Application of Panax notoginseng saponin Ft1 as a plant immune inducer in the prevention and control of bacterial plant diseases

Panax notoginseng saponin Ft1 enhances plant resistance to bacterial diseases by activating plant immune pathways, solving the problems of pathogen resistance and environmental pollution associated with chemical pesticides, and achieving low-pollution and high-efficiency plant disease control.

CN122074504APending Publication Date: 2026-05-26NANJING FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NANJING FORESTRY UNIV
Filing Date
2026-04-14
Publication Date
2026-05-26

Smart Images

  • Figure CN122074504A_ABST
    Figure CN122074504A_ABST
Patent Text Reader

Abstract

This invention discloses the application of Panax notoginseng saponin Ft1 as a plant immune inducer in the control of bacterial plant diseases, belonging to the field of biopesticide technology. This invention is the first to discover that Panax notoginseng saponin Ft1 can effectively activate the plant immune system, promote the expression of the FRK1 immune marker gene, induce reactive oxygen species bursts and calcium ion influx, and activate MAPK protein phosphorylation, thereby enhancing plant resistance to bacterial diseases such as *Pseudomonas syringae*. Unlike other existing Panax notoginseng saponins that directly inhibit fungi as fungicides, Panax notoginseng saponin Ft1 works by activating the plant's own immunity and has no inhibitory effect on plant growth at effective concentrations. It is highly efficient, safe, and environmentally friendly, and can be used as a novel biopesticide for the control of bacterial plant diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biological pesticide technology, specifically relating to the application of Panax notoginseng saponin Ft1 as a plant immune inducer in the prevention and control of bacterial plant diseases. Background Technology

[0002] Traditional chemical pesticides can kill pathogens to some extent, but long-term use leads to pathogen resistance and serious environmental pollution. Plant immune inducers can induce the plant's own immunity, thereby enabling the plant to acquire or enhance its resistance to pathogens. Because plant immune inducers do not have direct bactericidal activity, pathogens are less likely to develop resistance to them, resulting in a broad spectrum of control; moreover, many are derived from nature, with low pollution levels. Plants have evolved two immune systems during evolution: ETI (effector-triggered immunity) and PTI (PAMP-triggered immunity), both of which can respond to various diseases (fungi, bacteria, viruses, oomycetes, etc.) and inhibit their infection and proliferation. Plant cell surfaces contain various receptor proteins that can recognize pathogen-associated molecular patterns (PAMPs) or different types of immune elicitors (proteins, nucleotides, flavonoids, etc.), and through signal cascade amplification, produce a series of physiological immune responses, including reactive oxygen species bursts, cell wall thickening (callose deposition), MAPK activation, and upregulation of disease resistance gene expression. Currently, plant immune inducers are divided into two main categories: biogenic and non-biogenic. Non-biogenic immune inducers include copper ions, silicon ions, etc. Biogenic immune inducers include various substances such as oligosaccharides, chitosan, proteins, and nucleotides isolated from bacteria.

[0003] Saponins are composed of a sapogenin and sugars, uronic acids, or other organic acids. Based on the type of sapogenin, they are mainly divided into triterpenoid saponins (primarily found in Araliaceae, Fabaceae, Cucurbitaceae, etc.) and steroidal saponins (primarily found in Dioscoreaceae, Liliaceae, etc.). They are mainly distributed in higher terrestrial organisms, and also exist in small quantities in some marine organisms such as starfish. As a class of natural products, the diversity of saponins in terms of type and structure gives them a wide range of physiological and biochemical activities.

