invention is directed toward each individual feature, system, article, material, and / or method described herein. Furthermore, any combination of two or more such features, systems, articles, materials, and / or methods (provided that these features, systems, articles, materials, and / or methods do not contradict each other) is included within the scope of the invention.
[0405] All definitions used herein should be understood as controlling dictionary definitions, definitions in incorporated documents, and / or the general meaning of the defining terms. Except for numerical representations, plural and singular should be considered interchangeable.
[0406] The indefinite articles “a” and “an” used in this specification and claims, unless otherwise expressly stated, shall be understood as “at least one”.
[0407] The term “or” as used herein means “and / or” and is used interchangeably with the latter unless the context explicitly excludes it. The phrase “and / or” as used in the specification and claims should be understood to mean “any one or both” of the elements so combined, that is, elements that are connected in some cases and exist separately in others. If there are two or more elements separated by a comma, the comma preceding “and / or” has the same meaning as “and / or”, accordingly indicating “and” or “or”. In addition to the elements expressly identified in the “and / or” clause, other elements may optionally exist, whether related to or unrelated to the expressly identified elements, unless explicitly stated otherwise.
[0408] All references, patents and patent applications and publications cited or mentioned in this application are incorporated herein by reference in their entirety.
Claims
1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of amyloid precursor (APP), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 2 by no more than 3 nucleotides, wherein the sense strand and the antisense strand may be partially, substantially, or completely complementary.
2. The dsRNA agent of claim 1, wherein the antisense strand comprises a region complementary to the mRNA encoding APP, the region comprising at least 15 consecutive nucleotides differing from one of the antisense sequences listed in any one of Tables 1-3 by no more than 1, 2 or 3 nucleotides.
3. The dsRNA agent of claim 1, wherein the antisense strand comprises a region complementary to the mRNA encoding APP, the region comprising at least 15 consecutive nucleotides from any of the antisense sequences listed in any of Tables 1-3.
4. A double-stranded RNA (dsRNA) agent for inhibiting the expression of amyloid precursor (APP), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotide positions 2 to 18 of the antisense strand comprise a region complementary to the APP RNA transcript, wherein the complementary region comprises at least 15 consecutive nucleotides differing from one of the antisense sequences listed in one of Tables 1-3 by 0, 1, 2, or 3 nucleotides, and optionally comprises a targeting ligand.
5. The dsRNA agent according to claim 4, wherein the region complementary to the APP RNA transcript comprises at least 15, 16, 17, 18 or 19 consecutive nucleotides differing by no more than 3 nucleotides from one of the antisense sequences listed in any one of Tables 1-3.
6. The dsRNA agent according to any one of claims 1-5, wherein the antisense strand of the dsRNA is substantially or completely complementary to any target region of SEQ ID NO: 1, and preferably the dsRNA agent comprises any one of the antisense strand sequences described in Tables 1-3.
7. The dsRNA agent according to any one of claims 1-6, wherein the sense strand sequence is at least substantially complementary to or completely complementary to the antisense strand sequence in the dsRNA agent, preferably, wherein the dsRNA agent comprises any one of the sense strand sequences in Tables 1-3.
8. The dsRNA agent according to any one of claims 1-7, wherein the dsRNA agent comprises a sequence listed as a double-stranded sequence in any one of Tables 1-3.
9. The dsRNA agent according to any one of claims 1-8, wherein the dsRNA agent comprises at least one modified nucleotide.
10. The dsRNA agent according to any one of claims 1-9, wherein all or substantially all nucleotides of the sense strand and / or antisense strand are modified nucleotides.
11. A double-stranded RNA (dsRNA) agent for inhibiting the expression of amyloid precursor (APP), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region partially complementary to mRNA encoding APP, wherein each strand is about 15 to about 30 nucleotides in length, wherein the sense strand sequence can be represented by formula (I): in: Each N' F This refers to nucleotides modified with 2'-fluorine. Each N' N1 、N' N2 、N' N3 、N' N4 、N' N5 and N' N6 Independently representing modified or unmodified nucleotides; Each N' L Independently represents a modified or unmodified nucleotide, but not a nucleotide with 2'-fluorine modification; Furthermore, m' and n' are each an independent integer from 0 to 7.
