Rice OsTIP2; application of gene 2 in improving resistance of rice to acetochlor and rice breeding material of gene 2
By knocking out the OsTIP2;2 gene in rice and inactivating the acetochlor transporter using the CRISPR/Cas9 system, the problem of rice's sensitivity to acetochlor was solved, achieving rice resistance and promoting simplified rice cultivation and environmental protection.
Patent Information
- Application Number
- CN202610318921.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-16
- Publication Date
- 2026-05-12
AI Technical Summary
In existing technologies, the sensitivity of rice to acetochlor leads to increased herbicide use, environmental pollution, and increased weed resistance, making it difficult to achieve simplified rice cultivation.
By knocking out the OsTIP2;2 gene in rice using gene editing technology and inactivating the acetochlor transporter protein using the CRISPR/Cas9 system, herbicides can be prevented from reaching the target site of rice, thus cultivating acetochlor-resistant rice germplasm resources.
It significantly alleviated the growth-inhibiting effect of acetochlor on rice, achieved resistance to acetochlor in rice, ensured high and stable yields of rice, and can be stably inherited, making it suitable for the construction of resistant rice germplasm resources.
Smart Images

Figure CN122012598A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of rice breeding technology, and in particular to the application of the rice OsTIP2;2 gene in improving rice resistance to acetochlor and its rice breeding materials. Background Technology
[0002] Simplified planting methods such as direct seeding of rice represent the future direction of rice cultivation. The key to ensuring high and stable rice yields lies in weed control. Chemical control is currently the most common method of weed control; however, rice paddies are home to a wide variety of weeds with multiple resistances, which can easily lead to excessive herbicide use, environmental pollution, pesticide residues, and increased weed resistance.
[0003] Acetochlor, an amide-based herbicide, is used as a pre-emergence herbicide, which can reduce the total amount of herbicide used and improve the ease of weeding. However, it is difficult to apply to paddy fields due to its adverse effects on rice growth. This invention uses gene editing technology to inactivate the acetochlor transporter protein, preventing the herbicide from reaching the target site in rice to exert its effect, thus obtaining resistant rice varieties. When used in combination with acetochlor, it facilitates simplified rice cultivation and has significant economic value. Summary of the Invention
[0004] The purpose of this invention is to provide an application of the rice OsTIP2;2 gene in improving rice resistance to acetochlor and its rice breeding material.
[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0006] This invention provides the application of the rice OsTIP2;2 gene in improving rice resistance to acetochlor, by knocking out the OsTIP2;2 gene to improve rice resistance to acetochlor;
[0007] The amino acid sequence of the OsTIP2;2 gene is shown in SEQ ID NO:2, or it is the amino acid sequence of a derivative protein that still has the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the sequence shown in SEQ ID NO:2.
[0008] Furthermore, the nucleotide sequence of the OsTIP2;2 gene is shown in SEQ ID NO: 1.
[0009] This invention also provides the application of the rice OsTIP2;2 gene in the creation of amide herbicide-resistant germplasm resources through sexual or asexual reproduction, wherein the amino acid sequence of the OsTIP2;2 gene is as shown in SEQ ID NO:2, or is the amino acid sequence of a derivative protein that still has the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the sequence shown in SEQ ID NO:2.
[0010] A method for cultivating OsTIP2;2 transgenic plants, specifically: constructing an OsTIP2;2 gene knockout vector, introducing the gene knockout vector into the target plant, and obtaining OsTIP2;2 gene knockout rice plants.
[0011] A rice breeding material specifically comprises: knocking out the vacuolar membrane aquaporin gene OsTIP2;2 using CRISPR / Cas9 gene editing technology, or editing the nucleotide sequence of the rice OsTIP2;2 gene, thereby inhibiting the expression level and / or activity of the protein OsTIP2;2 in rice.
[0012] Compared with the prior art, the outstanding effect of the present invention is as follows:
[0013] This invention cloned a vacuolar membrane aquaporin family gene, OsTIP2;2. Knockout of OsTIP2;2 in wild-type rice using CRISPR / Cas9 gene editing technology significantly alleviated the growth-inhibiting effect of acetochlor on wild-type rice, indicating that this gene participates in the targeted transport pathway of acetochlor in rice and has the potential to cultivate acetochlor-resistant rice germplasm resources. The herbicide resistance of this gene-edited rice can be stably inherited through sexual or asexual reproduction and can be used to construct resistant rice germplasm resources.
