Midkine-overexpressed mesenchymal stem cell, extracellular vesicle and application of Midkine-overexpressed mesenchymal stem cell and extracellular vesicle

By overexpressing Midkine in mesenchymal stem cells and extracellular vesicles, the problems of limited mesenchymal stem cell function and short Midkine half-life were solved, achieving localized and sustained high-concentration release of Midkine, which promoted tissue regeneration and repair, especially showing significant effects in the repair of cartilage and skin wounds.

CN122012402APending Publication Date: 2026-05-12AFFILIATED HUSN HOSPITAL OF FUDAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610215251.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-14
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

The function of existing mesenchymal stem cells is affected by the donor source, age, and post-transplantation microenvironment. Furthermore, Midkine has a short half-life in vivo, making it difficult to maintain an effective concentration when administered locally, which limits its application in tissue repair.

Method used

By integrating mesenchymal stem cells that overexpress Midkine gene elements, and utilizing their long-term survival and tissue chemotaxis capabilities, a sustained high concentration of Midkine can be released locally. Combined with the application of extracellular vesicles, the synergistic effect of mesenchymal stem cells and Midkine can be achieved.

Benefits of technology

It achieves localized, sustained high-concentration release of Midkine, enhancing tissue regeneration and repair effects, especially showing great potential in cartilage regeneration and skin wound repair. The extracellular vesicles contain recombinant Midkine protein or mRNA, further promoting tissue repair.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012402A_ABST
    Figure CN122012402A_ABST
Patent Text Reader

Abstract

The invention provides a Midkine-overexpressed mesenchymal stem cell, an extracellular vesicle and application of the Midkine-overexpressed mesenchymal stem cell and the extracellular vesicle. The mesenchymal stem cell is integrated with a gene element for overexpressing Midkine, the long-term survival and tissue chemotaxis ability of the mesenchymal stem cell are utilized to realize local continuous overexpression of Midkine recombinant protein, the engineered mesenchymal stem cell integrates the advantages of the Midkine recombinant protein and the mesenchymal stem cell, the synergistic effect of the Midkine recombinant protein and the mesenchymal stem cell is exerted, and the engineering mesenchymal stem cell has the advantages of promoting tissue regeneration and repair, promoting tissue regeneration and repairing and improving tissue regeneration and repair efficiency. Particularly, the method has huge potential in the aspects of cartilage tissue regeneration and skin wound repair; besides, the extracellular vesicles secreted by the Midkine-overexpressed mesenchymal stem cells contain Midkine recombinant protein or mRNA (messenger Ribonucleic Acid), and are also used for promoting cartilage injury repair.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a mesenchymal stem cell overexpressing Midkine, extracellular vesicles, and their applications. Background Technology

[0002] Mesenchymal stem cells (MSCs) are widely recognized for their potent immunomodulatory activity, stimulating the repair and regeneration of diseased or damaged tissues. Their main mechanisms include: secreting various trophic factors (such as VEGF, PDGF, and FGF) to promote angiogenesis and cell proliferation; secreting various immunomodulatory factors (such as PGE2, IDO, and TGF-β) to inhibit excessive inflammation, regulate immunity, and produce anti-apoptotic factors to protect damaged cells; and secreting chemokines to recruit endogenous stem cells for repair. Therefore, MSCs have shown potential in wound healing (diabetic foot ulcers, pressure sores, and large-area burns), promoting bone and cartilage repair, cardiovascular repair and angiogenesis, and nerve tissue repair. However, due to limitations imposed by their source (bone marrow, adipose tissue, or umbilical cord), donor age, and culture methods, and because their function is affected by the damaged microenvironment after transplantation, the application of MSCs remains limited. Current research is focused on overcoming these limitations and enhancing their therapeutic effects through strategies such as genetic engineering (e.g., overexpression of functional factors), pretreatment (hypoxia or drug pretreatment), or integration with novel biomaterials.

