Application of OsRPP13 gene in regulation and control of heat resistance and photosynthetic performance of rice
By constructing the OsRPP13 gene knockout mutant, the problem of regulating the heat resistance and photosynthetic performance of rice under high temperature stress was solved, the heat resistance and photosynthetic efficiency of rice were improved, and gene resources were provided for molecular breeding.
Patent Information
- Application Number
- CN202610491879.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-15
- Publication Date
- 2026-05-12
- Estimated Expiration
- 2046-04-15
AI Technical Summary
In the current technology, the regulatory mechanism of the rice OsRPP13 gene on heat resistance and photosynthetic performance under high temperature stress has not been clarified, which affects the yield and physiological function of rice under high temperature stress.
By designing a CRISPR-Cas9 recombinant vector to target the OsRPP13 gene, an OsRPP13 gene knockout mutant was constructed. Rice callus was transformed using Agrobacterium-mediated transformation to obtain OsRPP13 gene knockout mutant lines, and their biological functions under high temperature stress were analyzed.
It significantly improved the heat resistance and photosynthetic performance of rice, enhanced the survival rate and photosynthetic efficiency under high temperature stress, and provided genetic resources for molecular breeding.
Smart Images

Figure CN122012532A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically involving OsRPP13 The application of genes in regulating heat tolerance and photosynthetic performance in rice, more specifically involving reducing... OsRPP13 Application of gene expression in improving heat resistance and photosynthetic efficiency in rice. Background Technology
[0002] Environmental temperature, as a core abiotic regulator of plant growth and development, directly determines the geographical distribution, growth cycle, and final yield of crops, and is one of the key constraints affecting the sustainable production of global agriculture and forestry. Under high-temperature stress, plants typically exhibit reduced seed germination rates, inhibited vegetative and reproductive growth, and in severe cases, leaf wilting or even death. With the intensifying trend of global warming, the frequency, duration, and intensity of high-temperature disasters are all showing a significant upward trend. The assessment report of the UN Intergovernmental Panel on Climate Change (IPCC) indicates that global temperatures are projected to rise by 2.6°C to 4.8°C by the end of this century. The continuously rising environmental temperatures pose a serious threat to crop yields. Therefore, elucidating the high-temperature stress tolerance mechanism of rice is beneficial for the scientific breeding of heat-resistant crops and has important strategic significance for addressing climate change and ensuring food security.
[0003] Rice ( Oryza sativa L. As a staple crop for more than half of the world's population, rice is highly sensitive to temperature changes, with an optimal growth temperature range of only 20℃ to 32℃. High-temperature stress can persist throughout the entire growth cycle of rice, triggering a series of physiological, biochemical, and molecular-level disorders that limit its yield potential. Therefore, in-depth analysis of the molecular mechanisms by which rice responds to high-temperature stress and the identification of key heat-resistance regulatory genes are of significant theoretical and applied value for breeding heat-resistant rice varieties through molecular breeding techniques, improving crop adaptability to climate change, and ensuring food security.
[0004] Photosynthesis is fundamental to rice's material production and yield formation, with over 90% of the dry matter required for rice yield coming from the accumulation of photosynthetic products. Compared to other physiological processes, photosynthesis is more susceptible to inhibition by high-temperature stress, with photosystem II (PSII) being the most sensitive core component of the photosynthetic apparatus. High-temperature stress directly disrupts the structure and function of the PSII oxygen-evolving complex (OEC), inhibiting electron donor-side activity, leading to impaired electron transport and reduced light energy utilization efficiency. Simultaneously, non-photochemical quenching capacity decreases, heat dissipation efficiency declines, and excess light energy accumulation triggers photoinhibition, ultimately resulting in decreased carbon assimilation capacity and reduced photosynthetic efficiency. Identifying key genes for rice photosynthetic adaptation under high-temperature stress and elucidating their molecular mechanisms is an important approach to improving rice's tolerance to high-temperature stress.