[0004] Panax notoginseng is a traditional Chinese medicine belonging to the genus Panax in the family Araliaceae. It has the effects of promoting blood circulation, stopping bleeding, reducing swelling, and relieving pain. The main medicinal components of Panax notoginseng are notoginsenosides and notoginsenosides, with higher content including notoginsenoside R1, notoginsenoside R2, notoginsenoside R3, notoginsenoside R4, and notoginsenoside Ft1. Notoginsenoside Ft1 (Cas: 155683-00-4), with the molecular formula C47H80O17, has been extensively studied for its involvement in animal pathological processes, such as inhibiting cancer cell migration, but there are almost no reports on its ability to enhance plant immunity. Summary of the Invention

[0005] The present invention aims to provide a natural small molecule of saponin that can be used as a plant immune inducer, and discloses its activity and application in activating plant immunity.

[0006] To achieve the above objectives, the technical solution is as follows:

[0007] Application of Panax notoginseng saponin Ft1 in the preparation of plant immune inducers for the prevention and control of bacterial plant diseases.

[0008] In some embodiments, the plant bacterial disease is caused by *Pseudomonas syringae* (DC3000).

[0009] In some embodiments, the notoginsenoside Ft1 enhances plant resistance to bacterial diseases through at least one of the following pathways (1)-(4):

[0010] (1) Upregulates the expression of FRK1, a key immune gene;

[0011] (2) Activate the burst of reactive oxygen species in plants;

[0012] (3) Activate the influx of calcium ions into plants;

[0013] (4) Promotes the phosphorylation of MAPK proteins.

[0014] In some embodiments, the notoginsenoside Ft1 has no inhibitory effect on plant growth at effective concentrations.

[0015] In some embodiments, the effective concentration is 1-100 μM.

[0016] In some embodiments, the plant includes Arabidopsis thaliana.

[0017] In some embodiments, an effective amount of notoginsenoside Ft1 is applied to the plant or the environment surrounding the plant.

[0018] In some embodiments, the application method includes foliar spraying.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] (1) Panax notoginseng saponin Ft1 has the activity of activating plant immunity. At a concentration of 50 μM, it can activate plant disease resistance responses such as reactive oxygen species burst, calcium ion influx and MAPKs, and improve its resistance to pathogens.

[0021] (2) Panax notoginseng saponin Ft1 is a natural product of saponins and will not cause pollution to the environment.

[0022] (3) Panax notoginseng saponin Ft1 can activate the basic immunity of plants, has a broad spectrum, and has a very low probability of inducing drug resistance in pathogens.

[0023] (4) Panax notoginseng saponin Ft1 does not inhibit the growth phenotype of Arabidopsis thaliana and may have little impact on crop agronomic traits, with great application prospects. Attached Figure Description

[0024] Figure 1 This is a schematic diagram illustrating the construction process of the pFRK1-GUS expression vector;

[0025] Figure 2 Panax notoginseng saponin Ft1 activates the expression of the Arabidopsis thaliana immune marker gene FRK1;

[0026] Figure 3 Panax notoginseng saponin Ft1 promotes the release of reactive oxygen species in Arabidopsis thaliana;

[0027] Figure 4 Panax notoginseng saponin Ft1 promotes the influx of calcium ions into Arabidopsis thaliana;

[0028] Figure 5 Panax notoginseng saponin Ft1 activates phosphorylation of Arabidopsis thaliana MAPKs protein;

[0029] Figure 6 The notoginsenoside Ft1 promotes immunity in Arabidopsis thaliana to inhibit DC3000 growth;

[0030] Figure 7 Panax notoginseng saponin Ft1 does not inhibit the growth of Arabidopsis thaliana. Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. Unless otherwise described in detail, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, or are performed according to the kit and product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0032] The natural small molecule of Panax notoginseng saponins involved in the following examples is Panax notoginseng saponin Ft1, whose structural formula is as follows:

[0033] .