[0003] Mesenchymal stem cells (MSCs) exert their immunomodulatory and tissue repair functions through their secreted extracellular vesicles (EVs). EVs are a group of cell-derived structures composed of a lipid bilayer membrane, containing biologically active proteins, lipids, and RNA, and playing a crucial role in intercellular communication. Based on their biological origin, EVs are generally divided into subgroups, such as exosomes (40-150 nm in diameter), microvesicles (150-1000 nm in diameter), and apoptotic bodies (50-2000 nm in diameter). Recent studies have shown that EVs can replace MSCs in performing a range of biological functions, making them a viable alternative to cell therapy in certain applications.

[0004] Midkine (MK) is a heparin-binding growth factor with multiple functions, promoting cell proliferation, migration, survival, and tissue repair. Midkine plays a crucial role in embryonic development, tissue repair, and tumorigenesis, particularly in cartilage regeneration. It stimulates chondrocyte proliferation and matrix synthesis, promoting the repair of cartilage defects, thus showing great promise in the treatment of osteoarthritis and cartilage damage. Furthermore, midkine accelerates wound healing through multiple mechanisms, including promoting the proliferation and migration of key repair cells, stimulating angiogenesis, regulating inflammation, and preventing cell death, demonstrating significant potential in the treatment of refractory chronic wounds. However, midkine's short half-life in vivo and the difficulty in maintaining effective concentrations with local administration limit its clinical application. Therefore, developing a sustained-release midkine delivery system is of significant clinical importance. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides mesenchymal stem cells overexpressing Midkine, extracellular vesicles, and their applications.

[0006] This invention provides mesenchymal stem cells overexpressing Midkine, extracellular vesicles, and their applications using the following technical solution: In a first aspect, the present invention provides a mesenchymal stem cell overexpressing Midkine, wherein the mesenchymal stem cell integrates gene elements overexpressing Midkine, and utilizes the long-term survival and tissue chemotaxis of the mesenchymal stem cell to achieve localized and sustained high-concentration release of Midkine, thereby exerting the synergistic effect of the mesenchymal stem cell and Midkine.

[0007] A second aspect of the present invention provides a method for preparing mesenchymal stem cells overexpressing Midkine as described above, characterized by comprising the following steps: Step 1): Insert the coding sequence of Midkine as shown in SEQ ID NO.1 and the coding sequence of T2A polypeptide as shown in SEQ ID NO.2 before the EGFP sequence of the pRRLSIN plasmid to obtain the overexpressing Midkine lentiviral vector pRRLSIN-MK as shown in SEQ ID NO.3; Step 2): The lentiviral expression vector pRRLSIN-MK overexpressing Midkine was co-transfected with packaging plasmids pMD2.G and psPAX2 into 293T cells to prepare lentiviral particles overexpressing Midkine. Step 3): Transfect mesenchymal stem cells with a lentivirus that overexpresses Midkine.

[0008] Preferably, in step 3), the mesenchymal stem cells are human umbilical cord mesenchymal stem cells.

[0009] In a third aspect, the present invention provides an application of the above-mentioned mesenchymal stem cells overexpressing Midkine for promoting tissue regeneration and repair.

[0010] Preferably, the tissue regeneration and repair includes cartilage regeneration and skin wound repair.

[0011] In a fourth aspect, the present invention provides an extracellular vesicle secreted by mesenchymal stem cells that overexpress Midkine as described above.

[0012] In a fifth aspect, the present invention provides an application of the above-described extracellular vesicles to promote cartilage injury repair.

[0013] Furthermore, the mesenchymal stem cells and extracellular vesicles overexpressing Midkine described in this invention are applied to tissue damage regeneration and repair, and are not limited to the treatment of cartilage damage, but also include bone damage, cardiovascular disease, acute respiratory distress syndrome (ARDS), bronchial asthma, chronic obstructive pulmonary disease (COPD), lung failure, pulmonary fibrosis, cirrhosis, liver fibrosis, surgical liver injury, kidney failure, nephritis, burns, wounds, tissue defects, cerebral infarction, myocardial infarction, etc.

