Begonia U6 promoter BsU6-3 and application thereof

By screening and analyzing the Begonia U6 promoter BsU6-3 and its truncated sequence BsU6-3.4P, the problem of limited application of CRISPR/Cas9 gene editing technology in Begonia breeding was solved, the transcription efficiency of sgRNA was improved, and a highly efficient gene editing system was constructed for the breeding of new varieties.

CN122012504APending Publication Date: 2026-05-12HENAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610279487.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-09
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

In current begonia breeding, the application of CRISPR/Cas9 gene editing technology is limited by the fact that related gene editing systems have not yet been effectively constructed. In particular, the U6 promoter has not been thoroughly studied in begonia, which affects the transcription efficiency of sgRNA and the efficiency of gene editing.

Method used

We provide the Begonia U6 promoter BsU6-3 and its truncated sequence BsU6-3.4P to construct a Begonia CRISPR/Cas9 gene editing system to drive LUC fluorescent protein expression. By cloning and analyzing the transcriptional activity of the U6 promoter in the Begonia genome, we screened for promoter sequences with high transcriptional activity.

Benefits of technology

It improved the transcription efficiency of sgRNA, enhanced the effect of gene editing, laid a technical foundation for the breeding of new begonia varieties, and realized the construction of an efficient gene editing system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the technical field of cultivation of new varieties of ornamental plants, and particularly relates to a begonia U6 promoter BsU6-3 and application thereof. The nucleotide sequence of the U6 promoter BsU6-3 is shown as SEQ ID No.1. The promoter is mainly used for constructing a begonia CRISPR / Cas9 gene editing system, or is used for driving LUC fluorescent protein expression. In the gene editing process, an endogenous U6 promoter of a receptor plant or a related species is used, so that the gene editing method has very important technical significance for improving the transcription efficiency of sgRNA and improving the gene editing efficiency. In the application, the inventor clones a series of U6 promoters in a begonia sempervirens genome, and performs preliminary comparative analysis on the transcriptional activity of the promoters by taking an LUC reporter gene as an example. Based on the results, a good technical foundation can be laid for subsequent efficient gene editing system construction and further begonia new variety cultivation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of ornamental plant breeding technology, specifically involving the BsU6-3 promoter of Begonia U6 and its application. Background Technology

[0002] In plant breeding, gene editing and other biotechnological methods are commonly used to cultivate new varieties. Among them, the CRISPR / Cas9-based gene editing system is one of the most frequently used techniques in plant breeding due to its advantages such as high efficiency, precision, and ease of operation.

[0003] Begonias are widely used in landscaping due to their diverse leaf shapes and colors. However, current begonia breeding still largely relies on conventional hybridization and selection methods. One of the main technical obstacles hindering the application of gene-editing technologies such as CRISPR / Cas9 in begonias is the lack of an effective gene-editing system.

[0004] In gene editing based on the CRISPR / Cas9 system, sgRNA (single-stranded guide RNA), transcribed by RNA polymerase III, is responsible for recognizing the target sequence, and its expression level directly affects the editing efficiency. RNA polymerase III is initiated by the U6 promoter; therefore, in-depth research on the U6 promoter is a crucial prerequisite for constructing a begonia gene editing system. Summary of the Invention

[0005] The purpose of this application is to provide a series of Begonia U6 promoters, thereby laying a certain technical foundation for the construction of Begonia gene editing system and further breeding of new Begonia varieties.

[0006] The technical solution adopted in this application is described in detail below.

[0007] The nucleotide sequence of the begonia U6 promoter BsU6-3 is shown in SEQ ID No. 1.

[0008] The BsU6-3 promoter of Begonia U6 is used in plants to construct a Begonia CRISPR / Cas9 gene editing system or to drive the expression of LUC fluorescent protein.

[0009] The truncated sequence BsU6-3.4P of the Begonia U promoter is shown in SEQ ID No. 2.

[0010] The truncated sequence BsU6-3.4P of the Begonia U promoter BsU6-3 is used in plants to construct a Begonia CRISPR / Cas9 gene editing system or to drive the expression of LUC fluorescent protein.

[0011] The CRISPR / Cas9 gene editing system consists of two parts: the Cas9 nuclease and sgRNA, which is responsible for recognizing the target sequence. The sgRNA is transcribed by RNA polymerase III, which is driven by the U6 promoter. Existing research shows that the U6 promoter is typically species-specific; therefore, using endogenous U6 promoters from the recipient plant itself or closely related species during gene editing is of great technical significance for improving sgRNA transcription efficiency and gene editing efficiency.

