Primer group, kit and method for detecting MNP marker sites of schistosome and oncomelania in water environment and application
By combining primer sets and next-generation high-throughput sequencing technology, efficient and sensitive detection of schistosomiasis and Oncomelania snails in the aquatic environment has been achieved, solving the problems of high detection cost and long time consumption in existing technologies, and supporting the precise prevention and control of schistosomiasis.
Patent Information
- Application Number
- CN202610401437.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-30
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies for detecting schistosomiasis and Oncomelania snails in aquatic environments suffer from high detection costs, long processing times, cumbersome operations, and a high risk of missed detections, making it difficult to meet the needs of high-throughput and high-sensitivity comprehensive ecological monitoring.
Multiplex PCR amplification using primer sets, combined with next-generation high-throughput sequencing technology, was employed to detect MNP marker sites of Schistosoma and Oncomelania snail in the aquatic environment. High-efficiency and sensitive detection was achieved through the combination of MNP-1 to MNP-14 marker sites.
It enables comprehensive, efficient, sensitive and accurate detection of 14 MNP marker sites in a single reaction system, supports the identification of schistosomiasis and Oncomelania hupensis, and is suitable for tracking the prevalent species of pathogens in water bodies in epidemic foci and assessing the risk of transmission.
Smart Images

Figure QLYQS_1
Abstract
Description
Technical Field
[0001] This disclosure relates to the field of molecular biological diagnostics and environmental pathogen monitoring technology, and in particular to a primer set, kit, method and application for detecting MNP marker sites of Schistosoma and Oncomelania hupensis in aquatic environments. Background Technology
[0002] Schistosomiasis is a significant zoonotic parasitic disease, affecting hundreds of millions of people worldwide. It is one of the six major tropical diseases identified by the WHO and is also a key parasitic disease for prevention and control in my country. Its transmission requires Oncomelania snails as intermediate hosts. When schistosomiasis eggs enter the water, they develop into miracidia, which infect the snails. The miracidia then develop into cercariae within the snails and are released into the water, creating "infected water." Effective monitoring of the presence of schistosomiasis cercariae in water bodies within epidemic areas, as well as the distribution and infection rate of Oncomelania snails in the environment, is crucial for assessing transmission risks, issuing early warnings of outbreaks, and implementing precise control measures. Traditional schistosomiasis monitoring relies on disease detection and manual snail inspection techniques, which suffer from low sensitivity, poor efficiency, and environmental pollution. Furthermore, the distribution area of Oncomelania snails, the sole intermediate host of schistosomiasis, remains large, making monitoring techniques time-consuming and labor-intensive.
[0003] Molecular biology methods, especially those based on polymerase chain reaction (PCR) technology, have improved the sensitivity and specificity of detection. However, conventional PCR is often designed for a single target. To simultaneously detect schistosomes and snails and their infection status, multiple independent PCR reactions are required. This makes the detection cost high, time-consuming, and cumbersome. Furthermore, it is prone to false negatives due to sample consumption and low target content in environmental samples. Therefore, single-target detection cannot meet the needs of comprehensive ecological monitoring and accurate risk assessment.
[0004] Therefore, there is an urgent need to develop a method that can detect schistosomiasis and Oncomelania snails in aquatic environmental samples in a single, high-throughput, and highly sensitive manner.
[0005] Public content
[0006] To address the problems of existing technologies, this disclosure provides a primer set, kit, method, and application for detecting MNP marker sites in Schistosoma and Oncomelania hupensis in aquatic environments. The technical solution is as follows:
[0007] On one hand, this disclosure provides a primer set for detecting MNP marker sites of Schistosoma and Oncomelania hupensis in an aquatic environment. The primer set includes at least one of primer pairs 1 to 14, each primer pair including a forward primer and a reverse primer. The forward primer of the first primer pair, the reverse primer of the first primer pair, the forward primer of the 14th primer pair, and the reverse primer of the 14th primer pair are shown in sequence as SEQ ID NO: 1 to SEQ ID NO: 28 in the sequence listing.
[0008] On the other hand, this disclosure provides a kit for detecting MNP marker sites of Schistosoma and Oncomelania hupensis in an aquatic environment, the kit comprising the aforementioned primer set.