[0014] Compared with the prior art, the present invention has the following beneficial effects: This invention provides mesenchymal stem cells overexpressing Midkine, extracellular vesicles, and their applications. The mesenchymal stem cells integrate gene elements overexpressing Midkine, leveraging the long-term survival and tissue chemotaxis capabilities of these cells to achieve localized and continuous overexpression of recombinant Midkine protein. This engineered mesenchymal stem cell combines the advantages of both recombinant Midkine protein and mesenchymal stem cells, exerting a synergistic effect and demonstrating great potential in promoting tissue regeneration and repair, particularly cartilage regeneration and skin wound repair. Furthermore, the extracellular vesicles secreted by the Midkine-overexpressing mesenchymal stem cells, containing recombinant Midkine protein or mRNA, also contribute to promoting cartilage injury repair. Attached Figure Description

[0015] Figure 1 The staining of the surface of human umbilical cord mesenchymal stem cells (HUC-MSCs) in Example 2 of this invention with mixed antibodies against CD34, CD19, CD45 and HLADR was negative. Figure 2In Example 2 of this invention, the positive rates of antibody staining for CD44, CD73, CD90, and CD105 on the surface of human umbilical cord mesenchymal stem cells were all higher than 95%. Figure 3 The efficiency of lentivirus infection of human umbilical cord mesenchymal stem cells in Example 2 of the present invention: A) and B) are white light and green fluorescence photos of HUC-MSCs infected with Midkine lentivirus, respectively; C) and D) are white light and green fluorescence photos of HUC-MSCs infected with EGFP control virus. Figure 4 The Midkine mRNA level after HUC-MSCs were infected with Midkine or EGFP control lentivirus in Example 2 of this invention; Figure 5 The histological staining results (Safranin O-Fixed Green staining) of mesenchymal stem cells overexpressing Midkine promoting cartilage defect repair in Example 3 of this invention. Figure 6 Microscopic observation of extracellular vesicles secreted by mesenchymal stem cells overexpressing Midkine injected into the joint cavity to promote cartilage repair in Example 4 of the present invention; Figure 7 This is a statistical analysis of the wound area resulting from intravenous injection of mesenchymal stem cells overexpressing Midkine to promote skin damage repair in Example 5 of this invention. Detailed Implementation

[0016] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. The embodiments are only used to explain the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0017] This invention provides mesenchymal stem cells overexpressing Midkine, extracellular vesicles, and their applications. The mesenchymal stem cells integrate gene elements overexpressing Midkine, leveraging the long-term survival and tissue chemotaxis capabilities of these cells to achieve localized and continuous overexpression of recombinant Midkine protein. This engineered mesenchymal stem cell combines the advantages of both recombinant Midkine protein and mesenchymal stem cells, exerting a synergistic effect and demonstrating great potential in promoting tissue regeneration and repair, particularly cartilage regeneration and skin wound repair. Furthermore, the extracellular vesicles secreted by the Midkine-overexpressing mesenchymal stem cells, containing recombinant Midkine protein or mRNA, also contribute to promoting cartilage injury repair.

