Recombinase combination suitable for bacteroides, application and homologous recombination method
By constructing the BaSSAP9-BaSSB39 recombinase combination derived from Bacteroides and co-expressing it in the Escherichia coli-Bacteroides shuttle vector, the problem of low homologous recombination efficiency in Bacteroides genetic manipulation was solved, achieving efficient and precise gene editing.
Patent Information
- Application Number
- CN202610241732.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-28
- Publication Date
- 2026-05-12
AI Technical Summary
In existing technologies, the genetic manipulation system of Bacteroides has problems such as low homologous recombination efficiency and uncontrollable editing success rate. Especially in Bacteroides fragilis, the combination of exogenous recombinases faces problems such as difficulty in expression, low activity or poor interaction with host factors, resulting in limited improvement in recombination efficiency.
A combination of Bacteroides-derived SSAP-SSB proteins, specifically a combination of BaSSAP9 and BaSSB39, was constructed and co-expressed on an Escherichia coli-Bacteroides shuttle vector to improve the homologous recombination efficiency of Bacteroides.
It significantly improved the genome editing efficiency of Bacteroides fragilis from an almost undetectable level to 0.052%, promoting the research and application progress of genome engineering of this strain.
Smart Images

Figure CN122012630A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial genetic engineering technology, specifically relating to a recombinase combination, application, and homologous recombination method suitable for Bacteroides. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] With the deepening of microbiome research, gut symbiotic bacteria, especially Bacteroides ( Bacteroides Due to their central role in host metabolism, immune regulation, and gut microbiota homeostasis, symbiotic bacteria have become the most promising candidate strains for the development of "next-generation probiotics." However, transforming these symbiotic bacteria from basic research into safe and controllable engineered strains faces a fundamental challenge: the lack of efficient, precise, and species-appropriate genetic manipulation tools. This tool bottleneck severely restricts the targeted enhancement of their beneficial functions, the rational knockout of potential pathogenicity, and the systematic construction of complex synthetic biology pathways.
[0004] The genetic manipulation challenges of the Bacteroides genus are rooted in its unique physiological niche and genotype. The type species of this genus, *Bacteroides fragilis* (…), is a case in point. Bacteroides fragilis Taking [a specific example] as an example, it exhibits a typical "symbiotic-pathogenic" duality. Under intestinal homeostasis, it can exert immunomodulatory functions by synthesizing substances such as capsular polysaccharide A; however, once translocated to the extraintestinal environment, its complete oxidative stress resistance system and drug resistance gene pool mediated by mobile genetic elements can rapidly transform into pathogenic potential. This duality of biological characteristics means that genetic modification of it requires not only highly efficient editing tools but also high specificity and controllability to avoid introducing new biosafety risks due to off-target or unintended modifications.
[0005] Currently, genetic manipulation systems applied to Bacteroides mainly rely on their endogenous homologous recombination systems or site-specific integrases. These methods generally suffer from problems such as long homologous arm requirements, lengthy operation cycles, and limitations to single-site editing. Although the CRISPR-Cas system has been introduced to improve targeting, its editing efficiency in Bacteroides remains unsatisfactory, and there is a risk of accumulated off-target effects. It is even more inadequate in complex operations such as multi-gene collaborative editing or large-fragment DNA integration. Therefore, developing a platform technology that does not rely on long homologous arms, is not limited by specific restriction enzyme sites, and can simultaneously achieve precise editing of multiple gene sites is key to unlocking the application potential of Bacteroides synthetic biology.
[0006] Homologous recombination-mediated recombination technology offers an ideal solution to the aforementioned bottlenecks. The core of this technology is the use of phage-derived homologous recombinase systems, such as Redα / Redβ or RecE / RecT, to significantly improve the efficiency of short homologous arm (40-50 bp)-mediated recombination within cells. Its mechanism of action involves two steps: first, exonucleases (such as Redα or RecE) process the double-stranded DNA donor, producing a 3' overhanging single-stranded DNA; subsequently, single-stranded annealing proteins (SSAPs, such as Redβ or RecT) bind to and protect this single strand, promoting its pairing and recombination with chromosomal target sequences. Studies have shown that introducing single-stranded binding proteins (SSBs) during recombination can synergize with SSAPs to further stabilize the single-stranded DNA intermediate, preventing its degradation by host nucleases, thereby potentially increasing recombination efficiency by several orders of magnitude.