[0034] Example 1: Panax notoginseng saponin Ft1 promotes FRK1 expression

[0035] 1. pFRK1-GUS transgenic Arabidopsis

[0036] This application uses Arabidopsis thaliana as the experimental subject and employs biochemical screening methods. First, the promoter of the immunomarker gene FRK1 was cloned using high-fidelity polymerase (Phanta Super-Fidelity DNA Polymerase, Nanjing Novizan Biotechnology Co., Ltd.). Cloning primers were synthesized by Nanjing Qingke Biotechnology Co., Ltd., and their sequences are as follows (underlined primers are Gateway system adapter primers, and the remaining parts are promoter sequence primers). The PCR amplification system and program are shown in Tables 1 and 2 below:

[0037] FRK1-Pro-attbF: GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC GCTGTCGAACATACATTGTCGC;

[0038] FRK1-Pro-attbR: GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC CGATGATCCGCTTTCAACGATAC.

[0039] Table 1. Preparation system for high-fidelity enzyme PCR

[0040]

[0041] Table 2 High-fidelity enzyme PCR running procedure

[0042]

[0043] The promoter sequence was constructed into the pDonr207 entry vector of the Gateway system. The reaction mixture consisted of 1 μL of vector, 1 μL of PCR product, and 0.4 μL of BP enzyme (Thermo Fisher Scientific). The reaction was carried out for at least 2 hours (usually overnight). The next day, 0.4 μL of proteinase K (Sangon Biotech) was added to the reaction mixture, and the mixture was incubated at 37°C for 5 minutes. The reaction mixture was then added to DH5α *E. coli*, and subjected to a series of incubation cycles: ice bath for 30 minutes, water bath for 90 seconds, and ice bath for 2 minutes. 500 μL of liquid LB medium was then added to the tube and the mixture was shaken at 37°C for one hour. A 50 mg / mL gentamicin sulfate solution (Sangon Biotech) was prepared, filtered, and sterilized to serve as a 1000-fold stock solution of antibiotic (the gentamicin sulfate used below is the same as here). This solution was added to melted solid LB medium. After the medium cooled, the bacterial suspension was evenly spread and incubated in the dark at 37°C for one day. Subsequently, the *E. coli* bacteria grown on the culture medium were picked, added to a clear 96-well plate containing liquid LB, and cultured. PCR identification was then performed using Kangwei Century 2×Es Taq MasterMix (Dye) enzyme. The identification primers are as follows, and the identification procedure is shown in Table 2:

[0044] attB1: GGGGACAAGTTTGTACAAAAAA(5'-3');

[0045] attB2: GGG GAC CAC TTT GTA CAA GAA(5'-3').

[0046] Table 3 Taq enzyme identification preparation system

[0047]

[0048] Table 4 Taq enzyme identification procedure

[0049]

[0050] For bacterial cultures with correct band sizes, aspirate 20 μL and add 3-4 mL of LB liquid containing gentamicin sulfate for overnight shaking. The next day, extract plasmids for sequencing (Sangon Biotech). For plasmids with correct sequencing, proceed to the next step of the LR reaction. The reaction system consists of 1 μL of pGWB535 vector, 1 μL of correctly sequenced pDonr207 vector, and 0.4 μL of LR enzyme (Thermo Fisher Scientific). Subsequent steps are the same as for constructing the pDonr207 vector: bacterial selection and identification, shaking, and plasmid extraction for sequencing. A schematic diagram of vector construction is shown below. Figure 1 As shown:

[0051] After obtaining the pGWB535 vector containing the FRK1 promoter sequence, it was transformed into GV3101 Agrobacterium tumefaciens cells. The transformation procedure was as follows: 2 μL of pGWB535 vector was added to GV3101 competent cells, followed by sequential incubation on ice for 5 minutes, freezing in liquid nitrogen for 5 minutes, water bath at 37°C for 5 minutes, and then on ice for 5 minutes. Finally, 500 μL of liquid LB was added, and the cells were shaken at 28°C for 2-3 hours before being plated onto solid LB medium (containing rifampicin (0.05 mg / mL) and spectinomycin (0.025 mg / mL, both sterilized by filtration). The transformed Agrobacterium was grown on the medium at 28°C for 2-3 days. Single colonies on the medium were picked for identification using the same primers and procedures as above; sequencing was not required.