[0018] Example 1: Construction and identification of lentiviral particles overexpressing Midkine 1. Obtaining the target plasmid and transforming competent cells The lentiviral vector pRRLSIN-MK was constructed using the pRRLSIN, pMD2.G, and psPAX2 three-plasmid system as the target gene expression vector. The coding sequence of human Midkine (SEQ ID NO.1) and the coding sequence of T2A (SEQ ID NO.2) were inserted before the EGFP sequence of the original pRRLSIN plasmid. The final recombinant plasmid pRRLSIN-MK sequence is shown in SEQ ID NO.3. Midkine coding sequence (SEQ ID NO.1): atgcagcaccgaggcttcctcctcctcaccctcctcgcc ctgctggcgctcacctccgcg gtcgccaaaaaagaaagataaggtgaagaagggcggcccggggagcgagtgcgctgagtgggcctgggggccctgcacccccagcagcaaggattg cggcgtgggtttccgcgagggcacctgcggggcccagacccagcgcatccggtgcagggtgccctgcaactggaagaaggagtttggagccgact gcaagtacaagtttgagaactggggtgcgtgtgatgggggcacaggcaccaaagtccgccaaggcaccctgaagaaggcgcgctacaatgctcag tgccaggagaccatccgcgtcaccaagccctgcacccccaagaccaaagcaaaggccaaagccaagaaagggaagggaaaggac (the underlined sequence is the signal peptide); T2A polypeptide coding sequence (SEQ ID NO.2): ggaagcggagccacgaacttctctctgttaaagcaagcaggagatgttgaagaaaaccccgggcct; Recombinant plasmid pRRLSIN-MK was added to pre-chilled E. coli competent cells and incubated on ice for 30 min, followed by heat shock at 42°C for 60 sec, and then incubated on ice again for 2 min. 600 μL of LB liquid medium (antibiotic-free) was added, and the cells were incubated at 37°C with shaking at 200 rpm for 60 min. 100 μL of the bacterial culture was then spread onto Amp-resistant plates and incubated upside down in an incubator for 12–16 h. Single colonies from the resistant plates were picked and inoculated into LB liquid medium containing 100 μg / mL Amp and incubated overnight at 37°C with shaking at 200 rpm. The plasmid was then extracted using an endotoxin-free plasmid extraction kit.

[0019] 2. Packaging and titer determination of lentiviral particles Lentiviral packaging was performed using a three-plasmid system. The pRRLSIN-MK recombinant plasmid extracted using an endotoxin-free plasmid extraction kit was co-transfected with two packaging plasmids (pMD2.G and psPAX2) into 293T cells using Lipo3000 transfection reagent. Forty-eight hours after transfection, the cell supernatant was collected, and 1 / 4 volume of concentrated virus solution was added. After mixing, the mixture was incubated overnight at 4°C, centrifuged at 4000g for 25 min, and the white precipitate was collected as the concentrated virus. The virus was resuspended in PBS, aliquoted, and stored at -80°C. The empty plasmid pRRLSIN (expressing EGFP) without the recombinant target gene Midkine was also packaged and produced as a control virus. HEK293T cells were infected with packaged lentivirus, and the viral titers of both Midkine and EGFP control viruses reached 10^8 IU / mL.

[0020] Example 2: Transfection of umbilical cord mesenchymal stem cells with lentivirus overexpressing Midkine 1. Isolation, culture and identification of human umbilical cord mesenchymal stem cells After collecting umbilical cord blood (UCB) from healthy delivered infants, 10-50 cm sections of umbilical cord (UC) were aseptically transferred to a sterile container containing 0.9% sterile sodium chloride solution, repeated multiple times. The UC was then cut into 5 mm thick sections using a scalpel. The tissue sections were enzymatically digested by incubating with collagenase and hyaluronidase at 37°C for 2 hours, centrifuged at 300 g for 5 minutes, and the precipitate was washed with 1×PBS. Samples were then stained with PI and flow cytometry was used to count viable cells. For standard in vitro expansion, cells were sputtered at 6000 cells / cm³. 2The cells were seeded at a density of 100% into cell culture dishes and cultured in complete medium (containing α-MEM, 2 mM L-Glutamax, and 10% FBS). The medium was changed 2 to 3 times per week, and the cells were passaged or collected when they reached 80-90% confluence. The old medium was discarded, and 2 mL of 0.25% trypsin digestion solution was added. After the cells became round and floated, 4 mL of culture medium was added to stop the digestion. The cells were then transferred to sterile centrifuge tubes and centrifuged at 500g for 3 min. The supernatant was discarded, and the cells were transferred to new sterile culture flasks at a ratio of 1:4-6. Cells from passages 3 to 7 were used for experiments.

[0021] Human umbilical cord mesenchymal stem cells (HUC-MSCs) were identified using Miltenyi's MSC typing kit (catalog number 130-125-285). The old culture medium in the culture flask was discarded, and the cells were washed with PBS, digested with trypsin, and collected. The cell pellet was washed three times with PBS, resuspended in FACS buffer (PBS containing 1% FBS), and the cell density was adjusted to 3 × 10⁻⁶ cells / mL. 6 cells / mL; aspirate 100 μL of cell suspension into a 1.5 mL tube, add antibody cocktail according to the kit steps, mix gently, and incubate at 4 °C for 30 min; wash cells with 1 mL of FACS buffer, centrifuge at 500 g for 3 min, and discard the supernatant; resuspend cells in 400 μL of FACS buffer, and detect surface molecules of human umbilical cord blood mesenchymal stem cells by flow cytometry.