[0007] It is worth noting that the efficiency of recombinant engineering is highly dependent on the adaptability of SSAP and SSB proteins to host cells. Existing technologies have shown that by screening and optimizing specific protein combinations, highly efficient recombinant systems have been successfully established in *E. coli*, *Lactobacillus*, and even *Bifidobacterium*. However, these successful protocols derived from other bacterial genera cannot be directly transferred to *Bacteroides*. *Bacteroides* possesses a unique and complex cell envelope structure, significantly different DNA repair mechanisms, and an endogenous nuclease profile. This means that exogenous (even from closely related genera) SSAP-SSB protein combinations may face difficulties in expression, low activity, or poor interaction with host factors within the cell, resulting in limited improvements in recombinant efficiency. Summary of the Invention
[0008] To address the shortcomings of existing technologies, the present invention aims to provide a recombinase combination, application, and homologous recombination method suitable for Bacteroides. This invention addresses the problems of low homologous recombination efficiency and uncontrollable editing success rate in existing Bacteroides genome editing technologies by screening SSAP-SSB protein combinations from the Bacteroides genus to establish a recombinase system that can significantly improve genome editing efficiency. The homologous recombination method constructed in this invention can promote functional genomics research on Bacteroides and other related strains.
[0009] To achieve the above objectives, the technical solution of the present invention is as follows:
[0010] In a first aspect, the present invention provides a recombinant enzyme combination suitable for Bacteroides, comprising a single-chain annealing protein and a single-chain binding protein of Bacteroides.
[0011] In some embodiments of the present invention, the single-chain annealing protein includes BaSSAP9-BaSSAP. 22Any one of them, preferably any one of BaSSAP2, BaSSAP6 and BaSSAP9, and more preferably BaSSAP9.
[0012] In some embodiments of the present invention, the single-chain binding protein includes BaSSB1-BaSSB. 74 Any one of them, preferably BaSSB 39 .
[0013] In some embodiments of the present invention, the recombinase combination is BaSSAP9 and BaSSB. 39 The combination of .
[0014] In some embodiments of the present invention, the nucleotide sequence of BaSSAP9 is shown in SEQ ID NO.1, and the BaSSB 39 The nucleotide sequence is shown in SEQ ID NO.2.
[0015] A second aspect of the present invention provides the application of the recombinase combination described in the first aspect in Bacteroidetes homologous recombination.
[0016] In some embodiments of the present invention, the Bacteroides is Bacteroides fragilis.
[0017] A third aspect of the present invention provides a homologous recombination method suitable for Bacteroides, the homologous recombination method comprising using the recombinase combination described in the first aspect, thereby improving the homologous recombination efficiency.
[0018] In some embodiments of the present invention, the homologous recombination method includes: designing homologous arms, constructing the recombinase combination on an Escherichia coli-Bacteroides shuttle vector, and electroporating Bacteroides to obtain corresponding transformants.
[0019] In some embodiments of the present invention, the Bacteroides is Bacteroides fragilis.
[0020] In some embodiments of the present invention, the Escherichia coli-Bacteroides shuttle vector is the pNBU2-intN2-ermF plasmid, and the nucleotide sequence of the pNBU2-intN2-ermF plasmid is shown in SEQ ID NO.3.
[0021] In some embodiments of the present invention, the specific method for constructing the recombinase combination on the Escherichia coli-Bacteroides shuttle vector is as follows: BaSSAP and BaSSB are respectively constructed on P BfP1E6 The downstream of the promoter is used to co-express the gene, and then it is placed in the E. coli-Bacteroides shuttle vector to obtain pNBU2-intN2-intN2-ermF-P. BfP1E6 -BaSSAP-BaSSB.
[0022] A fourth aspect of the present invention provides the application of the recombinase combination described in the first aspect or the homologous recombination method described in the third aspect in Bacteroides gene editing.
[0023] In some embodiments of the present invention, the Bacteroides include Bacteroides fragilis; preferably Bacteroides fragilis.