[0005] Plants have developed complex stress response mechanisms over long-term evolution, among which disease resistance proteins (R proteins), as core members of the plant immune system, play a crucial role in resisting pathogen invasion. RPP13 protein is a key member of the plant immune system; as a typical CC-NBS-LRR type disease resistance protein, it initiates defense by recognizing specific pathogen effector factors. Currently, research on RPP13 family genes mainly focuses on disease resistance in model plants such as Arabidopsis thaliana and tobacco, as well as crops such as wheat and maize. Studies have confirmed its important function in resisting infection by pathogens such as downy mildew, rice blast, and bacterial blight. However, with the deepening of research on plant stress physiology, increasing evidence suggests that some R proteins not only participate in biotic stress responses but may also participate in the regulation of abiotic stress tolerance through cross-regulation mechanisms—for example, CC-NBS-LRR type disease resistance proteins such as RPM1 in Arabidopsis thaliana and Rp1 in maize have been found to respond to drought, salt stress, and oxidative stress. However, to date, research on rice… OsRPP13 Research on the gene (RAP-DB ID: Os08g0543100) is still limited to its disease resistance function annotation. There are no publicly available reports clarifying whether it participates in the regulation of temperature stress tolerance. Its role, molecular mechanism, and application potential in rice high-temperature response are all unknown. Summary of the Invention
[0006] The purpose of this invention is to provide OsRPP13 The application of genes in regulating heat tolerance and photosynthetic performance in rice, specifically by reducing... OsRPP13 Application of gene expression in improving heat resistance and photosynthetic performance of rice.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: Based on the whole genome sequence of rice published on the official website of The Rice Annotation Project (RAP) (https: / / rapdb.dna.affrc.go.jp / ), rice was obtained. OsRPP13 Nucleotide sequence information of the gene (gene number Os08g0543100). Rice. OsRPP13 The gene coding region has a nucleotide length of 3555 bp, as shown in SEQ ID NO.1, and encodes a protein consisting of 1184 amino acids, as shown in SEQ ID NO.2.
[0008] The present invention also includes the function of the above-mentioned gene-related CRISPR-Cas9 recombinant vector and transformed plant lines, as well as the function of host cells containing the vector in regulating plant heat tolerance, which also fall within the scope of protection of the present invention.
[0009] The gene functions protected by this invention include not only those described above. OsRPP13 Genes, including those related to OsRPP13 The function of homologous genes with high homology (such as above 80%; more preferably above 90%; more preferably above 95%; more preferably above 98%) in high-temperature tolerance.
[0010] This invention is based on OsRPP13 By designing the target nucleotide sequence from the gene's CDS sequence, a CRISPR-Cas9 recombinant vector was constructed and started by the rice constitutive gene promoter. The vector was then obtained through Agrobacterium infection. OsRPP13 Gene knockout mutant lines were analyzed. osrpp13 The biological functions of mutants in response to high-temperature stress can provide genetic resources for molecular breeding of crops with high temperature tolerance and high light efficiency.
[0011] This invention discloses a method for reducing OsRPP13 The biological functions of gene expression in improving heat resistance and photosynthetic performance in rice are specifically manifested in: under high temperature stress, OsRPP13 Gene knockout mutants ( osrpp13 The survival rate and Fv / Fm, Y(I), Y(II), ETR(I), and ETR(II) of the mutant were significantly higher than those of the wild type.
[0012] The above application draws conclusions by simulating high-temperature stress experiments in a temperature-controlled incubator.
[0013] Specifically, it will include OsRPP13 CRISPR-Cas9 recombinant vectors with gene-specific target sequences were transformed into rice callus tissue using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed rice callus tissue was then cultured into plants.
[0014] Based on its function, heat-resistant plants can be obtained through genetic modification. Specifically, this can be achieved by... OsRPP13 Gene knockout in the target plant yields a transgenic plant, which exhibits higher heat resistance and photosynthetic efficiency than the target plant.