[0012] In this application, the inventors cloned a series of U6 promoters in the Begonia semperflorens genome, using the LUC reporter gene as an example, and conducted a preliminary comparative analysis of the transcriptional activity of these promoters. Based on these results, a solid technical foundation can be laid for the subsequent construction of an efficient gene editing system and for further breeding of new Begonia varieties. Attached Figure Description

[0013] Figure 1 Figure 1 shows the electrophoresis results of PCR amplification of six U6 promoters from Begonia semperflorens and the electrophoresis results of recombinant plasmids. Figure A shows the electrophoresis results of PCR amplification of the promoters, where band M is a 2 kb DNA marker, band 1 is BsU6-1, band 2 is BsU6-2, band 3 is BsU6-3, band 4 is BsU6-4, band 5 is BsU6-5, and band 6 is BsU6-6. Figure B shows the electrophoresis results of the recombinant plasmids, where band M is a 2 kb DNA marker, band 1 is BsU6-1::LUC, band 2 is BsU6-2::LUC, band 3 is BsU6-3::LUC, band 4 is BsU6-4::LUC, band 5 is BsU6-5::LUC, and band 6 is BsU6-6::LUC. Figure 2 This is a schematic diagram of the recombinant plasmid expression vector structure; Figure 3 Figure A shows the transient expression detection results of the recombinant plasmid expression vector in leaves of Nicotiana benthamiana. Figure A shows the fluorescence signal results of the experimental groups, where a is the BsU6-1::LUC group, b is the BsU6-2::LUC group, c is the BsU6-3::LUC group, d is the BsU6-4::LUC group, e is the BsU6-5::LUC group, and f is the BsU6-6::LUC group. Figure B shows the empty vector control group. Figure 4Figure A shows the results of truncation of the U6-3 promoter; Figure B shows the electrophoresis results of the truncated product after PCR amplification. In the figure, band M is a 2 kb DNA marker, band 1 is BsU6-3-P1, band 2 is BsU6-3-P2, band 3 is BsU6-3-P3, band 4 is BsU6-3-P4, and band 5 is BsU6-3-P5. Figure 5 The results show the transient expression of the recombinant plasmid with the truncated U6-3 promoter in tobacco leaves. Detailed Implementation

[0014] The present application will be further explained below with reference to the accompanying drawings and embodiments. Before introducing further embodiments, the situation of some biological materials involved in the following embodiments is briefly described as follows. Biomaterials: Begonia 'Super Olympics' and Nicotiana benthamiana are common and frequently used biological materials in begonia research. The applicant, as an institution of higher education and research, and the inventor, has long been engaged in research on begonia secondary metabolism, and therefore has long cultivated and preserved related biological materials. The recommended cultivation conditions for these biological materials are: temperature 23℃, light intensity 12000 lx, humidity 60%, and a photoperiod of 14 h light / 10 h darkness. Nicotiana benthamiana seeds were sown in moist vermiculite, covered with a film to retain moisture, and placed in a light environment for germination. Once two leaves had grown, they were transplanted into soil (vermiculite: nutrient soil = 3:1) and cultured for 4-6 weeks before subsequent experiments.

[0015] pGreenII-0800-LUC Plasmids are common and frequently used plant transient expression plasmids in existing molecular biology research. They can be obtained from public channels. As mentioned above, the inventor has been engaged in related research for a long time and therefore has preserved the plasmid for a long time. The sequencing and primer synthesis work was completed by Henan Youkang Gene Biotechnology Co., Ltd. Main kits and reagents: DNA purification kits, plasmid extraction kits, Escherichia coli DH5α and Agrobacterium GV3101 (pSoup) competent cells, etc., are products of Beijing Zhuangmeng International Biotechnology Co., Ltd. Genomic DNA extraction kit, 5min TA / Blunt-Zero Cloning Kit, DNA polymerase 2×Phanta Flash Master Mix (Dye Plus) and homologous recombinase Clon Express Ultra One Step Cloning Kit, etc., are products of Nanjing Novizan Biotechnology Co., Ltd. D-fluorescein potassium salt is a product of Digibio Biotechnology Co., Ltd.

[0016] Example 1 Given the important role of the U6 promoter in CRISPR / Cas9 gene editing, the inventors, combining their previous work on Begonia semperflorens transcriptome sequencing, further screened and cloned relevant U6 promoters in the Begonia semperflorens genome. The specific experimental process is briefly described below. (I) Preliminary screening and determination of the U6 promoter in Begonia semperflorens Using the snRNA sequence of Arabidopsis thaliana, the inventors compared and screened the Begonia semperflorens genome and found a total of 7 Begonia semperflorens U6 snRNAs.