[0024] The beneficial effects of this invention are as follows: This invention discloses for the first time a method for constructing and screening combinations of single-chain annealing proteins and single-chain binding proteins. This method co-constructs the single-chain annealing protein and the single-chain binding protein in an *E. coli*-*Bacteroides fragilis* shuttle expression vector, achieving co-expression in *Bacteroides fragilis*, thereby significantly improving the homologous recombination capacity of *Bacteroides fragilis*. Using the method of this invention, the homologous recombination efficiency of genome editing in *Bacteroides fragilis* is greatly improved, with its absolute genome editing efficiency increasing from almost undetectable levels to 0.052%, significantly advancing the research and application progress of genome engineering for this strain.
[0025] This invention systematically mines and screens SSAP and SSB protein combinations, BaSSAP9 and BaSSB, from within the vast germplasm resource bank of Bacteroides. 39 The combination of [various elements]. This is achieved by constructing an endogenously efficient BaSSAP9-BaSSB [model / system]. 39 The synergistic system overcomes the functional barriers of exogenous proteins, thereby tailoring a high-precision, high-efficiency, and low-off-target gene editing solution for Bacteroides, truly opening up the transformation pathway from "conditional symbiotic bacteria" to "safe engineered bacteria". Attached Figure Description
[0026] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0027] Figure 1 This document describes the construction and recombination function verification of the BaSSAP expression vector in Example 1 of the present invention. A is a schematic diagram of the BaSSAP expression vector. BaSSAP is constructed in promoter P... BfP1E6 Downstream of, placed in the Escherichia coli-Bacteroides shuttle vector (pNBU2-intN2-ermF-P) BfP1E6-BaSSAP). Transformants of *Bacteroides fragilis* expressing 22 BaSSAPs were obtained through conjugation transfer. B and C are schematic diagrams of *Bacteroides fragilis* genome editing. A 500 bp DNA sequence in the genome was replaced by a single-stranded DNA containing a tetracycline resistance gene introduced into *Bacteroides fragilis* via electroporation, and positive colonies were detected using two pairs of primers (P1 / P2 and P2 / P3). D shows the BaSSAP homologous recombination function test in *Bacteroides fragilis*. Experimental results showed that wild-type *Bacteroides fragilis* did not produce positive bacteria after homologous recombination; however, *Bacteroides fragilis* expressing BaSSAP2, BaSSAP6, and BaSSAP9 recombinases produced positive bacteria with successful genome editing. BaSSAP9 showed strong homologous recombination ability in *Bacteroides fragilis*, while BaSSAP2 and BaSSAP6 showed weaker homologous recombination ability.
[0028] Figure 2 This document describes the construction and recombination function testing of the BaSSAP9-BaSSB expression vector in Example 2 of the present invention. A is a schematic diagram of the BaSSAP9-BaSSB expression vector. BaSSAP9 and various BaSSBs were constructed on P... BfP1E6 Downstream of the promoter, it was co-expressed and placed in the E. coli-Bacteroides shuttle vector (pNBU2-intN2-ermF-P). BfP1E6 Transformants of *Bacteroides fragilis* expressing various BaSSAP9-BaSSB were obtained via conjugation transfer. B represents the effect of different BaSSBs on the homologous recombination function of BaSSAP9. Recombinases BaSSAP9 and BaSSB were constructed under the same promoter, and the recombination function of BaSSAP9 and various SSB combinations was examined. The results showed that BaSSAP9-BaSSB... 39 The combination exhibits a higher homologous recombination capacity, which is 7.6 times higher than that of BaSSAP9 alone. Detailed Implementation
[0029] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0030] Reagents and instruments: In this embodiment, the reagents are mainly molecular biology experimental reagents. The primers required for plasmid construction were synthesized by Shanghai Sangon Biotech Co., Ltd., the BaSSAP and BaSSB genes were synthesized by Shenzhen BGI Genomics Co., Ltd., the restriction endonuclease was from New England Biolabs, the DNA polymerase was ApexHF HS DNA Polymerase FS Master Mix from Accurate Biology, the antibiotics were purchased from Invitrogen, and the BHI culture was purchased from Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd. The electroporator used was an Eppendorf electroporator from Germany, along with a 1 mm electroporation cuvette of the same brand. The Bacteroides fragilis NCTC 9343 involved in this invention was purchased from the China Medical Microbiology Culture Collection Center.