[0022] The results of the identification are as follows Figure 1 , Figure 2 As shown, human umbilical cord mesenchymal stem cells express CD34, CD19, CD45 and HLADR at low levels, with an expression rate of ≤2%; and express CD44, CD73, CD90 and CD105 at high levels, with an expression rate of ≥95%.

[0023] 2. Lentiviral infection of HUC-MSCs Human umbilical cord mesenchymal stem cells (HUC-MSCs) were administered at a dose of 1×10⁻⁶ cells / day before transfection. 5 Cells / well were seeded into 6-well plates and cultured overnight at 37°C in a 5% CO2 incubator. Polybrene was used to enhance transfection efficiency. The transfection conditions for HUC-MSCs were optimized, and an MOI of 50 was determined to be the optimal transfection ratio. HUC-MSCs from generations 3-7 were transfected with Midkine and EGFP control viruses, respectively. EGFP expression was observed after 48 hours. Figure 3 As shown, HUC-MSCs infected with both Midkine and EGFP control viruses exhibited green fluorescence of EGFR under a fluorescence microscope, indicating that the genes of both viruses were expressed and the infection efficiency reached approximately 80%.

[0024] 3. qPCR detection of midkine expression level After culturing the lentivirus-infected cells for 48 hours, the culture medium in the wells was discarded, the cells were collected, and total RNA was extracted. Using the reverse transcription product of the total RNA as a template, quantitative real-time analysis of the Midkine gene was performed on virus-infected HUC-MSCs using a fluorescence quantitative method. HUC-MSCs transfected with EGFP control virus were used as controls. The primers for Midkine and the internal control GAPDH are as follows: Midkine forward primer (SEQ ID NO.4): 5'-CGCATCCGGTGCAGGTG-3'; Midkine reverse primer (SEQ ID NO.5): 5'-TCCTGGCACTGAGCATTGTAGC-3'; GAPDH forward primer (SEQ ID NO.6): 5'-GAAGGTGAAGGTCGGAGTC-3'; GAPDH reverse primer (SEQ ID NO.7): 5'-GAAGATGGGTGATGGGATTTC-3'.

[0025] Reaction system: 0.3 μL of 10 μM PCR forward primer, 0.3 μL of 10 μM PCR reverse primer, 2 μL of cDNA, 7.5 μL of 2×SYBR Green qPCR Mix (containing ROX), and ddH2O added to a final volume of 15.0 μL.

[0026] Amplification conditions were set as follows: pre-denaturation at 95℃ for 2 min; 40 cycles of 95℃ for 10 s, 55℃ for 10 s, and 72℃ for 15 s; after each cycle, the temperature was increased to 95℃. Each sample was repeated three times. The relative expression levels were statistically analyzed using the One-Way Anova method in GraphPad Prism 10 statistical software.

[0027] like Figure 4 As shown, compared with the control group, overexpression of Midkine lentivirus can significantly upregulate the level of Midkine mRNA in HUC-MSCs after infection.

[0028] Example 3: Mesenchymal stem cells overexpressing Midkine promote cartilage regeneration 1. Human umbilical cord mesenchymal stem cell culture and gene editing (1) Using the operation method of Example 2, umbilical cord mesenchymal stem cells (HUC-MSCs) were cultured from the umbilical cords of healthy infants and expanded to the 3rd-5th generation and then cryopreserved in liquid nitrogen for later use. (2) Using the operation method of Example 2, HUC-MSCs were infected with Midkine or EGFP control lentivirus to obtain gene-edited HUC-MSCs.