[0052] The correctly identified strain was placed in an Erlenmeyer flask containing 200 mL of LB medium and incubated overnight at 28°C on a shaker. Flowering wild-type Arabidopsis thaliana Col-0 was transformed using the inflorescence infection method. The specific procedure was as follows: A single colony of the correctly identified transformed Agrobacterium was placed in a shaking tube and gently shaken. The next day, the bacterial suspension in the shaking tube was transferred to an Erlenmeyer flask containing 200 mL of liquid LB containing the corresponding antibiotic and shaken vigorously. After the suspension became turbid, it was poured into a centrifuge bottle and centrifuged at 4000 rpm for 10 minutes at 25°C. The liquid LB was discarded, and 150 mL of 5% sucrose solution containing 0.02% Silwet L-77 was added. The Agrobacterium was resuspended by pipetting, and then the suspension was poured into a 100 mL graduated cylinder. Col-0 plants were inserted into the graduated cylinder and allowed to stand for 90 seconds. They were then removed, wrapped with plastic wrap to retain moisture, and placed in the dark for 12 hours before being placed in a normal culture room. The seeds of the infected Arabidopsis thaliana are the T1 generation transgenic Arabidopsis thaliana. T1 generation transgenic Arabidopsis seeds were sown in substrate soil, covered with a transparent cover, and exposed to light for 5-7 days to germinate. After the seedlings developed two cotyledons, glufosinate-ammonium solution was sprayed at a ratio of 1:1000 to screen positive seedlings. The seedlings that survived normally were the positive seedlings of pFRK1-GUS transgenic Arabidopsis, and the seeds from the positive seedlings could be used.

[0053] 2. High-throughput screening of natural small molecules using biochemical methods

[0054] The pFRK1-GUS transgenic Arabidopsis seeds were disinfected for 15 minutes using a commercially available 84 disinfectant solution (approximately 4% effective chlorine content):water = 3:7, and then rinsed 5-6 times with sterile water. After 2 days in a 4°C refrigerator, the seeds were used. A solid culture medium containing 2.25 g / L MS, 5 g / L sucrose, and 0.4% Phytagel (Shanghai Yuanye Biotechnology Co., Ltd.) was melted by heating, and 80 μL of the medium was added to each well of a 96-well shake plate using a pipette. The disinfected Arabidopsis seeds were resuspended in 0.1% agarose gel (Nanjing Sangon Biotech Co., Ltd.), and then pipetteed onto 96-well transparent shake plates. The seeds were grown at 23°C for 5-7 days in a 16h / 8h light / dark cycle. All sowing operations were performed in a clean bench, and the culture medium, 96-well plates, and pipette tips were all sterile. (The culture medium used for Arabidopsis thaliana growth will be referred to as 1 / 2MS solid medium in the following text, and the sterilization method is the same as here).

[0055] The natural product powder standard of Panax notoginseng saponin Ft1 (purity >98%) was dissolved in dimethyl sulfoxide (DMSO) to prepare a stock solution (generally 10 mM). The stock solution was diluted to a working concentration gradient to form treatment groups (10 μM, 50 μM, 100 μM, etc.). Mock (1% DMSO) and 100 nM bacterial flagellar peptide Flg22 were used as negative and positive controls, respectively. The 100-150 μM solutions of the control group and treatment group were added to the above-mentioned 96-well plates, preferably covering the seedlings in the wells. After 5 hours of treatment, the solution in the plate was aspirated with a pipette and added to GUS Buffer staining solution containing 1% X-Gluc (Chinese name: 5-bromo-4-chloro-3-indolyl-β-D-glucuronide cyclohexylammonium salt; English name: 5-Bromo-4-chloro-3-indolylβ-D-glucuronide cyclohexylammonium salt) (GUS Buffer, pH=7.0, preparation method is shown in Table 5).