[0031] Plasmid transformation methods for Bacteroides fragilis: E. coli S17-1 λ pir, transformed with the recombinase plasmid, was inoculated into 500 μL LB-amp medium and cultured overnight at 37°C. 1-5 single colonies of Bacteroides fragilis were inoculated into 500 μL BHI medium and cultured overnight at 35°C. 100 μL of E. coli S17-1 λ pir overnight medium was mixed with 100-500 μL of Bacteroides fragilis overnight medium, centrifuged at 12000 rpm for 30 s, and resuspended to a 50 μL volume. This was then spread onto antibiotic-free BHI plates and incubated aerobically for 20-24 h. All the grown bacterial colony was scraped off and resuspended in 1 mL LB medium. The bacterial suspension was serially diluted 10-fold, and 100 μL of each diluted LB medium was used as the final volume. -2 and 10 -1 The bacteria were spread onto BHI plates containing 8 μg / mL gentamicin and 20 μg / mL erythromycin, respectively, and incubated in an anaerobic incubator at 37°C until single colonies grew.
[0032] Electroporation method for recombinant substrates of Bacteroides fragilis: (1) Preparation of competent cells: Bacteroides fragilis was inoculated into 1.2 mL of BHI medium at a ratio of 1:12 and cultured under anaerobic conditions at 35°C until the logarithmic growth phase (OD). 600 (Approximately 0.3). The cells were then centrifuged at 4°C and 10,000 rpm for 1 min, and the supernatant was discarded. The cells were resuspended in 1 mL of pre-chilled ddH2O buffer and centrifuged again under the same conditions for 1 min, discarding the supernatant. This resuscitation and centrifugation process was repeated once. Finally, 90 µL of 10% glycerol was added to the EP tube.
[0033] (2) Electrotransformation of competent cells: A pair of primers modified by thiophosphorylation and phosphorylation respectively were used to amplify double-stranded DNA containing a 160 bp homologous arm and a tetracycline resistance selection marker by PCR. The resulting single-stranded DNA was then treated with λ exo exonuclease and recovered. Competent cells of Bacteroides fragilis expressing different BaSSAP or BaSSAP-BaSSB were prepared, and 500 ng of single-stranded DNA was added and mixed. The mixture was then transferred to an electroporation cuvette with a 1 mm gap and electrotransformed at 1350 V, 200 Ω, and 25 µF. After transformation, the cells were revived in antibiotic-free BHI medium and cultured at 35 °C for 10 h. The cells were then plated on agar plates containing 10 µg / mL tetracycline. The number of single colonies formed on the plates was counted and the positive rate was detected. The recombination efficiency of each BaSSAP was evaluated by comparing the number of successfully edited colonies under different conditions.
[0034] Method for calculating absolute genome editing efficiency: After introducing the recombinant substrate into Bacteroides and completing resuscitation, the bacterial culture is subjected to 10... 5 The sample was diluted several times and spread onto antibiotic-free BHI agar plates. The total number of viable bacteria was calculated based on the number of colonies formed on the plates. Simultaneously, approximately half of the *Bacteroides fragilis* suspension from the same centrifuge tube was spread onto an agar plate containing 10 µg / mL tetracycline to count the total number of positive colonies. The absolute genome editing efficiency was calculated using the following formula: Absolute editing efficiency = (Number of positive colonies / Total number of viable bacteria) × 100%.
[0035] Positive colonies detected by bacterial culture PCR: Detection primer P1(F): TTATGCAGTGAGCGCAGATA (SEQ ID NO.4) Detection primer P2(R): CCGCAAGGAATGGTGCATGC (SEQ ID NO.5) Detection primer P3(F): CGGAATCTTGCACGCCCTCG (SEQ ID NO.6) Detection primer P4(R): AATATACCATCCATTTCCCC (SEQ ID NO.7) Table 1 PCR reaction system PCR reaction system 25 µL Template: Bacteroides fragilis bacterial culture 0.5 µL Primer F 0.5 µL Primer R 0.5 µL ApexHF HS DNA Polymerase FS Master Mix 12.5 µL <![CDATA[ddH2O]]> 11.0 µL Table 2 PCR reaction procedure
[0036] Example 1: Screening for BaSSAP, which promotes homologous recombination, in Bacteroides fragilis.