[0014] The application of the rice OsTIP2;2 gene in improving rice resistance to acetochlor and its rice breeding materials, as described below with reference to the accompanying drawings and specific embodiments, will be further explained. Attached Figure Description
[0015] Figure 1 This image shows the subcellular localization of OsTIP2;2 protein-GFP in rice protoplasts. Scale bar = 10 nm.
[0016] Figure 2 The sequence alignment results of OsTIP2;2 protein with representative aquaporins are shown.
[0017] Figure 3 Analysis of the docking between OsTIP2;2 protein and acetochlor molecules.
[0018] Figure 4 Figure A shows the growth of yeast heterologously expressing OsTIP2;2 protein under acetochlor stress; Figure B shows the growth phenotype of yeast under acetochlor stress and the growth curve of recombinant yeast.
[0019] Figure 5 Identification of OsTIP2;2 mutant plants.
[0020] Figure 6 Figure A shows the tolerance of wild-type rice and the OsTIP2;2 mutant to acetochlor during seed germination. Figure B shows the growth of plants under acetochlor stress and the root length and plant height of plants under acetochlor stress.
[0021] Figure 7 To assess the tolerance of wild-type rice and the OsTIP2;2 mutant to acetochlor soil treatment. Detailed Implementation
[0022] Unless otherwise specified, the experimental methods described in the following examples are generally performed under standard experimental conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used are commercially available.
[0023] All chemical reagents used in the examples were either imported or domestically produced at the cell grade.
[0024] In the examples, the *Escherichia coli* DH5α strain was a commonly used strain, commercially available. Most molecular biology laboratories have it preserved. The rice variety was wild-type Zhonghua 11 (a publicly used, commercially available rice variety).
[0025] The primers used in the examples were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the sequencing was performed by Beijing Qingke Biotechnology Co., Ltd.
[0026] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.
[0027] Example 1: Cloning of the OsTIP2;2 gene and its encoded protein
[0028] RNA (OMEGA R6827-01) was extracted from seedlings of the wild-type japonica rice variety Zhonghua 11, and reverse transcribed (Takara cat#6210A) to obtain gDNA-free cDNA. This cDNA was used as a template for PCR amplification using forward primer F1 and reverse primer R1 (sequences shown in SEQ ID NO: 3-4). A 747 bp PCR product was obtained.
[0029] Sequencing revealed that the 747 bp PCR product contained the nucleotides shown in SEQ ID NO.1. Amino acid translation of the coding sequence CDS was performed using (http: / / web.expasy.org / translate / ) to obtain the amino acid sequence of OsTIP2;2, encoding 248 amino acids. The encoded protein was named OsTIP2;2, and its amino acid sequence is shown in SEQ ID NO.2.
[0030] F1: 5'-ATGTCGGGCAACATCGCCTT-3';
[0031] R1: 5'-TTAGAACTCGCTGCTGGCAA-3'.
[0032] Example 2: Subcellular localization of OsTIP2;2 protein
[0033] Total RNA was extracted from 15-day-old Zhonghua 11 rice seedlings, and cDNA was obtained by reverse transcription. This cDNA was then used as a template for PCR amplification to amplify the full-length ORF of OsTIP2;2 (with the stop codon removed). The primers used were (as shown in SEQ ID NO: 5-6):
[0034] F2: 5'- TCAGATCTCGAGCTCAAGCTTCATGTCGGGCAACATCGCCTT-3';
[0035] R2: 5'-CCTTGCTCACCATCAGGATCCCGAACTCGCTGCTGGCAACG-3'.
[0036] The amplified target fragment was digested and recovered, then ligated with the empty vector 322-dl-eGFPn (Beijing Huayueyang) to fuse OsTIP2;2 with GFP. After confirmation by sequencing, the fusion vector 322-dl-eGFPn-OsTIP2;2 and the empty vector were transformed into rice protoplasts, respectively, and cultured at room temperature for 16 h. The subcellular localization of the fusion protein OsTIP2;2-GFP and the protein GFP in rice protoplasts was observed under a laser confocal microscope. The results are as follows: Figure 1 As shown, this demonstrates that the OsTIP2;2 protein is specifically located in the rice cell membrane.
[0037] Example 3: OsTIP2;2 protein sequence analysis
[0038] Reported and representative aquaporins from other species were downloaded from https: / / blast.ncbi.nlm.nih.gov, and their sequences were compared using MEGA software. Yellow highlights indicate NPA motifs, green indicates ar / R selective filters, and red indicates Froger sites, as shown below. Figure 2 As shown, this result can be used as a reference for subsequent analysis of the water channel structure.