[0009] Furthermore, this disclosure provides a method for detecting MNP marker sites of Schistosoma and Oncomelania hupensis in an aquatic environment, the method comprising:
[0010] The above primer set was used to amplify the test sample to obtain the amplification product;
[0011] The amplified products were subjected to next-generation high-throughput sequencing to obtain sequencing data;
[0012] The sequencing data were aligned to the reference genomes of Schistosoma and Oncomelania hupensis, respectively, to obtain the sequencing results of the sample to be tested;
[0013] If the sequencing results are identical to the sequences of the reference genomes of the schistosome and the snail, then the sample to be tested is determined to contain the schistosome and the snail.
[0014] On one hand, this disclosure provides an application of a combination of MNP marker sites for detecting schistosomiasis and Oncomelania snails in an aquatic environment. The application is characterized by using the combination of MNP marker sites to detect schistosomiasis and Oncomelania snails in an aquatic environment. The combination of MNP marker sites includes MNP-1 to MNP-14, and the positions of MNP-1 to MNP-14 on the reference sequence are shown in the table below.
[0015] MNP Marker Number Reference sequence MNP starting point MNP endpoint MNP-1 GCA_036898135.1 19936 20024 MNP-2 GCA_036898135.1 3712 3807 MNP-3 GCA_036898135.1 10574 10673 MNP-4 GCA_036898135.1 8564 8685 MNP-5 GCA_036898135.1 9463 9585 MNP-6 GCA_036898135.1 4827 4946 MNP-7 GCA_036898135.1 8382 8496 MNP-8 GCA_025215515.1 102672 102786 MNP-9 GCA_025215515.1 44042 44178 MNP-10 GCA_025215515.1 138103 138239 MNP-11 GCA_025215515.1 130466 130587 MNP-12 GCA_025215515.1 139222 139362 MNP-13 GCA_025215515.1 22191 22336 MNP-14 GCA_025215515.1 7899810 7899942
[0016] Specifically, the application includes: combining the MNP marker sites for tracking and geographical distribution surveys of pathogens circulating in water bodies in schistosomiasis endemic areas.
[0017] Specifically, the application includes combining the MNP marker sites to assess the risk of schistosomiasis transmission in different water bodies.
[0018] Specifically, the schistosomiasis is Schistosoma japonicum Katsurada.
[0019] Specifically, the snail in question is Oncomelania hupensis.
[0020] The beneficial effects of the technical solution provided in this disclosure are as follows: This disclosure provides a primer set, kit, method, and application for detecting MNP marker sites in Schistosoma japonicum and Oncomelania hupehensis in aquatic environments. This MNP marker site combination is species-specific, screened on the genomes of Schistosoma japonicum and Oncomelania hupehensis. MNP-1 to MNP-7 are derived from Schistosoma japonicum, and MNP-8 to MNP-14 are derived from Oncomelania hupehensis. This MNP marker site combination contains multiple nucleotide polymorphism marker sites within the species, exhibiting high polymorphism and strong species differentiation ability. The primer set provided in this disclosure has amplification compatibility and can be amplified in a single reaction system using ultramultiplex PCR technology, achieving amplification of 14 MNP marker sites within one reaction system. Combined with next-generation sequencing platform for sequence analysis of the amplified products, a single reaction can identify Schistosoma japonicum and Oncomelania hupehensis, providing comprehensive, efficient, sensitive, and accurate detection. The kit includes the above primer set; therefore, the kit also has comprehensive, efficient, sensitive, and accurate detection capabilities. Detailed Implementation
[0021] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below.
[0022] Example 1
[0023] This embodiment provides a primer set for detecting MNP marker sites of Schistosoma and Oncomelania hupensis in an aquatic environment. The primer set includes at least one of primer pairs 1 through 14, each primer pair comprising a forward primer and a reverse primer. The forward primer of primer pair 1, the reverse primer of primer pair 1 through the forward primer of primer pair 14, and the reverse primer of primer pair 14 are shown sequentially as SEQ ID NO: 1 to SEQ ID NO: 28 in the sequence listing. Specific sequences are shown in Table 1.
[0024] Table 1 shows the primer sequence and the location of the corresponding MNP marker sites.