12. A double-stranded RNA (dsRNA) agent for inhibiting the expression of amyloid precursor (APP), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region partially complementary to mRNA encoding APP, wherein each strand is about 18 to about 30 nucleotides in length, wherein the antisense strand sequence can be represented by formula (II): in: Each N F This represents a 2'-fluorinated nucleotide; Each N M1 N M2 N M3 N M4 N M5 N M6 N M7 and N M8 Independently representing modified or unmodified nucleotides; Each N L Independently represents a modified or unmodified nucleotide, but not a nucleotide with 2'-fluorine modification; And n is an integer from 0 to 7.
13. A double-stranded RNA (dsRNA) agent for inhibiting the expression of amyloid precursor (APP), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand and the antisense strand are complementary, wherein the antisense strand contains a region complementary to mRNA encoding APP, wherein the complementary region contains at least 15 consecutive nucleotides, wherein the dsRNA duplex is represented by formula (III): in: Each strand is independently about 17 to about 30 nucleotides in length; Each N F and N' F Independently representing nucleotides modified with 2'-fluorine; Each N M1 N M2 N M3 N M4 N M5 N M6 N M7 N M8 、N' N1 、N' N2 、N' N3 、N' N4 、N' N5 and N' N6 Each nucleotide can be independently represented as either modified or unmodified. Each N L and N' L Independently represents a modified or unmodified nucleotide, but not a nucleotide with 2'-fluorine modification; Furthermore, m', n', and n are each an independent integer from 0 to 7.
14. The dsRNA agent according to any one of claims 9-13, wherein the one or more modified nucleotides are independently selected from the group consisting of: 2'-O-methyl nucleotides, 2'-fluoronucleotides, 2'-deoxynucleotides, 2'3'-seco nucleotide mimics, locked nucleotides, unlocked nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abase-free nucleotides, ribitol, reverse nucleotides, reverse abase-free nucleotides, isomannitol nucleotides, reverse 2'-OMe nucleotides, reverse 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholinonucleotides, 3'-OMe nucleotides, nucleotides containing a 5'-thiophosphate group, nucleotides modified with 5'-phosphate or 5'-phosphate mimics, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bis(decylamide) groups, 2'-amino-modified nucleotides, phosphamide esters, or nucleotides containing non-natural bases.
15. The dsRNA agent according to any one of claims 1 to 14, comprising an E-vinylphosphonate nucleotide located at the 5' end of the guide strand.
16. The dsRNA agent according to any one of claims 1-15, wherein the dsRNA agent comprises at least one phosphate thionucleotide internucleotide bond.
17. The dsRNA agent according to any one of claims 1 to 15, wherein the sense strand comprises at least one phosphate thionucleotide internucleotide bond.
18. The dsRNA agent according to any one of claims 1 to 15, wherein the antisense strand comprises at least one phosphate thionucleotide internucleotide bond.
19. The dsRNA agent according to any one of claims 1 to 15, wherein the sense strand comprises 1, 2, 3, 4, 5 or 6 phosphate thioester nucleoside bonds.
20. The dsRNA agent according to any one of claims 1-15, wherein the antisense strand comprises 1, 2, 3, 4, 5 or 6 phosphate thioester nucleoside bonds.
21. The dsRNA agent according to any one of claims 1-20, wherein the modified sense strand is a modified sense strand sequence shown in any one of Tables 2-3.
22. The dsRNA agent according to any one of claims 1-20, wherein the modified antisense strand is a modified antisense strand sequence shown in one of Tables 2-3.
23. The dsRNA agent according to any one of claims 1-22, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the length of the complementary region is between 16 and 23 nucleotides.
24. The dsRNA agent according to any one of claims 1 to 23, wherein the length of the complementary region is 19 to 21 nucleotides.
25. The dsRNA agent according to any one of claims 1 to 24, wherein the length of each strand does not exceed 30 nucleotides.
26. The dsRNA agent according to any one of claims 1 to 24, wherein the length of each strand does not exceed 25 nucleotides.
27. The dsRNA agent according to any one of claims 1 to 24, wherein the length of each strand does not exceed 23 nucleotides.
28. The dsRNA agent according to any one of claims 1-27, wherein the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.
29. The dsRNA agent of claim 28, wherein one or more targeting groups or linking groups are conjugated to a sense strand.
30. The dsRNA agent according to claim 28 or 29, wherein the targeting group or linking group comprises N-acetylgalactosamine (GalNAc).
31. The dsRNA agent according to claim 28 or 29, wherein the targeting group has the following structure: 。 32. The dsRNA agent according to any one of claims 1-31, wherein the dsRNA agent comprises a targeting group conjugated to the 5' end of the sense strand.