[0039] Example 4: Docking OsTIP2;2 with acetochlor molecules
[0040] 1. The 3D model of OsTIP2;2 was used for protein structure prediction using AlphaFold3 (https: / / alphafold.ebi.ac.uk / ). The validity of the model structure was validated online using MolProbity (http: / / molprobity.biochem.duke.edu / ). The structural formula of acetochlor was obtained from PubChem (https: / / pubchem.ncbi.nlm.nih.gov / ).
[0041] 2. Protein binding pockets were predicted using the Proteins Plus website. Using OsTIP2;2 protein as the receptor and acetochlor as the ligand, molecular docking was performed using Auto Dock Vina. A 20×20×20 ų docking box was constructed centered on the Proteins Plus output, with the conformational search exhaustiveness parameter set to 150 to ensure sufficient conformational space sampling. High-resolution docking was then selected from the output results for further analysis and 3D model preparation using PyMOL. Figure 3 ).
[0042] The results showed that the structural model predicted that the regions where OsTIP2;2 interacts with acetochlor include amino acid residues Ala40, Leu52, Val60, Pro129, His131, Gly132, Ile184, and Arg199, which exhibit hydrophobic interactions with acetochlor. Figure 3 ).
[0043] Example 5: Growth of yeast heterologously expressing OsTIP2;2 protein under acetochlor stress.
[0044] 1. Sensitivity test results of yeast strains in solid culture medium
[0045] Single-colony yeast cells were suspended in 1 mL of SC-galactose medium to induce expression for 16-20 h, and the OD of the yeast culture was measured at this time. 600 The values were uniformly diluted to 0.2 with SC-galactose medium, and then diluted 20-fold and 200-fold with sterile water. 3 μL of yeast suspensions of different concentrations were inoculated onto SC-galactose solid medium containing 0.5, 1, and 2 mM acetochlor, respectively, and incubated upside down in a 30℃ incubator for 5-6 days, with photographs taken and records recorded.
[0046] The results showed that the transgenic strain (pYES2-OsTIP2;2) grew in the same manner as the empty vector strain (pYES2) without the addition of acetochlor, but its growth was weaker than that of the wild-type strain with the addition of acetochlor. Figure 4 A).
[0047] 2. Growth of yeast strains in liquid culture medium
[0048] Single-colony yeast cells were suspended in 1 mL of SC-galactose medium to induce expression for 16-20 h, and the OD of the yeast culture was measured at this time. 600 The bacterial culture was uniformly diluted to 0.2 with SC-galactose medium. 100 μL of the bacterial culture and 100 μL of liquid medium containing 0.5 mM acetochlor were then transferred to the corresponding 96-well plates. The 96-well plates were placed in a microbial growth curve analyzer and incubated at 30℃ and 800 rpm for 24 h. OD was measured every 0.5 h. 600 value.
[0049] The growth curves show that the growth rate of the yeast strain transfected with the empty vector did not change significantly under culture conditions with or without acetochlor, but the growth trend and rate of the yeast strain expressing OsTIP2;2 were significantly inhibited under acetochlor treatment. Figure 4 B).
[0050] Example 6: Construction of OsTIP2;2 mutant plants by CRISPR knockout
[0051] Using Zhonghua 11 as material, a CRISPR / Cas9 knockout line of OsTIP2;2 was constructed using Wuhan Aidijing Biotechnology Co., Ltd.
[0052] 1. Using the CRISPR / Cas9 system, target sequences are selected based on the exon sequences of OsTIP2;2 (as shown in SEQ ID NO: 7-8). A simple and efficient CRISPR / Cas9 system is used to select specific target sequences based on the exon sequences of OsTIP2;2, specifically inactivating the OsTIP2;2 protein.
[0053] Target 1: CTTGAGGGAGGCCGCGCTGA AGG;
[0054] Target 2: GTGGCGGTGTGCCACGGGTT CGG.
[0055] 2. Amplify sgRNA expression cassettes containing the above target sequence fragments.
[0056] (1) Based on the target sequence, design fusion PCR primers to amplify target 1-OsU6a, target 1-gRNA, target 2-OsU6b, and target 2-gRNA.