[0015] The present invention also discloses a plant breeding method, wherein the method is as follows (1) or (2): (1) By reducing the activity of OsRPP13 protein in the target plant, plants with stronger heat resistance and photosynthetic efficiency than the target plant were obtained. (2) Reduce OsRPP13 Gene expression was used to obtain plants with greater heat resistance and photosynthetic efficiency than the target plant. Preferably, the target plant is rice.
[0016] In one embodiment of the present invention, a polynucleotide is cloned into a CRISPR vector using conventional methods, and the recombinant vector carrying the exogenous gene is introduced into plant cells capable of expressing the OsRPP13 protein, thereby enabling the plant cells to express the OsRPP13 protein. OsRPP13 protein deficiency. This can also be achieved by regenerating plants from the aforementioned plant cells. OsRPP13 Gene-deleted mutant plants were used, and recombinant plasmids were transferred into the plants using Agrobacterium-mediated transformation.
[0017] The term "plant" as used in this invention includes the whole rice plant, its parent and offspring plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots, flowers, and other tissues and organs. OsRPP13 Both genes and nucleic acids were edited.
[0018] This invention also extends to the harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, and other tissues and organs. It further relates to other derivatives of the plant after harvest, such as dried granules or powders, oils, fats and fatty acids, starches, or proteins. This invention also relates to foods or food additives obtained from the relevant plants.
[0019] Beneficial technical effects of the present invention: This invention constructs rice OsRPP13 The CRISPR-Cas9 recombinant vector of the gene was used to transform rice callus tissue using Agrobacterium-mediated transformation to obtain rice OsRPP13 Mutant strain. The inventors revealed the reduction of [something] by simulating high-temperature stress experiments in an incubator. OsRPP13 The role of gene expression in improving heat resistance and photosynthetic efficiency in rice provides gene resources for molecular breeding of rice with high temperature resistance and high photosynthetic efficiency. Attached Figure Description
[0020] Figure 1 Wild type after high temperature treatment OsRPP13 Gene expression levels.
[0021] Figure 2 For wild-type rice and osrpp13 Mutant strain genome OsRPP13 Gene sequence alignment diagram; in the diagram, A is OsRPP13 Gene mutant target design diagram, B is osrpp13 Gene sequencing peak diagram in mutants.
[0022] Figure 3 Wild-type rice after high-temperature treatment and osrpp13 Phenotypic and survival statistics of mutant lines; in the figure, A represents wild type and... osrpp13Phenotypic diagram of leaf growth in mutant strains, B is a statistical chart of survival rate of related materials.
[0023] Figure 4 Wild-type rice after high-temperature treatment and osrpp13 Maximum photonic efficiency of leaves in mutant strains; in the figure, A represents the wild type and... osrpp13 Chlorophyll fluorescence image of mutant strain, B is Fv / Fm statistical graph of related materials.
[0024] Figure 5 Wild-type rice after high-temperature treatment and osrpp13 The photosynthetic parameters of the mutant strains were determined specifically by four indicators: actual photochemical efficiency (Y(I), Y(II)) and electron transport rate (ETR(I), ETR(II)) of photosystem I and photosystem II. Detailed Implementation
[0025] The principles and features of the present invention will now be described in detail with reference to the accompanying drawings. These embodiments are provided to provide a more thorough explanation of the invention and to fully convey the scope of the invention to those skilled in the art.
[0026] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used are commercially available.
[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.
[0028] Unless otherwise stated, the implementation of this invention will utilize conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques have been fully explained in published literature. Furthermore, the gene editing methods, gene editing vector construction methods, and gene-edited plant acquisition methods employed in this invention, except for those used in the following embodiments, can all be implemented using methods already disclosed in existing literature.
[0029] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.
[0030] In addition, to provide a more intuitive understanding of the technical solution of this invention, some technical terms involved in this invention are explained as follows: A "mutant" is an individual that has undergone a mutation and has phenotypic characteristics that differ from the wild type.