[0017] After comprehensive analysis of these 7 sequences, those with an E-value < 3.12e were selected. -40 Of the six sequences, all were found to be 100 bp in length, highly conserved, and all began transcription with a 'G' base. Based on these findings, the 27 bp 5' end U6 snRNA and the upstream 1500 bp were selected as candidate Begonia U6 promoter sequences, named BsU6-1, BsU6-2, BsU6-3, BsU6-4, BsU6-5, and BsU6-6, respectively, and primers for subsequent PCR amplification were designed accordingly.

[0018] The specific design of the relevant primers is as follows: The snRNA sequence of the aforementioned Arabidopsis thaliana is as follows: gtcccttcggggacatccgataaaattggaacgatacagagaagattagcatggcccctgcgcaaggatgacacgcataaatcgagaaatggtccaaatttt.

[0019] Correspondingly, based on subsequent sequencing results, the BsU6 snRNA sequence of Begonia is as follows: GTCCTTCGGGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCACAAATCGAGAAATGGTCCAAATTTT. (II) PCR amplification Take leaves from a healthy 'Super Olympics' begonia (about 3-4 months old) and extract its genome according to the instructions of the plant genome extraction kit.

[0020] Subsequently, referring to the high-fidelity DNA polymerase instructions, PCR amplification was performed using the primers designed in step (I) above; the reference design for the 50μL amplification system is as follows: 2×Phanta Flash Master Mix, 25μL; Upstream forward primer, 1.5 μL; Below is a reverse primer, μL; DNA template, 2 μL; ddH2O, 20 μL; The PCR amplification procedure is as follows: Pre-denaturation: 98℃, 30s; denaturation: 98℃, 10s; annealing: 55~60℃, 5s; extension: 72℃, 10s (5s / kb); 72℃, 1min. (III) Transformation of amplified products

[0021] The PCR amplification products from step (II) were detected by 1% agarose gel electrophoresis (the amplification results are shown in the figure). Figure 1 As shown in the figure, the results are as expected, and the target fragment was recovered by referring to the instructions of the gel recovery and purification kit; Furthermore, referring to the kit instructions, the recovered product was ligated to the 5min TA / Blunt-Zero CloningKit plasmid; Subsequently, the above-mentioned ligation plasmid was transformed into DH5α competent cells, and positive monoclonal colonies were further selected for sequencing analysis. (iv) Sequencing results and analysis

[0022] The specific sequencing results of the six U6 promoter sequences are as follows: BsU6-1 (1500bp): BsU6-2(1500bp): BsU6-3 (1500bp, sequence as shown in SEQ ID No. 1):

[0023] BsU6-4(1500bp): BsU6-5(1500bp): BsU6-6(1500bp):

[0024] Based on the sequencing results above, the U6 promoter sequences of Begonia and Arabidopsis were compared. The results showed that both Begonia and Arabidopsis contained a TATA box and a USE element (5'-ATCC / TCACATCG-3') at positions 30 bp and 60 bp before the transcription start site. Since existing research suggests that the TATA box and USE element are related to the recognition and binding of RNA polymerase III, it is preliminarily speculated that all six Begonia U6 promoters may possess transcriptional activity.

[0025] Example 2 To further analyze the transcriptional activity of the U6 promoter cloned in Example 1, the inventors compared it with... pGreenII-0800-LUC The plasmid was ligated and transformed for verification. A brief overview of the experiments is as follows. (a) Sequence amplification

[0026] Using the T plasmid containing the relevant U6 promoter sequence from step (I) as a template, primers were designed and PCR amplification was performed (the amplification system and reaction procedure can be referred to Example 1). When designing primers, subsequent interactions with... pGreenII-0800-LUC The plasmid ligation sequence and specific primer sequence design are as follows: Note: Lowercase letters are homologous arms of the LUC vector. (ii) Construction of recombinant plasmids pGreenII-0800-LUC The plasmids were ligated using homologous recombinase;

[0027] The ligation product was further transformed into E. coli DH5α competent cells, and positive monoclonal bacteria were selected for sequencing identification (related electrophoresis results are shown in the figure). Figure 1 As shown in the figure, the results are as expected. To ensure correct plasmid recombination ligation, the correctly identified recombinant bacteria were propagated, and plasmids were extracted for later use. Finally, the correctly recombinant expression vector was obtained. BsU6-1:: LUC、BsU6-2::LUC , BsU6-3::LUC , BsU6-4::LUC , BsU6-5::LUC and BsU6-6::LUC .

[0028] A schematic diagram of the recombinant plasmid vector structure is shown below. Figure 2 As shown.