[0025] MNP marker site numbering upstream primer Downstream primer Reference sequence starting point end MNP-1 GGCAAAGAGTGGTGTTGAACAAA CAGTAGCAATGCGGTTGTCG GCA_036898135.1 19936 20024 MNP-2 CCTAATTGTTCCAGGAAGCCCTA GCTCTGCCGATATTGTTAACTAAGG GCA_036898135.1 3712 3807 MNP-3 TATACTGGCTTCTTTATCCGCGC AAAGAAGAAGGAGGTGGTGAAGG GCA_036898135.1 10574 10673 MNP-4 TGGTGATCCAAAGGTTCGTCC ACAGTGTTCGTTCTGTGAGTCTC GCA_036898135.1 8564 8685 MNP-5 CGGCAGTCCTATGGAAAGAAGAA TCGAGCCGCTCATCTTCTTT GCA_036898135.1 9463 9585 MNP-6 AAGAGGGGTGATGGGTAACAAAA ACAAACCCAGACGACAAAATTGG GCA_036898135.1 4827 4946 MNP-7 ATCGCCATTTATGCTTAACCTGC CAACACGGCAACAAATGTTTCTG GCA_036898135.1 8382 8496 MNP-8 CTTGCTAAAACACGCTAACCAGT GCGGCTTTCAAAGAAACTCATCA GCA_025215515.1 102672 102786 MNP-9 TTAGAGGCCTAACTAGAGCTCGT TGTAGGACGCCTAAATGTGTGTT GCA_025215515.1 44042 44178 MNP-10 CCGTGGAGATATGTTTGGACCTA GCACAGTCCTGAAGTTCCATTTC GCA_025215515.1 138103 138239 MNP-11 CGTCGAATTCCGGAAATGTTACC ATTCAAGCTGCCAGATTTGATCG GCA_025215515.1 130466 130587 MNP-12 ACCTCAATTCACTACCACTGTCT AAGTCGGTGAATCAACCAGACAA GCA_025215515.1 139222 139362 MNP-13 CAACTTGTCTATTCATCAATGCACC TGGTACAGGTCAGGAATGAACAA GCA_025215515.1 22191 22336 MNP-14 GGCACCAAAGTTAGTGATAGGGA AGCTGATCGGGCCTTATGTATAC GCA_025215515.1 7899810 7899942
[0026] Example 2
[0027] This embodiment provides a kit for detecting MNP marker sites of Schistosoma and Oncomelania hupensis in an aquatic environment. The kit includes the primer set provided in Example 1.
[0028] Example 3
[0029] This embodiment provides an application of a combination of MNP marker sites for detecting schistosomiasis and Oncomelania snails in an aquatic environment. The application includes using the combination of MNP marker sites to detect schistosomiasis and Oncomelania snails in an aquatic environment. The combination of MNP marker sites includes MNP-1 to MNP-14, and the positions of MNP-1 to MNP-14 on the reference sequence are shown in Table 1.
[0030] Specifically, the application also includes: combining MNP marker sites for tracking and geographic distribution surveys of schistosomiasis pathogens in aquatic environments.
[0031] Specifically, the application also includes combining MNP marker sites to assess the risk of schistosomiasis transmission in different water bodies.
[0032] Specifically, the schistosomiasis is Schistosoma japonicum Katsurada.
[0033] Specifically, the snail is Oncomelania hupensis.
[0034] In this embodiment, primer sets were used to detect 12 samples of 3 types. The 12 samples included 3 negative Oncomelania snail tissue samples (not infected with Schistosoma), 3 positive Oncomelania snail tissue samples (infected with Schistosoma), and 6 positive water samples (from water used to feed positive Oncomelania snails in the laboratory). Specific information is shown in Table 2.
[0035] Table 2 shows the information of the samples to be tested.
[0036] Sample number DNA concentration (ng / μL) Sample Description DL1 72.2 Negative Oncomelania snail tissue DNA DL2 140 Negative Oncomelania snail tissue DNA DL3 73 Negative Oncomelania snail tissue DNA DLXXC1 55.4 DNA from positive Oncomelania snail tissue DLXXC2 79.4 DNA from positive Oncomelania snail tissue DLXXC3 68.4 DNA from positive Oncomelania snail tissue W1 0.139 Positive water sample DNA W2 0.32 Positive water sample DNA W3 0.298 Positive water sample DNA W4 0.252 Positive water sample DNA W5 0.178 Positive water sample DNA W6 0.223 Positive water sample DNA
[0037] Multiple MNP marker sites were amplified by multiplex PCR to obtain multiplex PCR amplification products.