[0037] (1) Obtain Bacteroides fragilis transformants expressing different BaSSAP values Donor bacterial preparation: The plasmid carrying the recombinase expression plasmid (pNBU2-intN2-ermF-P) BfP1E6 -BaSSAP) E. coli S17-1 λ pir was inoculated from a single colony into 500 μL LB-amp and cultured overnight at 37°C.
[0038] Recipient bacterial preparation: Pick 1-5 single colonies of Bacteroides fragilis and inoculate into 500 μL BHI, and incubate overnight at 35°C.
[0039] Mixing and plating: Mix 100 μL of overnight donor bacterial culture with 100-500 μL of overnight recipient bacterial culture, centrifuge at 12000 rpm for 30 s, resuspend the precipitate to 50 μL, spread it on antibiotic-free BHI plates, and incubate in an aerobic environment for 20-24 h to form bacterial growth.
[0040] Transformant screening: Scrape the bacterial growth and suspend it in 1 mL LB, perform 10-fold serial dilutions, and take 100 μL of each 10-fold serial dilution. -2 and 10 -1 Spread the samples onto BHI plates containing 8 μg / mL gentamicin and 20 μg / mL erythromycin, and incubate them in an anaerobic incubator at 35°C until single colonies grow, thus obtaining Bacteroides fragilis transformants expressing the corresponding BaSSAP.
[0041] Note: This step corresponds to the route for obtaining transformants expressing 22 BaSSAP species via conjugation transfer. Figure 1 (Figure A in the middle)
[0042] (2) Recombinant substrate electroconversion editing of the above transformants Competent cell preparation: The Bacteroides fragilis to be edited (wild-type or BaSSAP transformant) was inoculated into 1.2 mL of BHI at a ratio of 1:12 and cultured anaerobically at 35°C until the logarithmic growth phase (OD). 600 ≈0.3. Centrifuge at 10000 rpm for 1 min at 4℃, and discard the supernatant. Resuspend the bacterial cells in 1 mL of ddH2O pre-cooled in an ice bath, centrifuge for 1 min under the same conditions, and discard the supernatant; repeat this resuspension-centrifugation once (for a total of 2 washes). Finally, add 90 μL of 10% glycerol to the EP tube to obtain the competent bacterial suspension for electroporation.
[0043] Preparation of recombinant substrate ssDNA: Double-stranded DNA was obtained by PCR amplification using a pair of thiophosphorylation / phosphorylation modified primers, with a structure of 160 bp homologous arm + tetracycline selection marker. The PCR product was digested with λ exo exonuclease to obtain and recover the single-stranded DNA (ssDNA) recombinant substrate.
[0044] Electroporation and recovery: Take the above competent bacteria, add 500 ng ssDNA and mix well, then transfer to a 1 mm gap electroporation cuvette. Immediately after electroporation, add antibiotic-free BHI for recovery, and incubate at 35℃ for 10 h. Electroporation conditions are 1350 V, 200 Ω, and 25 µF. After recovery, plate onto agar plates containing 10 μg / mL tetracycline and culture to obtain suspected positive colonies.
[0045] This editing process corresponds to Figure 1 Figures B and C show the results. ssDNA carrying the tetracycline resistance gene was introduced via electroporation, replacing a 500 bp fragment on the genome, and the result was detected using two pairs of primers.
[0046] (3) Positive screening, absolute editing efficiency calculation and PCR identification Absolute editing efficiency: After completing the revival, the bacterial solution 10 5 Dilute the bacterial culture several times and spread it onto antibiotic-free BHI plates. Calculate the total viable count based on the number of colonies. Simultaneously, take approximately half of the bacterial culture from the same centrifuge tube and spread it onto a plate containing 10 μg / mL tetracycline. The colony count is used as the total positive bacterial count. Absolute genome editing efficiency (%) = Total positive bacterial count / Total viable bacterial count × 100%.