33. The dsRNA agent according to any one of claims 1-31, wherein the dsRNA agent comprises a targeting group conjugated to the 3' end of the sense strand.
34. The dsRNA agent according to any one of claims 1 to 31, wherein the antisense strand comprises a reverse abase-free residue at its 3' end.
35. The dsRNA agent according to any one of claims 1-31, wherein the sense strand comprises one or two reverse abase-free residues or imann residues at the 3' and / or 5' ends.
36. The dsRNA agent according to any one of claims 1-35, wherein the dsRNA agent has two blunt ends.
37. The dsRNA agent according to any one of claims 1 to 35, wherein at least one strand comprises a 3' overhang of at least one nucleotide.
38. The dsRNA agent according to any one of claims 1 to 35, wherein at least one strand comprises a 3' overhang of at least two nucleotides.
39. A composition comprising the dsRNA agent according to any one of claims 1-38.
40. The composition of claim 39, further comprising a pharmaceutically acceptable carrier.
41. The composition of claim 40, further comprising one or more additional therapeutic agents.
42. The composition of claim 41, wherein the composition is packaged in a kit, container, bag, dispenser, prefilled syringe, or vial.
43. The composition according to any one of claims 39-42, wherein the composition is formulated for subcutaneous administration, for intrathecal administration, or for intravenous (IV) administration.
44. A cell comprising the dsRNA agent of any one of claims 1-38, optionally, said cell being a mammalian cell, optionally a human cell.
45. A method for inhibiting APP gene expression in cells, the method comprising: (i) Preparing cells containing an effective amount of the double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-38 or the composition of any one of claims 39-43.
46. The method of claim 45, further comprising: (ii) Maintain the cells prepared according to claim 45(i) for a sufficient time to allow for the degradation of the APP gene mRNA transcript, thereby inhibiting the expression of the APP gene in the cells.
47. The method according to any one of claims 45-46, wherein the cells are located in the subject and the dsRNA agent is administered subcutaneously to the subject.
48. The method according to any one of claims 45-46, wherein the cells are located in the subject and the dsRNA agent is administered to the subject intrathecally.
49. The method according to any one of claims 45-46, wherein the cells are located in the subject and the dsRNA agent is administered to the subject via intravenous administration.
50. The method according to any one of claims 47-49, further comprising evaluating inhibition of the APP gene after administration of the dsRNA agent to a subject, wherein the evaluation method comprises: (i) Identify one or more physiological characteristics of the subject’s APP-related disease or condition, and (ii) Compare the identified physiological characteristics with baseline pre-treatment physiological characteristics of APP-related diseases or conditions and / or control physiological characteristics of APP-related diseases or conditions. The comparison indicated the presence or absence of one or more of the inhibition of APP gene expression in the subjects.
51. The method according to claim 50, wherein, The identified physiological characteristics are one or more of the following: the subject's APP mRNA level, APP protein level, APPα, APPβ, Aβ, Aβ40 and / or Aβ42, α-CTF, β-CTF, MAPT peptide and / or various forms of APP cleavage products.
52. The method of claim 51, wherein a decrease in one or more of the subject's APP mRNA level, APP protein level, APPα, APPβ, Aβ, Aβ40 and / or Aβ42, α-CTF, β-CTF, MAPT peptide and / or various forms of APP cleavage products indicates a decrease in the subject's APP gene expression.
53. A method for inhibiting APP gene expression in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-38 or a composition according to any one of claims 39-43.
54. The method of claim 53, wherein the dsRNA agent is administered subcutaneously to the subject.
55. The method of claim 53, wherein the dsRNA agent is administered to the subject via intrathecal administration.
56. The method of claim 53, wherein the dsRNA agent is administered to the subject via IV.
57. The method according to any one of claims 54-56, further comprising evaluating the inhibition of the APP gene after administration of the dsRNA agent, wherein the evaluation method comprises: (i) Identify one or more physiological characteristics of the subject’s APP-related disease or condition, and (ii) Compare the identified physiological characteristics with baseline pre-treatment physiological characteristics of APP-related diseases or conditions and / or control physiological characteristics of APP-related diseases or conditions. The comparison indicates the presence or absence of one or more of the inhibition of APP gene expression in the subjects.
58. The method according to claim 57, wherein, The identified physiological characteristics are one or more of the following: APP mRNA level, APP protein level, APPα, APPβ, Aβ, Aβ40 and / or Aβ42, α-CTF, β-CTF, MAPT peptide and / or various forms of APP cleavage products.