[0031] "Recombinant vector" refers to a vector that adds expression elements (such as promoters, RBS, terminators, etc.) to the basic skeleton of a cloning vector in order to knock out the target gene.
[0032] Example 1: High Temperature Stress OsRPP13 Gene expression status Wild-type rice ZH11, grown to the two-leaf-one-heart stage at normal 28℃, was treated with a high temperature of 42℃ for 3 hours before sampling. The middle portion of the second leaf was taken, and three biological replicates were set up. The sampled leaves were flash-frozen in liquid nitrogen for RNA extraction, and cDNA was obtained after reverse transcription. Real-time quantitative PCR (qRT-PCR) analysis was then performed. The results showed that high-temperature treatment significantly inhibited... OsRPP13 Gene expression ( Figure 1 ).according to OsRPP13 Primers OsRPP13-qPCR-F and OsRPP13-qPCR-R were designed based on the CDS sequence of the gene, using the OsACTIN1 gene from rice as an internal control (primers OsACTIN1-qPCR-F and OsACTIN1-qPCR-R). Detection was performed using qRT-PCR. OsRPP13 Gene expression levels, primer sequences are as follows: OsRPP13-qPCR-F: 5'-AAGGAGCTCTGTGGCTTGAA-3' OsRPP13-qPCR-R: 5'-TCCAGACCAGACGGGAATAA-3' OsACTIN1-qPCR-F: 5'-GGAAGTACAGTGTCTGGATTGGAG-3' OsACTIN1-qPCR-R: 5'-TCTTGGCTTAGCATTCTTGGGT-3'.
[0033] Example 2: Comparison of heat tolerance and photosynthetic performance between wild-type and mutant lines 1. Construction of rice mutant lines Based on the whole genome sequence of rice published on the official website of The Rice Annotation Project (RAP) (https: / / rapdb.dna.affrc.go.jp / ), rice was obtained. OsRPP13 Nucleotide sequence information of a gene. Using a website. https: / / crispor.gi.ucsc.edu / crispor.py Design the target gene sequence. Select the target sequence TATCAATCGTAGGGATGGGGG ( Figure 2 In step A), an expression cassette carrying the target gRNA is ligated into a CRISPR-Cas9 backbone vector, then transferred into rice callus tissue via Agrobacterium-mediated transformation, and cultured to obtain the T0 generation. osrpp13 Mutant strain.
[0034] 2. Screening of rice mutant lines The T0 generation obtained in the above steps osrpp13 The mutant line was propagated, and the harvested seeds (T1 generation) were cultured under conditions of 14h light / 10h darkness, 28 ℃, and 70% relative humidity until the two-leaf-one-heart stage. DNA was extracted, and the genome of the T1 generation seedlings was amplified by PCR. OsRPP13 Genes were sequenced. Sequencing results showed that in T1 generation positive plants... OsRPP13 The gene exhibited three different mutation types (7 bp deletion, 1 bp deletion, and 1 bp insertion), indicating that the mutant strain... OsRPP13 Gene editing has occurred. Figure 2 (B in the middle).
[0035] 3. Wild-type rice and osrpp13 Phenotype of mutant lines under high temperature treatment conditions 3.1 High-Temperature Treatment Method After germination of T2 generation seeds, they were cultured under normal growth conditions (photoperiod of 14h light / 10h dark, light intensity of 250μE, relative humidity of 70%, and temperature of 28℃) until the two-leaf-one-heart stage, and then background identification was performed to determine that they were... OsRPP13The mutated plants were then cultured for 2 days under conditions of 14h light / 10h darkness, 250μE light intensity, 70% relative humidity, and 42℃. Afterward, they were photographed and returned to normal growth conditions for one week to recover. The survival rate was calculated, and the maximum photochemical quantum efficiency F was measured. v / F m .