[0056] Table 5 GUS Buffer

[0057]

[0058] Then, stain at 37°C in the dark, observing every 2 hours. When the seedlings treated with the Flg22 positive control produce a distinct blue substance, the staining solution in the 96-well plate can be aspirated, and the leaves can be decolorized with 95% alcohol for further observation. If the Arabidopsis treated with the natural product produces the aforementioned blue substance, it indicates that the natural product can activate the expression of the Arabidopsis immune marker gene FRK1, which has a certain function of activating plant immunity.

[0059] The results showed that 10 μM notoginsenoside Ft1 could induce the production of a blue substance in pFRK1-GUS transgenic Arabidopsis thaliana, indicating that notoginsenoside Ft1 promotes the expression of the FRK1 gene in Arabidopsis thaliana. (See attached figures.) Figure 2 .

[0060] Example 2: Panax notoginseng saponin Ft1 promotes the release of reactive oxygen species in Arabidopsis thaliana.

[0061] Based on L-012 (CAS: 143556-24-5,8-amino-5-chloro-2,3-dihydro-7-phenylpyrido[3,4-d]pyridazine-1,4-dione sodium salt, molecular formula C 13 The ROS measurement methods for H8ClN4O2·Na and HRP (CAS: 9003-99-0, Horseradish Peroxidase) are as follows. 3-4 week old Arabidopsis Col-0 plant discs (5.5 mm in diameter, avoiding the main leaf veins) were collected using a perforator and floated in 50 μl of sterile water in a 96-well white plate, then left to stand overnight at room temperature (approximately 12 hours). The next day, the compounds for the control and treatment groups were premixed with 500 times diluted L-012 (5 mg / mL) and HRP (10 mg / mL). The premix was added to a clear 96-well plate, and then to another 96-well white plate. The chemiluminescence of the Arabidopsis discs was detected using a microplate reader (Guangzhou Boluteng), with a single reading time of 1 second per well, for a total duration of approximately 30 minutes.

[0062] Chemiluminescence detection results showed that 50 μM and 100 μM notoginsenoside Ft1 promoted the release of reactive oxygen species in Arabidopsis thaliana. The results are as follows... Figure 3 As shown.

[0063] Example 3: Panax notoginseng saponin Ft1 promotes the influx of calcium ions into Arabidopsis thaliana

[0064] This experiment used Arabidopsis thaliana Col-Q, which was a positive seedling obtained by transferring aequorin protein into wild-type Arabidopsis thaliana (the transformation method was similar to that of the pFRK1-GUS transgenic Arabidopsis thaliana in Example 1). In the presence of oxygen and the substrate coelenterate (CTZ), they can form a luminescent complex with aequorin protein. Calcium ions (Ca...) 2+ When combined with this complex, it can release carbon dioxide and blue fluorescence.

[0065] In this experiment, diluted MES (2-morpholinoethanesulfonic acid, stock solution concentration 200mM, 100×), CaCl2 (stock solution concentration 1M, 100×), and CTZ mixture (stock solution concentration 1mM, 100×) were first added to each well of a white 96-well plate. Then, 5-7 day old Arabidopsis thaliana Col-Q seedlings of uniform size, obtained from seeds germinated on 15cm culture dishes, were added to each well. After standing overnight, the negative control DMSO, the positive control Flg22, and notoginsenoside Ft1 were added to the 96 wells the next day (note the concentration changes), and the chemiluminescence of the Arabidopsis discs was detected using a microplate reader (Guangzhou Boluteng). The single reading time per well was 1 second. Since the calcium ion influx process was relatively rapid, it was advisable to test 3 columns (24 wells) of the 96-well plate each time, with 60 cycles (adjusted according to the total time of approximately 20 minutes).

[0066] The results are as follows Figure 4 As shown, chemiluminescence detection results indicate that 10 μM, 50 μM and 100 μM notoginsenoside Ft1 can all promote the influx of calcium ions into Arabidopsis thaliana.