[0029] (III) Transient expression detection The recombinant expression vector prepared in step (II) was transformed into Agrobacterium GV3101 (pSoup) competent cells. After screening and identification, correctly transformed cells were selected and seeded into liquid LB medium at 28°C and 220 r·min. -1 Oscillation cultivation OD 600After reaching approximately 0.8, centrifuge, collect the bacterial cells, and then use buffer (10 mmol·L⁻¹). -1 MgCl2+ 10 mmol·L -1 MES + 200 μmol·L -1 The bacterial cells were resuspended in AS (OD600=0.8 after resuspension) and incubated at 28°C in the dark for 3 hours to serve as the infection solution.

[0030] Select uniformly growing and healthy leaves of Nicotiana benthamiana, inject them with the above-prepared infection solution, and place them in the dark for 24 hours after injection, then transfer them to a light incubator for 48 hours (23℃, 14 hours of light / 10 hours of darkness). Tobacco leaves that had undergone the above-mentioned transient transformation (infection) for 72 hours were removed, and 100 mmol·L⁻¹ was sprayed on the underside of the leaves. -1 The D-fluorescein sodium salt was incubated in the dark for 10 minutes, and then in vivo fluorescence signal images were captured using a Tanon 5200 fully automated chemiluminescence image analysis system. The transcriptional activity of different promoters was determined based on the intensity of the fluorescence signal (all related experimental operations were performed in biological replicates).

[0031] Experimental results are as follows Figure 3 As shown. Analysis reveals that: compared to pGreenII-0800-LUC In the negative control (empty vector), 72 hours after infection, BsU6-3 showed the strongest fluorescence signal, followed by BsU6-1 and BsU6-5, while BsU6-6 showed the weakest fluorescence signal. This result indicates that BsU6-3 has high transcriptional activity.

[0032] Example 3 In existing technologies, some studies suggest that a repressor may exist at the 5' end of the U6 promoter, thus significantly affecting transcriptional activity. Therefore, taking BsU6-3 as an example, the inventors, based on the positions of various elements in its structural analysis, truncated its 5' end (see schematic diagram). Figure 4 As shown), the length designs are as follows: 11057 (BsU6-3.1P), 952 (BsU6-3.2P), 620 (BsU6-3.3P), 434 (BsU6-3.4P) and 187 bp (BsU6-3.5P) (see below for the truncated sequence).

[0033] Referring to the foregoing description and conventional practices in the field, primers were designed using the T-BsU6-3 vector from Example 1 as a template for PCR amplification to obtain amplification products of five truncated promoters. The specific primer designs are as follows: Note: Lowercase letters are homologous arms of the LUC vector.

[0034] Subsequently, referring to the foregoing description and conventional practices in the field, the aforementioned truncated promoters were connected to... pGreenII- 0800-LUC Vector, to obtain recombinant expression vector (validation results as shown) Figure 4 (as shown) BsU6-3-P1::LUC , BsU6-3-P2:: LUC , BsU6-3-P3::LUC , BsU6-3-P4::LUC and BsU6-3-P5::LUC ; Finally, referring to the foregoing description, Agrobacterium was transformed to prepare an infection solution, and transient expression verification and fluorescence signal detection were performed.

[0035] The results are as follows Figure 5 As shown in the figure. Analysis shows that BsU6-3-P4 (BsU6-3.4P) has high transcriptional activity, while BsU6-3-P5 did not show a fluorescent signal.