[0038] Specifically, 4 μL of the primer set provided in this embodiment of the invention, 200 ng of DNA from the sample (volume ≤ 16 μL), and 10 μL of GenoPlexs 3×T Master Mix (manufacturer: Shijiazhuang Borui Biotechnology Co., Ltd.) were added to the amplification reaction of each sample. If the volume was less than 30 μL, water was added to bring the volume to 30 μL, and the mixture was shaken to obtain a homogenate. This mixture was then used for multiplex PCR amplification. The multiplex PCR amplification program was: 95℃ for 3 min; (95℃ for 20 sec, 60℃ for 4 min) × 17 cycles; 72℃ for 4 min.
[0039] Then, the multiplex PCR amplification products after the reaction were purified using DNA purification magnetic beads (manufacturer: Nanjing Novizan Biotechnology Co., Ltd.), following the instructions in the product manual.
[0040] Constructing high-throughput sequencing libraries
[0041] Specifically, the following reaction reagents were added to the purified multiplex PCR amplification product: 10 μL GenoPlexs 3×T Master Mix, 2 μL 5 μM Illumina sequencing adapter primers, and 16 μL water. The PCR reaction was performed according to the following program: 95℃ for 3 min; (95℃ for 15 s, 58℃ for 15 s, 70℃ for 30 s) × 8 cycles; a final extension at 72℃ for 5 min; and the reaction was terminated at 16℃.
[0042] After the reaction, a high-throughput sequencing library of the sample to be tested was obtained. The high-throughput sequencing library was then purified using DNA purification magnetic beads to obtain a purified high-throughput sequencing library. The purification method was performed according to the product's instructions.
[0043] Library sequencing
[0044] The high-throughput sequencing library was sequenced using an Illumina NextSeq 550 sequencer to obtain sequencing data of the sample to be tested. For detailed sequencing steps, please refer to the instruction manual of the sequencer. After sequencing, the sequencing data was copied to an external hard drive.
[0045] Sequencing data analysis
[0046] Using Bowtie2 (version 2.1.0) software, the sequencing data of the samples to be tested were aligned to the reference genomes of Schistosoma japonicum and Oncomelania hubeiensis, respectively, to obtain the DNA sequence of the MNP marker site combination for each sample. The alignment results were saved in SAM (The Sequence Alignment / Map format).
[0047] The kit provided in Example 2 was used to test 12 samples. The detection method of MNP marker site combination in this example is as follows: the samples to be tested were amplified by multiplex PCR using the primer set provided in Example 1 to obtain multiplex amplification products, which were used to construct a library; the library was sequenced to obtain sequencing data.
[0048] (1) MNP marker detection rate
[0049] Multiplex PCR amplification and sequencing library construction were performed using the kit provided in Example 2 of this invention. Multiplex amplification, next-generation high-throughput sequencing, and data analysis were conducted on DNA samples from three negative Oncomelania hupensis tissue samples (uninfected with Schistosoma japonicum) and three positive Oncomelania hupensis tissue samples. Oncomelania hupensis markers were detected in both the three negative and three positive samples, with seven MNP markers detected in each sample, achieving a detection rate of 100%. Schistosoma japonicum markers were detected only in the three positive samples, with seven MNP marker sites detected in each sample, achieving a detection rate of 100%. The distribution of MNP marker sites detected in Schistosoma japonicum and Oncomelania hupehensis is shown in Table 3.
[0050] Table 3 shows the number and detection rate of MNP marker sites in Schistosoma japonicum and Oncomelania hubeiensis.
[0051] Sample number Number of Schistosomiasis markers detected Number of Oncomelania markers detected Schistosomiasis marker detection rate Oncomelania marker detection rate DL1 0 7 0 100% DL2 0 7 0 100% DL3 0 7 0 100% DLXXC1 7 7 100% 100% DLXXC2 7 7 100% 100% DLXXC3 7 7 100% 100%
[0052] Therefore, the primer set and kit provided in this embodiment can accurately detect the MNP marker sites of Schistosoma japonicum and Oncomelania hubeiensis.
[0053] (2) Accuracy analysis of MNP marker site combinations
[0054] To verify the accuracy of MNP markers in *Schistosoma japonicum* and *Oncomelania hupensis*, reproducibility tests were performed on DNA samples from three positive *Oncomelania hupensis* tissues (two independent experiments conducted by different personnel, using different batches of reagents, and different instruments). The data from the two experiments for each sample were compared and analyzed, and the accuracy of the typing was calculated using the formula: accuracy = 1 - (1 - precision) / 2. Precision refers to the proportion of marker sites that showed consistent typing results in both experiments. The statistical results are shown in Table 2.