[0047] Colony PCR identification: Detection primers: P1, P2, P3, P4 (two pairs of primers, P1 / P2 and P2 / P3, are used for positive detection). PCR system (25 μL): 0.5 μL bacterial template, 0.5 μL each of F / R primers, 12.5 μL ApexHF HS Master Mix, 11.0 μL ddH2O. PCR program: 94℃ for 10 min; followed by 35 cycles (98℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s / kb); final incubation at 72℃ for 10 min, followed by 12℃.
[0048] Under the same editing substrate and electroporation / screening conditions, genome editing was detected in wild-type and BaSSAP transformants. No successfully edited colonies were observed in wild-type transformants; however, positive colonies were obtained in transformants expressing BaSSAP2, BaSSAP6, and BaSSAP9. BaSSAP9 exhibited the strongest homologous recombination ability and the highest genome editing efficiency, reaching 0.0068%. For detailed comparison results, see [link to comparison]. Figure 1 Diagram D in the middle.
[0049] Example 2: Screening for the BaSSAP9-BaSSB combination of Bacteroides fragilis with high efficiency homologous recombination.
[0050] (1) Construct and obtain Bacteroides fragilis transformation libraries expressing BaSSAP9-different BaSSBs Based on the potent BaSSAP9 screened in Example 1, BaSSAP9 was combined with 74 different BaSSBs and constructed onto the same shuttle vector (pNBU2-intN2-ermF), and placed in P BfP1E6 Co-expression under the promoter forms pNBU2-intN2-ermF-P BfP1E6 -BaSSAP9-BaSSB series vectors ( Figure 2 (Figure A). Using the same conjugation transfer procedure as in Example 1 (S17-1 λ pir donor + Bacteroides fragilis recipient, mixed, antibiotic-free BHI for 20-24 h, followed by anaerobic screening with gentamicin 8 μg / mL + erythromycin 20 μg / mL), Bacteroides fragilis transformants expressing different BaSSAP9-BaSSB were obtained one by one.
[0051] (2) Evaluation of editing of 74 BaSSAP9-BaSSB transformants at the same site / on the same substrate. The process and conditions were the same as in Example 1. After performing the same process editing on 74 BaSSAP9-BaSSB combination transformants, the promoting effect of different BaSSBs on BaSSAP9 varied significantly; among them, BaSSAP9-BaSSB... 39 The combination exhibited the highest homologous recombination capability, with a recombination / editing efficiency of 0.052%, approximately 7.6 times higher than BaSSAP9 alone. See the detailed comparison below. Figure 2 Figure B in the middle.
[0052] In this embodiment, BaSSAP9, a gene for efficient homologous recombination in Bacteroides fragilis, was successfully screened. This was achieved by combining BaSSAP9 with BaSSB... 39 Co-expression was used to detect homologous recombination function, which successfully improved the homologous recombination ability of BaSSAP9 in Bacteroides fragilis.
[0053] SEQ ID NO.1 nucleotide sequence: ATGGGAAATAATTTACCAGCAAAAAAGGGAATCACAGAGTTTTTAAATATGGAATCAGTGAAAAGCCAGGTAAATCAGGCGGTTGGGAAGAATGCCATGAGGTTTATGTCATCGGTCATATCGGCGGTAACGGTCAATCCGGCGCTGCAGGAATGCACAAACCCTTCTATCCTGTCGGCCGCACTTCTGGGGGAGTCTTTAAATCTCTCCCCATCACCGCAGCTAGGGCAGTATTACATGGTGCCGTTTGAGGATAAAGCAAAAGGCAAGGTTGCGCAGTTTATCATGGGGTATAAGGGATATATACAATTGGCGATCCGCAGCGGCCAGTATAAAAAGTTGAATGTGTTTGCAATTAAAGAAGGGGAATTAGTACGGTTTGACCCTCTGACGGAGGAAATAGAAGTCCGGCTGATTGAAGATGAGGAGCAGAGGGAGAACGCCAAGACAATCGGCTACTACGCCATGTTTGAGTATGTGAACGGCTTTAAAAAGGCTATGTATTGGAGTAAGGCAAAGATGTTATCCCATGCAGACCGGTACAGTGCGGCGTTCTCGAAAGACGGCTATGAGTATACCATCAAGAGCGGCAGGAACAAGGGGGAGAAGAGAAAGAAAGTTTCCTTTGCGGATTTCGAAGCCGGTAATTACCCGAAAGACGATGAATGGATGTATTCCTCTTTCTGGTATAAGGATTTTGACGGCATGGCATACAAGACCATGCTCCGACAACTTATTAGTAAGTGGGGGATCATGAGCATTGAAATGCAGCAGGCTTATGTGAATGATTCTGCGGTGGCTTATGAGGACGGAATAAGATACCCAGATGAACAGCCGGATGAGCCGGAAGATGTCATTATTGATACAACCGTTTCCGAGGGTGCAATGGACGCATTCGCAGGAGTGGCGCAGGACGGGCATCAGGAGTTGAATCTTGAGGGTGGTGCTGATGGAACTGACAGAAAGTAA