[0036] 3.2 Phenotype after high temperature treatment After high-temperature treatment, a large number of wild-type plants wilted and died, while osrpp13 Mutant strains ( osrpp13- 2 , OSRPP13-18 , OSRPP13-20 There are fewer cases of wilting and death. Figure 3 (A) The results showed that, compared with the wild type, osrpp13 The mutant strains are more resistant to high temperatures.
[0037] Statistics of wild type and osrpp13 The survival rate of mutant plant lines was found to be... osrpp13 The survival rate of mutant lines was significantly higher than that of wild-type lines. Figure 3 (B in the text). Further testing of wild-type and... osrpp13 Chlorophyll fluorescence diagram of mutant lines ( Figure 4 A) and the maximum photochemical quantum efficiency F of the leaf v / F m The results showed that, after being subjected to high-temperature stress, the maximum photochemical quantum efficiency F of wild-type leaves was [missing information]. v / F m Significantly lower osrpp13 mutant strain ( Figure 4 (B in the text), which indicates knockout OsRPP13 Genes can enhance rice's ability to withstand high temperatures.
[0038] 3.3 Determination of photosynthetic parameters after high-temperature treatment After high-temperature treatment, wild-type plants and osrpp13 The results of photosynthetic parameter measurements of the mutant strains showed that, compared to the wild type, osrpp13 The actual photochemical efficiency (Y(I), Y(II)) and electron transport rate (ETR(I), ETR(II)) of photosystem I and photosystem II of the mutant strain were significantly improved, and these improvements were achieved even at higher light intensities (>500 μmol·m⁻¹). -2 ·s -1 Maintaining a clear advantage Figure 5 This indicates that knockout OsRPP13 The genes enhanced the plant's basic photosynthetic capacity and light energy conversion efficiency.
[0039] The above description is only a preferred embodiment of the present invention and is used only to explain the present invention. It is not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. All changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.
Claims
1. OsRPP13 The application of genes in regulating heat tolerance and photosynthetic performance in rice is characterized by, The OsRPP13 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the regulation is manifested as: reducing OsRPP13 Gene expression improves the heat resistance and photosynthetic efficiency of rice.
2. The application according to claim 1, characterized in that, reduce OsRPP13 Gene expression is achieved through knockout. OsRPP13 Gene.
3. The application according to claim 2, characterized in that, By building OsRPP13 The CRISPR-Cas9 vector for the gene yielded individuals with higher heat resistance and photosynthetic efficiency than the wild type. OsRPP13 Gene knockout mutant lines.
4. The application according to claim 3, characterized in that, The heat resistance and photosynthetic performance are as follows: under high temperature stress... OsRPP13 The survival rate and Fv / Fm, Y(I), Y(II), ETR(I), and ETR(II) of the gene knockout mutant lines were significantly higher than those of the wild type.
5. A plant breeding method, characterized in that, The method is as follows (1) or (2): (1) By reducing the activity of OsRPP13 protein in the target plant, plants with stronger heat resistance and photosynthetic efficiency than the target plant were obtained. (2) By reducing the content of the target plant OsRPP13 Gene expression was used to obtain plants with greater heat resistance and photosynthetic efficiency than the target plant. The target plant is rice, and the amino acid sequence of the OsRPP13 protein is shown in SEQ ID NO.
2. OsRPP13 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
6. The plant breeding method according to claim 5, characterized in that, reduce OsRPP13 Gene expression is achieved through knockout. OsRPP13 Gene.
7. A method for improving the heat resistance and photosynthetic performance of rice, characterized in that, The method is knockout. OsRPP13 Genes, the ones mentioned OsRPP13 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
8. The plant breeding method according to claim 6 or the method for improving the heat resistance and photosynthetic performance of rice according to claim 7, characterized in that, Using Agrobacterium-mediated CRISPR-Cas9 gene editing technology, we can obtain... OsRPP13 Gene knockout mutant lines.