[0029] 2. Modeling of knee cartilage injury in rats and transplantation of mesenchymal stem cells (1) Select SPF-grade male SD rats that meet the experimental requirements as transplant recipients, and set up an experimental group of HUC-MSCs (MK-MSCs) overexpressing Midkine virus, a PBS control group, and an EGFP control virus-infected HUC-MSCs (EGFP-MSCs) control group, with n=8 in each group; (2) Prepare 1% sodium pentobarbital. Weigh 0.4g of sodium pentobarbital, add 40mL of sterile physiological saline, dissolve and filter with a 0.22μm sterile filter; inject 0.8mL of 1% sodium pentobarbital into each rat (the rat injection dose is 40mg / kg), place the anesthetized rat on a constant temperature heating pad to keep it at body temperature; (3) Use a shaver to remove the hair near the knee joint, use a scalpel to open the skin along the inside of the knee joint, and cut the muscle tissue along the patellar ligament; first straighten the rat's leg, then move the patella to the outside of the knee joint to expose the joint cavity; use a 1mm ball drill to wear down the protrusions on both sides of the femoral groove of the rat to damage the cartilage layer; then rinse with physiological saline, wipe with povidone-iodine, straighten the rat's leg, reposition the patella, and suture the wound; for three days after the operation, administer gentamicin sulfate intramuscularly continuously; (4) Four days after modeling, the rats were divided into groups and injected intra-articularly: PBS group (50 μL), EGFP-MSCs group (3 × 10⁻⁶ μL), and EGFP-MSCs group (3 × 10⁻⁶ μL). 6 cells / 50μL), MK-MSCs group (3×10 6 (cells / 50μL).

[0030] Assess cartilage repair at week 4 after drug administration, such as... Figure 5 As shown, the cartilage defect area was still obvious in the PBS group, and the EGFP-MSCs group showed some cartilage-like tissue formation, but the chondrocytes were arranged in a disordered manner; the cartilage defect in the MK-MSCs group was basically repaired, the cartilage layer was thick, and the chondrocytes were arranged in an orderly manner. The results indicate that overexpression of Midkine significantly enhanced the ability of HUC-MSCs to promote cartilage regeneration.

[0031] Example 4: Extracellular vesicles secreted by mesenchymal stem cells overexpressing Midkine promote cartilage damage repair 1. Vesicle extraction HUC-MSCs were isolated, cultured, and infected using the method described in Example 3 to obtain HUC-MSCs overexpressing Midkine or EGFP control lentiviruses. After thawing frozen 3rd-4th generation MK-MSCs and control EGFP-MSCs, they were cultured in tissue culture dishes at approximately 200-500 cells per square centimeter. Fresh complete culture medium was replaced every 2-3 days. After the cells reached approximately 70% confluence within 4-6 days, the medium was replaced with serum-free, exosome-limited medium (CD-CHO Medium, Invitrogen) and cultured for another 48 hours. The supernatant was collected, and the cells were removed by centrifugation at 300g for 10 min. Cell debris was removed by centrifugation at 2000g for 15 min, and the supernatant was collected. Microbubbles and other impurities were removed by centrifugation at 10000g for 30 min, and the supernatant was collected again. The pellet was collected by centrifugation at 100000g for 70 min, and the pellet was resuspended in PBS to obtain exosomes MK-Exo containing MK-MSCs and control EGFP-Exo. These were aliquoted and frozen at -80℃ for later use. Simultaneously, samples were taken for Western blot analysis to detect the expression levels of CD63, CD81, and Midkine.

[0032] 2. Modeling of cartilage damage in rat knee joints The rat knee joint cartilage injury model was established using the method described in Example 3.

[0033] 3. Vesicle transplantation Four weeks after modeling, rats were divided into two groups and injected intra-articularly: PBS group (50 μL), EGFP-Exo group (10 μL), and EGFP-Exo group (10 μL). 9 10 vesicles / 50μL), MK-Exo group (10 9 (1 vesicle / 50μL), injected once every two weeks, for a total of two injections.