[0036] U6-3 promoter truncated sequence: BsU6-3.1P (1057bp) BsU6-3.2P(952bp) AGAGAACGAAAAACACGAGCAAAAAAATATTATAGTTTAATGATGTTTTTCATTGATAACTTAAACGTTTAGTTCTTTTAACTAAGAAACAAGTTATGTATCTTATCAACGGAAAAGAATATCACTAAAGAACAAGTCTAATTATAAAGTATCAATTGATAATTGTCATTTTAATTATTAACTCATTCTAGATTAATTACACTAATTTGATCATTGACATCAATAAGTAGAAAACAAAAACGTGAAAATTAGAGGATAAATAACATTACGGATCGGTGTTTTCACTTTAGTTCGAGTCACTCATTGTTCAACACATGATCATGTTGTGGAATCGGGTTGCTTGTCAACACACCAACTCGACGAATTTAAGAAAGCAGCTCACTAAGTCGAGTTGGTCAATTACAAATGAGTAAACGTGACATGTTTTATTGATCGAATCAAACAATCTAGGACACAAGATGAC CCCGTCGACCATCTTTTCTTTTTTTTTTGGTAAATACATGGCAAAACAACACAAAGAACATAGTTTTAAATGTATTTTATGTCAATAATATTATCAGATTTATATTTAATTAATTCATTTTCCCCAATTTAACCATGAATCTTTGAATATCTTTTTAGTTTAAATGTATTTTATGTCATAATATTATCAGATTTATATTTAATTAAATTCAATTTTTTTTCCCAATTTAACC ATAAATCTTTGAATATTTTTCTAAATTTATTCAACATGCATATTATTCTTACTGGGTACCTCTGAATCAGATAATAGGCCGAAAATAATAATTTATTAAAAATAATTGGAATCGAAAAAGAAATAAAAGCGTCCATCGCATTGACGAGATCGAATGATTCGACAAAACGATCCCACATCGACTAGTCCGATAGAAAAAGTCTTCTTTAATACCAAACAGAAACGAACACTTTC BsU6-3.3P (620bp) TTGGGAATCGGTTGCTTGTCAACACACCAACTCGACGAATTTAAGAAAGCAGCTCACTAAGTCATTCGAGTTGGTCAATTACAAATGAGTAACGTGAACATGTTTTATTTGATCGAAATCAAACAATCTAGGACACAAGATGACCCCGTCGACCATCTTTTCTTCTTTTTTTTTTGGTAAATACATGGCAAAACAACACAAAGAACATAGTTTTAAATGTATTTTATGTCATAATATTATCAGATTTATATTTTAATTAAATTCATTTTTCCCCAATTTAACCATGAATCTTTGAATATCTTTTAGTTTTAAATGTATTTTATGTCATAATATTATCAGATTTATATTTTAATTAAATTCAATTTTTTTTCCCAATTTAACCATAAATCTTTGAATATTTTTCTAAATTTATTCAACATATCATATTATTCTTACTGGGTACCTCTGAATCAGATAATAGGCCGAAAATAATAATTTATTAAAATAATTGGAATCGAAAAAGAAATAAAAGCGTCCCATCGCATTGACGAGATCGAATGATTCGACAAACAACGATCCCACATCGACTAGTCCGATAGAAAAAGTCTTCTTTATATACCAACAGAAACGAACACACTTTC (434bp, as shown in SEQ ID No.2) GGCAAAACAACACAAAGAACATAGTTTTAAATGTATTTTATGTCATAATATTATCAGATTTATATTTTAATTAAATTCATTTTTCCCCAATTTAACCATGAATCTTTGAATATCTTTTAGTTTTAAATGTATTTTATGTCATAATATTATCAGATTTATATTTTAATTAAATTCAATTTTTTTTCCCAATTTAACCATAAATCTTTGAATATTTTTCTAAATTTATTCAACATATCATATTATTCTTACTGGGTACCTCTGAATCAGATAATAGGCCGAAAATAATAATTTATTAAAATAATTGGAATCGAAAAAGAAATAAAAGCGTCCCATCGCATTGACGAGATCGAATGATTCGACAAACAACGATCCCACATCGACTAGTCCGATAGAAAAAGTCTTCTTTATATACCAACAGAAACGAACACACTTTC BsU6-3.5P(187bp)ACTGGGTACCTCTGAATCAGATAATAGGCCGAAAATAATAATTTATTAAAATAATTGGAATCGAAAAAGAAATAAAAGCGTCCCATCGCATTGACGAGATCGAATGATTCGACAAACAACGATCCCACATCGACTAGTCCGATAGAAAGTCTTCTTTATATACCAACAGAAACGAACACACTTTC.

Claims

1. The Begonia U6 promoter BsU6-3, characterized in that, The nucleotide sequence of the U6 promoter BsU6-3 is shown in SEQ ID No.

1.

2. The application of the Begonia U6 promoter BsU6-3 as described in claim 1 in plants, characterized in that, It can be used to construct a CRISPR / Cas9 gene editing system for begonias, or to drive the expression of LUC fluorescent protein.

3. PCR amplification of the BsU6-3 promoter of Begonia U6 according to claim 1 using primer pair, characterized in that, The specific design is as follows: Forward primer: 5'-ATCAGTCAACTCGACCCGAT-3', Reverse primer: 5'-GGACCATTTCTCGATTTGTGCG-3'.

4. The truncated sequence BsU6-3.4P of the Begonia U promoter BsU6-3, characterized in that, The nucleotide sequence of the truncated sequence BsU6-3.4P is shown in SEQ ID No.

2.

5. The application of the truncated sequence BsU6-3.4P of the Begonia U promoter BsU6-3 as described in claim 4 in plants, characterized in that, It can be used to construct a CRISPR / Cas9 gene editing system for begonias, or to drive the expression of LUC fluorescent protein 2.