[0067] Example 4: Panax notoginseng saponin Ft1 activates Arabidopsis MAPKs

[0068] Arabidopsis thaliana Col-0 seedlings in good growth condition were removed from the culture medium and transferred to 12-well clear culture plates. The samples were soaked in primary water overnight to maintain uniform sample condition. The next day, DMSO, Flg22, and notoginsenoside Ft1 were added to the 12-well plates to achieve their corresponding working concentrations. The treatment time can be adjusted flexibly; generally, MAPK activation of the PTI pathway is considered to be stronger within 15-30 minutes, while MAPK activation of the ETI pathway requires a longer time, typically several hours. After the treatment time was reached, the Arabidopsis samples were removed, blotted dry with paper towels, placed in 1.5 mL centrifuge tubes, and small steel beads were added. The samples were then stored at -80°C.

[0069] Place the frozen sample in a high-throughput tissue homogenizer and homogenize. Add 100 µL of protein extraction buffer (150 mM NaCl, 1.0% Triton X-100, 50 mM Tris-HCl, pH 8.0), mix well, and incubate on ice for 5 minutes. Centrifuge the tube at 12,000 rpm for 10 minutes at 4°C. Transfer 80 µL of the supernatant to a new tube, add 20 µL of 5X Loading Buffer, and incubate at 80°C for 10 minutes.

[0070] Assemble the electrophoresis tank, take out the pre-made gel, peel off the film on the surface of the gel, pull out the comb, insert the gel plate into the electrophoresis tank, and close the latch.

[0071] Add running buffer to the electrophoresis tank and load samples, 15µL per well, and 3µL per well for protein marker. Fill any blank wells with 1× loading buffer. Cover the electrophoresis tank and set the electrophoresis apparatus to low voltage (80V) for 2.5 hours. Cut the target band (approximately 53kDa) according to the size of the protein marker and the target protein, and immerse it in transfer buffer. Soak the cellulose acetate (PVDF) membrane in methanol for one minute, then thoroughly wet it in the transfer buffer. Stack the membranes in the following order: positive electrode - sponge - filter paper - PVDF membrane - protein gel - filter paper - sponge - negative electrode, and place them on the transfer apparatus. Squeeze out excess water to remove air bubbles and keep the membrane moist. Connect the electrophoresis apparatus, set it to 100V, and perform transfer for 1.5 hours. After transfer, the PVDF membrane was blocked horizontally on a shaker at room temperature for 1-2 hours with TBST buffer containing 5% skim milk powder. Then, it was incubated with primary antibody (antiphospho-p44 / 42MPKs (1:2000)) at room temperature for 1-2 hours. After incubation, the PVDF membrane was washed three times with TBST buffer on a horizontal shaker for 15 minutes each time. The membrane was then transferred to a universal secondary antibody (peroxidase-conjugated universal rabbit IgG (1:15000)) and incubated. It was then washed three times with TBST for 15 minutes each time. The membrane was then imaged at 10s, 30s, 1min, 5min, and 15min to analyze the phosphorylation of the corresponding proteins, selecting the result after 5min of exposure. The PVDF membrane was stained with Ponceau S for 30s to check the uniformity of total protein extraction in each sample.

[0072] The results are as follows Figure 5 As shown, Western blotting was used to detect the phosphorylation of MAPKs protein in Arabidopsis thaliana seedlings. The results showed that 50 μM notoginsenoside Ft1 could activate the phosphorylation of MAPKs protein in Arabidopsis thaliana within 15-30 min.

[0073] Example 5: Panax notoginseng saponin Ft1 promotes Arabidopsis thaliana immunity to inhibit DC3000 growth