[0057] Target 1: (as shown in SEQ ID NO: 9-10)
[0058] gRT1: 5'-CTTGAGGGAGGCCGCGCTGAGTTTTAGAGCTAGAAAT-3'
[0059] OsU6a: 5'-TCAGCGCGGCCTCCCTCCAAGCGGCAGCCAAGCCAGCA-3'
[0060] Target 2: (as shown in SEQ ID NO: 11-12)
[0061] gRT2: 5'-TGGCGGTGTGCCACGGGTTGTTTTAGAGCTAGAAAT-3'
[0062] OsU6b: 5'-AACCCGTGGCACAACCGCCACAACACAAGCGGCAGC-3'
[0063] OsU6a / OsU6b were amplified in UF: CTCCGTTTTACCTGTGGAATCG (as shown in SEQ ID NO: 13) to obtain target 1-OsU6a; target 2-OsU6b; gRT1 / gRT2 were amplified in gRNA-R: CGGAGGAAAATTCCATCCAC (as shown in SEQ ID NO: 14) to obtain target 1-gRNA / target 2-gRNA.
[0064] The first round of PCR amplification of the U6 promoter and gRNA;
[0065] pU6 amplification system:
[0066]
[0067] gRNA amplification system:
[0068]
[0069] PCR reaction parameters:
[0070]
[0071] (2) Design adapter primers with sticky ends. The amplified U6 promoter with the target homologous sequence and the gRNA sequence were fused by PCR to obtain the sgRNA expression cassette. At the same time, specific sticky end adapters (F3: accg; R3: ctcg) of the pCRISPR / Cas9 system and specific sticky end adapters between the two expression cassettes (F4: tcag; R4: ctga) were added, and complete adapter primers were synthesized. The sequences are shown in SEQ ID NO: 15-18.
[0072] Pps-R: TTCAGAggtctcT accg ATGGAATCGGCAGCAAAGG
[0073] Pgs-2: AGCGTGggtctcG tcag ggTCCATCCACTCCAAGCTC
[0074] Pps-2: TTCAGAggtctcT ctga cacTGGAATCGGCAGCAAAGG
[0075] Pgs-L: AGCGTGggtctcG ctcg ATCCATCCACTCCAAGCTC
[0076] The two independent pU6 promoters and gRNA sequences obtained from the first round of amplification were assembled into an sgRNA expression cassette.
[0077] Second round of PCR amplification of sgRNA expression cassette
[0078] sgRNA expression cassette amplification system:
[0079]
[0080] sgRNA expression cassette amplification system:
[0081]
[0082] PCR reaction parameters:
[0083]
[0084] (3) Enzyme digestion and ligation: The amplified sg-RNA and the Cas9-containing vector pEGCas9Pubi-H (provided by Wuhan Aidijing Technology Co., Ltd.) were digested with restriction endonuclease BsaⅠ to generate linearized sticky ends that are complementary to the sticky ends of the target sequence. The sg-RNA expression cassette was then ligated to the pEGCas9Pubi-H vector using the Golden Gate assembly method.
[0085] The enzyme digestion and ligation system is as follows:
[0086]
[0087] Enzyme digestion-ligation reaction parameters:
[0088]
[0089] (4) The ligation product was transformed into Escherichia coli DH5α, cultured overnight on Kanamycin-resistant LB plates, and positive strains were selected for sequencing to obtain the complete pCRISPR / Cas9 recombinant vector (pEGCas9Pubi-H-OsTIP2;2-KO) containing the OsTIP2;2 protein target sequence sg-RNA+Cas9 with correct sequencing.
[0090] 3. The obtained pCRISPR / Cas9 recombinant vector was introduced into rice callus to obtain transgenic plants. The obtained complete recombinant vector containing the OsTIP2;2 protein target sequence -sg-RNA+Cas9 was introduced into rice callus to prepare transgenic rice. Transgenic plants with completely inactivated OsTIP2;2 protein could be obtained in the T0 generation plants.
[0091] 4. Screening for transgenic positive plants among transgenic plants: DNA was extracted from the transplanted transgenic plants (T0 generation) and the target sequence sites were detected. A total of 12 positive plants were detected.
[0092] 5. Obtaining mutant plants from transgenic positive plants
[0093] (1) Identification of mutation sites: DNA was extracted from the transplanted positive plants. Specific primers F5 and R5 (as shown in SEQ ID NO: 19-20) were designed for DNA fragments containing the target site within 500 bp. The DNA fragments containing the target site were amplified. The 300 bp PCR product was purified and sent to the company for sequencing. The sequencing results were compared with the wild-type plant sequence to screen out mutant plants.