[0034] The cartilage repair was assessed at week 4 after drug administration, as described in Example 3. The cartilage surface was observed under a stereomicroscope. Figure 6 As shown, the MK-Exo group exhibited the best cartilage repair quality, with uniform new cartilage thickness, intact tidal lines, and good subchondral bone reconstruction, significantly superior to the EGFP-Exo and PBS groups. These results indicate that extracellular vesicles secreted by HUC-MSCs overexpressing Midkine can effectively promote cartilage tissue regeneration.

[0035] Example 5: Mesenchymal stem cells overexpressing Midkine promote skin wound repair 1. Initiation of diabetic skin lesion model and mesenchymal stem cell transplantation in mice (1) Select SPF-grade male C57BL / 6J mice that meet the experimental requirements as transplant recipients, and set up MK-MSCs experimental group, PBS control group and EGFP-MSCs control group, with n=10 in each group; (2) Type I diabetes in mice was induced by streptozotocin (STZ). Freshly prepared STZ citrate buffer (pH 4.5) was injected intraperitoneally for 5 consecutive days at a dose of 50-60 mg / kg body weight. Seven days after the last injection, blood glucose was measured by blood collection from the tail vein using a blood glucose meter. The model of diabetes mellitus (DM) was determined to be successful if two consecutive random blood glucose values ​​were ≥16.7 mmol / L. (3) Four weeks after successfully inducing diabetes, mice were anesthetized with isoflurane inhalation, their backs were shaved and disinfected; a circular full-thickness skin defect with a diameter of 6-8 mm was created using a sterile skin biopsy piercing device. (4) 24 hours after modeling, the mice were divided into groups and injected intravenously via the tail vein with 150µL PBS (containing 0.5% bovine serum albumin), MK-MSCs or EGFP-MSCs 2×10⁻⁶ each. 6 cells.

[0036] On days 0, 3, 7, 10, 14, and 21 after drug administration, the wound was photographed using a digital camera at a fixed distance and under fixed lighting conditions, and the residual wound area was analyzed using ImageJ software. Statistical results are as follows: Figure 7 As shown, the MK-MSCs group exhibited the fastest wound healing, achieving complete healing by day 14, while the PBS group took up to day 21 to heal. These results indicate that HUC-MSCs overexpressing Midkine also effectively promote skin wound repair.

[0037] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A mesenchymal stem cell overexpressing Midkine, characterized in that, The mesenchymal stem cells integrate gene elements that overexpress Midkine. By utilizing the long-term survival and tissue chemotaxis of the mesenchymal stem cells, a localized and sustained high concentration of Midkine is released, thereby exerting the synergistic effect of the mesenchymal stem cells and Midkine.

2. A method for preparing mesenchymal stem cells overexpressing Midkine as described in claim 1, characterized in that, Includes the following steps: Step 1): Insert the coding sequence of Midkine as shown in SEQ ID NO.1 and the coding sequence of T2A polypeptide as shown in SEQ ID NO.2 before the EGFP sequence of the pRRLSIN plasmid to obtain the overexpressing Midkine lentiviral vector pRRLSIN-MK as shown in SEQ ID NO.3; Step 2): The lentiviral expression vector pRRLSIN-MK overexpressing Midkine was co-transfected with packaging plasmids pMD2.G and psPAX2 into 293T cells to prepare lentiviral particles overexpressing Midkine. Step 3): Transfect mesenchymal stem cells with a lentivirus that overexpresses Midkine.

3. The method for preparing mesenchymal stem cells overexpressing Midkine as described in claim 2, characterized in that, In step 3), the mesenchymal stem cells are human umbilical cord mesenchymal stem cells.

4. An application of mesenchymal stem cells overexpressing Midkine as described in claim 1, characterized in that, It is used to promote tissue regeneration and repair.

5. The application of mesenchymal stem cells overexpressing Midkine as described in claim 4, characterized in that, The tissue regeneration and repair refers to cartilage regeneration and skin wound repair.

6. An extracellular vesicle, characterized in that, Extracellular vesicles secreted by mesenchymal stem cells overexpressing Midkine as described in claim 1.

7. An application of the extracellular vesicles as described in claim 6, characterized in that, It is used to promote the repair of cartilage damage.