[0074] Healthy Arabidopsis thaliana plants, 3-4 weeks old, were grown in substrate soil under the following conditions: 23℃, 16h / 8h light / dark cycle. A 1mL syringe (needle removed) was used to inject the abaxial surface of the Arabidopsis thaliana. Treatment groups received DMSO and notoginsenoside Ft1, followed by injection of DC3000 bacterial solution with an OD value of 0.002 48 hours later; the control group received only notoginsenoside Ft1. After injection, the leaves were air-dried for half an hour and then covered with a transparent cap to maintain moisture. At least 9 leaves were injected for each treatment group as replicates. Two days after injection of DC3000 bacterial solution, the leaves were harvested and disinfected with 75% alcohol for 30 seconds in a clean bench. For ease of operation and to avoid contamination, a 1mL pipette tip was used to punch a hole in the center of the Arabidopsis thaliana leaf for sampling. Nine leaves from each treatment group were randomly divided into 3 groups, with 3 replicates per group. The removed leaves were placed in 1.5 mL centrifuge tubes containing steel balls. 500 μL of 10 mM sterile magnesium chloride solution (MgCl2) was added to the centrifuge tubes. The tubes were then placed in a centrifuge and shaken at 40 Hz for 30 seconds, followed by uniform shaking on a vertical shaker for half an hour to obtain the prepared bacterial suspension. This suspension was then diluted 100,000 times. The diluted suspension was plated on 9 cm diameter transparent plates using King's B (KB, Hangzhou Microbial Co., Ltd.) solid medium supplemented with rifampicin (0.05 mg / mL, filtered and sterilized). The plates were incubated in the dark at 28°C. After 2-3 days, the colony counts were performed. The density was calculated as: density = number of colonies per plate * dilution factor / plate area. Data analysis and graphing were performed using GraphPad Prism.

[0075] The results are as follows Figure 6 As shown, the inhibitory effect of Arabidopsis thaliana immune activation on DC3000 growth was detected after injection of 50 μM and 200 μM notoginsenoside Ft1. The number of DC3000 colonies was significantly reduced after injection of 200 μM notoginsenoside Ft1, indicating that notoginsenoside Ft1 enhanced the resistance of Arabidopsis thaliana to DC3000.

[0076] Example 6: Panax notoginseng saponin Ft1 does not inhibit the growth of Arabidopsis thaliana.

[0077] Seeds of wild-type Arabidopsis thaliana Col-0 were sown on six-well plates containing different concentrations of notoginsenoside Ft1. 5 mL of melted 1 / 2 MS solid medium was added to each well. The amounts of DMSO and notoginsenoside Ft1 added to each well are shown in Table 6.

[0078] Table 6. Preparation methods of Ft1 culture medium containing different concentrations of notoginsenosides.

[0079]

[0080] The results are as follows Figure 7The experiment showed the effect of notoginsenoside Ft1 on Arabidopsis thaliana growth. The results indicated that 1-100 μM notoginsenoside Ft1 had almost no effect on Arabidopsis thaliana growth.

[0081] The above description is illustrative only and not restrictive of the present invention. Those skilled in the art will understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all such modifications, variations or equivalents will fall within the protection scope of the present invention.

Claims

1. Use of Panax notoginseng saponin Ft1 in the preparation of a plant immune elicitor for preventing and treating plant bacterial diseases.

2. Use according to claim 1, characterized in that, The plant bacterial disease is caused by Pseudomonas syringae (DC3000).

3. Use according to claim 1 or 2, characterized in that, The Panax notoginseng saponin Ft1 improves the resistance of the plant to the bacterial disease through at least one of the following (1)-(4): (1) up-regulating the expression of an FRK1 immune key gene; (2) activating a plant active oxygen burst; (3) activating a plant calcium ion influx; (4) promoting MAPKs protein phosphorylation.

4. Use according to claim 1, characterized in that, The Panax notoginseng saponin Ft1 has no inhibitory effect on the growth of the plant at an effective concentration.

5. Use according to claim 4, characterized in that, The effective concentration is 1-100 μM.

6. Use according to claim 1, characterized in that, The plant includes Arabidopsis thaliana.

7. A method for controlling a bacterial disease of plants, characterized by, The method comprises applying an effective amount of the Panax notoginseng saponin Ft1 to the plant or the surrounding environment of the plant.

8. The method of claim 7, wherein, The application mode includes foliar spraying.