[0094] F5: 5'- ATGTCGGGCAACATCGCCTT -3';
[0095] R5: 5'-GAGGATGGTGATCTGGCCGC-3'.
[0096] (2) The mutant plants were propagated, and seeds were collected from individual plants in the T1 generation transgenic segregating population that did not contain transgenic elements such as hygromycin and Cas9. These were the loss-of-function mutants without transgenic components, named ostip2;2-3 and ostip2;2-8, respectively. The mutation analysis results are as follows: Figure 5 As shown.
[0097] Example 7 Sensitivity test of rice during germination stage to acetochlor
[0098] The knockout lines ostip2;2-3 and ostip2;2-8 were selected and their growth in acetochlor was observed through tissue culture. MS medium was prepared as follows: 15 g of sucrose and 2.215 g of MS medium base salt (EDTA sodium iron, containing vitamins) were added to 500 mL of secondary water. The pH was adjusted to 5.7 with NaOH, and the medium was dispensed into 80 mL portions for each culture flask. 0.28 g of Phytagel was added, and the flask was sterilized by high-temperature steam. Acetochlor was added when the temperature dropped to approximately 60°C to a final concentration of 20 nM. The mixture was then stirred, cooled, and solidified before use.
[0099] The seeds were thawed at 49℃ for 3-4 days. Before planting the tissue culture seedlings, the seeds were disinfected: first, they were washed three times with 75% alcohol prepared with sterile water for 3 minutes each time; then, they were washed twice with 30% sodium hypochlorite solution for 3 minutes and 20 minutes each time. During washing, the seeds were shaken rapidly to remove impurities adhering to the seed surface and reduce the possibility of subsequent contamination; finally, they were rinsed with sterile water before planting. During the early stage of cultivation (about 5 days), the seeds were placed at 28℃ in the dark. After emergence, they were transferred to normal conditions (light / dark = 14 h / 10 h, 28℃) and continued to be cultivated for 10 days. The growth of the seedlings after different treatments was photographed and recorded.
[0100] The results showed that there were no significant differences in the growth of all rice lines under the condition of no pesticide application. Further research revealed that under 20 nM acetochlor stress, the growth of all lines was inhibited to some extent, but the shoot length of the OsTIP2;2 mutant seedlings was significantly longer than that of the wild-type Zhonghua 11. Figure 6 A, 6B).
[0101] Example 8: Rice tolerance to acetochlor soil treatment experiment
[0102] Two days after rice seeds were sown, a 20 mg / L acetochlor spray solution was prepared using 0.1% Silwet L-77 and sprayed evenly onto the soil. The seeds were then placed in a greenhouse (light / dark = 14 h / 10 h, 28℃) and cultured for 15 days. The growth was recorded by taking photos.
[0103] The results are as follows Figure 7 As shown, the growth of wild-type rice was significantly inhibited after 20 days of acetochlor treatment, while the growth of the mutant was somewhat inhibited, but the aboveground growth was significantly better than that of the wild type. These results indicate that rice with the OsTIP2;2 gene mutation exhibits good tolerance to acetochlor soil treatment.
[0104] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of the rice OsTIP2;2 gene in improving rice resistance to acetochlor, characterized by: Improving rice resistance to acetochlor by knocking out the OsTIP2;2 gene; The amino acid sequence of the OsTIP2;2 gene is shown in SEQ ID NO:2, or it is the amino acid sequence of a derivative protein that still has the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the sequence shown in SEQ ID NO:
2.
2. The application of the rice OsTIP2;2 gene according to claim 1 in improving rice resistance to acetochlor, characterized in that: The nucleotide sequence of the OsTIP2;2 gene is shown in SEQ ID NO:
1.
3. The application of the rice OsTIP2;2 gene in the creation of amide-resistant germplasm resources through sexual or asexual reproduction, characterized by: The amino acid sequence of the OsTIP2;2 gene is shown in SEQ ID NO:2, or it is the amino acid sequence of a derivative protein that still has the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the sequence shown in SEQ ID NO:
2.
4. A method for cultivating OsTIP2;2 transgenic plants, characterized in that: By constructing an OsTIP2;2 gene knockout vector, the gene knockout vector was introduced into the target plant to obtain rice plants with the OsTIP2;2 gene knocked out.
5. A rice breeding material, characterized in that: The vacuolar membrane aquaporin gene OsTIP2;2 was knocked out using CRISPR / Cas9 gene editing technology.