59. The method of claim 58, wherein a decrease in one or more of the subject's APP mRNA level, APP protein level, APPα, APPβ, Aβ, Aβ40 and / or Aβ42, α-CTF, β-CTF, MAPT peptide and / or various forms of APP cleavage products indicates a decrease in the subject's APP gene expression.
60. A method for treating a disease or condition associated with the presence of the APP protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-38 or a composition of any one of claims 39-43 to inhibit APP gene expression.
61. The method of claim 60, wherein the disease or condition is one or more of the following: cerebral amyloid angiopathy (CAA), Down syndrome (DS), and Alzheimer's disease (AD), including hereditary CAA, early-onset familial Alzheimer's disease (EOFAD or eFAD), late-onset AD (LOAD), and amyotrophic lateral sclerosis (ALS), frontotemporal dementia, Huntington's disease, Parkinson's disease, spinocerebellum, prions, Lafra disease, stroke, or other neurodegenerative diseases or abnormalities related to APP.
62. The method of claim 61, further comprising administering an additional treatment to the subject.
63. The method of claim 62, wherein the additional treatment option comprises: The subject was given one or more APP antisense polynucleotides of the present invention, given a non-APP dsRNA therapeutic agent, and subjected to behavioral modifications.
64. The method of claim 63, wherein the non-APP dsRNA therapeutic agent is one or more of the following: cholinesterase inhibitors (e.g., donepezil, levamisole esters, and galantamine), memantine, BACE1i, immunotherapy, secretase inhibitors (e.g., gamma secretase inhibitors), acetylcholinesterase inhibitors, NMDA receptor antagonists, antibodies against abeta (e.g., aducanumab), agents against tau protein, anti-synuclein antibodies, fumarate compounds, anti-inflammatory agents, anti-fatty degeneration agents, antiviral agents, and / or antifibrotic agents; or any combination thereof.
65. The method according to any one of claims 60-64, wherein the dsRNA agent is administered subcutaneously to the subject.
66. The method according to any one of claims 60-64, wherein the dsRNA agent is administered to the subject via intrathecal administration.
67. The method according to any one of claims 60-64, wherein the dsRNA agent is administered to the subject via IV.
68. The method according to any one of claims 60-64, further comprising determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in the subject.
69. The method of claim 68, wherein the method of determining the efficacy of the treatment in a subject comprises: (i) Identify one or more physiological characteristics of the subject’s APP-related disease or condition, and (ii) Compare the identified physiological characteristics with the baseline of pre-treatment physiological characteristics for APP-related diseases or conditions; The comparisons indicate the presence, absence, and level of efficacy of double-stranded RNA (dsRNA) agents administered to subjects.
70. The method of claim 69, wherein the identified physiological characteristics are: APP mRNA level, APP protein level, APPα, APPβ, Aβ, Aβ40 and / or Aβ42, α-CTF, β-CTF, MAPT peptide and / or various forms of APP cleavage products.
71. The method of claim 69, wherein a decrease in one or more of the following: APP mRNA level, APP protein level, APPα, APPβ, Aβ, Aβ40 and / or Aβ42, α-CTF, β-CTF, MAPT peptide and / or various forms of APP cleavage products indicates efficacy of administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject.
72. A method for reducing the level of APP protein in a subject compared to a baseline pre-treatment level, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-38 or a composition of any one of claims 39-43 to reduce APP gene expression levels.
73. The method of claim 72, wherein the dsRNA agent is administered to the subject subcutaneously, intrathecally, or via IV.
74. A method for altering the physiological characteristics of an APP-related disease or condition in a subject, compared to a baseline of pre-treatment physiological characteristics of the subject's APP-related disease or condition, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) reagent of any one of claims 1-38 or a composition of any one of claims 39-43 to alter the physiological characteristics of the subject's APP-related disease or condition.
75. The method of claim 74, wherein the dsRNA agent is administered to the subject subcutaneously, intrathecally, or via IV.
76. The method according to any one of claims 74-75, wherein the physiological characteristic is one or more of the following: APP mRNA level, APP protein level, APPα, APPβ, Aβ, Aβ40 and / or Aβ42, α-CTF, β-CTF, MAPT peptide and / or various forms of APP cleavage products.
Citation Information
Patent Citations
Drug delivery product and methods
US20050281781A1
Drug-delivery system
US3854480A
Seal-lock
US426220A
Cholesterol matrix delivery system for sustained release of macromolecules
US4452775A
Microencapsulation of water soluble active polypeptides
US4675189A