SEQ ID NO.2 nucleotide sequence: ATGAGTGTAAACAAATGTATTTTTATCGGCAACATGGGACGTGATGCCGAGGTCCGTACCACTGAAACCGGCATCAAAGTAGCCCAATTTTCTATTGCATGTACAGAGCGTGCTTATACAAACAAAGCCGGTCAAACGATTCCGGAGAGAACCGAATGGATACCCGTCGTAGCCTGGAGGGGATTGGCGGAAACCATTGAGAAGTACACCCACAAAGGAAGCAAACTGTATATTGAAGGCAGATTCACAACCCGGAAGTATGAAACAAATGACGGCCAGAAACGAACCGTTTCTGAAATCGTAGCCGAAAGTATTGAAATGCTCGATCCCAAGCGGGATGCTCCCCCACTCCCTCCGGAACCCGAGCAGAAATTGAGTTATAATCCATAA SEQ ID NO.3 nucleotide sequence: The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A recombinase combination suitable for Bacteroides, characterized in that, This includes Bacteroides single-chain annealing proteins and single-chain binding proteins.
2. The recombinase combination as described in claim 1, characterized in that, The single-chain annealing protein includes BaSSAP9-BaSSAP 22 Any one of them, preferably any one of BaSSAP2, BaSSAP6 and BaSSAP9, and more preferably BaSSAP9.
3. The recombinase combination as described in claim 1, characterized in that, The single-chain binding protein includes BaSSB1-BaSSB 74 Any one of them, preferably BaSSB 39 .
4. The recombinase combination as described in claim 1, characterized in that, The recombinase combination is BaSSAP9 and BaSSB. 39 The combination; Preferably, the nucleotide sequence of BaSSAP9 is as shown in SEQ ID NO.1, and the BaSSB... 39 The nucleotide sequence is shown in SEQ ID NO.
2.
5. The application of the recombinase combination according to any one of claims 1-4 in Bacteroidetes homologous recombination; Preferably, the Bacteroides is Bacteroides fragilis.
6. A method for homologous recombination suitable for Bacteroides, characterized in that, The homologous recombination method includes using the recombinase combination according to any one of claims 1-4, thereby improving the homologous recombination efficiency.
7. The homologous recombination method as described in claim 6, characterized in that, The homologous recombination method includes: designing homologous arms, constructing the recombinase combination on an Escherichia coli-Bacteroides shuttle vector, and electroporating Bacteroides to obtain the corresponding transformants; Preferably, the Bacteroides is Bacteroides fragilis.
8. The homologous recombination method as described in claim 7, characterized in that, The Escherichia coli-Bacteroides shuttle vector is the pNBU2-intN2-ermF plasmid, and the nucleotide sequence of the pNBU2-intN2-ermF plasmid is shown in SEQ ID NO.
3.
9. The homologous recombination method as described in claim 8, characterized in that, The specific method for constructing the recombinase combination on the Escherichia coli-Bacteroides shuttle vector is as follows: BaSSAP and BaSSB are constructed separately on P... BfP1E6 The downstream of the promoter is used to co-express the gene, and then it is placed in the E. coli-Bacteroides shuttle vector to obtain pNBU2-intN2-intN2-ermF-P. BfP1E6 -BaSSAP-BaSSB.
10. The application of the recombinase combination according to any one of claims 1-4 or the homologous recombination method according to any one of claims 6-9 in Bacteroides gene editing; further, the Bacteroides includes Bacteroides fragilis; preferably Bacteroides fragilis.