[0055] Table 4 shows the accuracy assessment information for MNP marker sites in the three samples.
[0056] Sample number Repeat 1 Repeat 2 Number of common sites Number of repeatable sites Recurrence rate r Accuracy a DLXXC1 DLXXC1-1 DLXXC1-2 14 14 100% 100% DLXXC2 DLXXC2-1 DLXXC2-2 14 14 100% 100% DLXXC3 DLXXC3-1 DLXXC3-2 14 14 100% 100%
[0057] As shown in Table 4, there were 14 common sites and 14 reproducible sites in the pairwise replicates of the three samples, with a reproducibility rate of 100% and an accuracy rate of 100%. The high labeling accuracy indicates that DNA fingerprint data collected from different laboratories or at different times can be accurately compared with each other, providing technical support for the sharing of DNA fingerprint data.
[0058] (3) Detection rate of MNP marker sites in water environment samples
[0059] To examine the detection rate of MNP marker sites of Schistosoma japonicum and Oncomelania hupehensis in aquatic environmental samples, multiplex amplification, next-generation high-throughput sequencing, and data analysis were performed on DNA samples from six positive water samples. Oncomelania hupehensis and Schistosoma markers were detected in the DNA samples of the positive water samples. The number of detection sites and detection rate of MNP markers of Schistosoma japonicum and Oncomelania hupehensis are shown in Table 5.
[0060] Table 5 shows the number of marker detection sites in the DNA of positive water samples.
[0061] Sample number Number of Schistosomiasis markers detected Number of Oncomelania markers detected Schistosomiasis marker detection rate Oncomelania marker detection rate W1 2 2 29% 29% W2 3 2 43% 29% W3 3 3 43% 43% W4 3 3 43% 43% W5 2 2 29% 29% W6 2 2 29% 29%
[0062] Therefore, the primer set and kit provided in this embodiment can detect the MNP marker sites of Schistosoma japonicum and Oncomelania hubeiensis in positive water samples.
[0063] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.
Claims
1. A primer set for detecting MNP marker sites of Schistosoma and Oncomelania hupensis in aquatic environments, characterized in that, The primer set includes at least one of primer pairs 1 to 14, each primer pair including a forward primer and a reverse primer, the forward primer of the first primer pair, the reverse primer of the first primer pair to the forward primer of the 14th primer pair and the reverse primer of the 14th primer pair being shown in sequence as SEQ ID NO: 1 to SEQ ID NO: 28 in the sequence listing.
2. A kit for detecting MNP marker sites of Schistosoma and Oncomelania hupensis in an aquatic environment, characterized in that, The kit includes the primer set as described in claim 1.
3. A method for detecting MNP marker sites of Schistosoma and Oncomelania hupensis in an aquatic environment, characterized in that, The method includes: The primer set as described in claim 1 is used to amplify the sample to be tested, and the amplification product is obtained; The amplified products were subjected to next-generation high-throughput sequencing to obtain sequencing data; The sequencing data were aligned to the reference genomes of Schistosoma and Oncomelania hupensis, respectively, to obtain the sequencing results of the sample to be tested; If the sequencing results are identical to the sequences of the reference genomes of the schistosome and the snail, then the sample to be tested is determined to contain the schistosome and the snail.
4. An application for detecting combinations of MNP marker sites of Schistosoma and Oncomelania hupensis in an aquatic environment, characterized in that, The application includes using the MNP marker site combination to detect schistosomiasis and Oncomelania hupensis in the aquatic environment. The MNP marker site combination includes MNP-1 to MNP-14, and the positions of MNP-1 to MNP-14 on the reference sequence are shown in the table below. 。 5. The application according to claim 4, characterized in that, The applications include: combining the MNP marker sites for tracking the prevalent species and geographical distribution of schistosomiasis pathogens in aquatic environments.
6. The application according to claim 4, characterized in that, The applications include combining the MNP marker sites to assess the risk of schistosomiasis transmission in different water bodies.
7. The application according to claim 4, characterized in that, The schistosomiasis mentioned is Schistosoma japonicum.
8. The application according to claim 4, characterized in that, The snail in question is the Hubei snail.