A lentivirus dendritic cell vaccine targeting claudin-18.2 and a preparation method and application thereof

Abstract

The present application relates to the technical field of vaccine preparation, in particular to a lentivirus dendritic cell vaccine targeting Claudin-18.2 and a preparation method and application thereof. The preparation method comprises the following steps: obtaining immature dendritic cells; using a recombinant lentivirus particle carrying a nucleotide sequence encoding a Claudin-18.2 protein to perform gene transduction on the immature dendritic cells, so that the immature dendritic cells endogenously express a Claudin-18.2 antigen; applying a maturation-promoting stimulus to the transduced dendritic cells to obtain a dendritic cell vaccine that is mature and expresses the Claudin-18.2 antigen. The vaccine can effectively induce an antigen-specific cytotoxic T lymphocyte response, is suitable for preparing a drug for treating Claudin-18.2-positive gastric cancer, and has the characteristics of strong targeting and significant immune activation effect.

Description

Technical Field

[0001] This invention relates to the field of vaccine preparation technology, and in particular to a lentiviral dendritic cell vaccine targeting Claudin-18.2, its preparation method, and its application. Background Technology

[0002] Dendritic cells (DCs), as the most potent professional antigen-presenting cells in the body, play a central role in initiating and regulating adaptive immune responses. DC-based tumor vaccines, which load tumor antigens in vitro and then reinfuse them into patients, can induce specific cytotoxic T lymphocyte (CTL) responses, thereby recognizing and eliminating tumor cells. This represents a highly promising strategy for tumor immunotherapy.

[0003] Effective antigen loading is crucial for the success of dendritic cell (DC) vaccines. Traditional antigen loading methods mainly include using tumor cell lysates, synthetic peptides, or recombinant proteins. Using autologous or allogeneic tumor cell lysates is a common strategy because it contains a variety of potential tumor-associated antigens, theoretically capable of inducing a broad-spectrum immune response. For example, Chinese invention patent CN114958741B discloses a DC vaccine loaded with HPV complex antigens and its application, which uses lysates from various HPV-positive tumor cell lines as antigen sources, co-incubates them with DCs, and then reinfuses them. However, these cell lysate-based DC vaccines have several inherent drawbacks. First, the cell lysate composition is complex, with only a few being true tumor-specific antigens. Using it to load DCs can lead to the immune system simultaneously responding to a large number of irrelevant antigens and even normal antigens, reducing the strength of the response against key target antigens and potentially triggering an immune response against the body's own tissues. Second, exogenous antigens need to be phagocytosed and processed by DCs before being presented by MHC molecules; key antigens may not be effectively presented due to low expression levels or difficulty in processing. Furthermore, the lysate itself lacks effective endogenous danger signals and has limited activation capacity for dendritic cells (DCs), relying mainly on exogenous adjuvants. This leads to insufficient DC maturation, which in turn affects the intensity and persistence of subsequent T cell activation. The composition of cell lysates is affected by various factors such as cell source, culture state, and lysis process, resulting in significant differences between different batches. This makes it difficult to maintain consistent efficacy and safety in the final vaccine product, severely hindering quality control for large-scale production and clinical application.

[0004] Therefore, there is an urgent need in this field to develop a novel DC vaccine technology with a clearly defined antigen, precise targeting, high activation efficiency, and standardized preparation process to overcome the shortcomings of existing technologies. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a method for preparing a lentiviral dendritic cell vaccine targeting Claudin-18.2, characterized by comprising the following steps: S1. Obtain immature dendritic cells; S2. Gene transduction of the immature dendritic cells is performed using recombinant lentiviral particles, wherein the recombinant lentiviral particles carry a nucleotide sequence encoding the Claudin-18.2 protein, so that the dendritic cells endogenously express the Claudin-18.2 antigen. S3. Apply maturation-promoting stimulation to the transduced dendritic cells to obtain mature dendritic cell vaccines expressing Claudin-18.2 antigen.

[0006] Furthermore, the recombinant lentivirus particles described in step S2 are prepared by the following method: (i) Construct a recombinant lentiviral transfer plasmid containing a nucleotide sequence encoding the Claudin-18.2 protein; (ii) The recombinant lentiviral transfer plasmid and the viral packaging plasmid system are co-transfected into packaging cells to produce viral particles; (iii) Collect and concentrate the viral supernatant to obtain the recombinant lentivirus particles.

[0007] Furthermore, the nucleotide sequence encoding the CLAUDIN-18.2 protein in step (i) is fused with a Flag tag coding sequence; the backbone of the recombinant lentiviral transfer plasmid is pLVX.

[0008] Furthermore, the immature dendritic cells described in step S1 are obtained through the following method: Adherent mononuclear cells isolated from the peripheral blood of mammalian individuals, or bone marrow cells flushed out of the bone marrow of mice; The dendritic cell precursors were induced and cultured in a medium containing GM-CSF and IL-4 to obtain the immature dendritic cells.

[0009] Preferably, the peripheral blood is derived from a healthy human donor.

[0010] Furthermore, in the induction culture, the concentration of GM-CSF is 20-100 ng / mL, and the concentration of IL-4 is 10-50 ng / mL.

[0011] Furthermore, in step S2, the gene transduction step is performed on day 5 to day 6 of the induced culture of the immature dendritic cells; the infection multiplicity used during gene transduction is 50 to 300, more preferably 150 to 200.

[0012] Furthermore, the gene transduction is performed in the presence of a polygel at a concentration of 6-10 µg / mL.

[0013] Furthermore, in step S3, the maturation-promoting stimulus is the addition of TNF-α, and the concentration of TNF-α used is from 5 ng / mL to 20 ng / mL, more preferably 10 ng / mL.

[0014] The present invention also provides a dendritic cell vaccine targeting Claudin-18.2, which is prepared by the method described above.

[0015] The present invention also provides the use of the dendritic cell vaccine targeting Claudin-18.2 as described above in the preparation of a medicament for treating Claudin-18.2 positive gastric cancer.

[0016] Compared with existing technologies, the lentiviral dendritic cell vaccine preparation method targeting Claudin-18.2 provided by this invention utilizes recombinant lentiviral particles to transduce genes in immature dendritic cells, enabling them to endogenously and continuously express a single and specific tumor antigen, Claudin-18.2. This overcomes the inherent defects of traditional methods that rely on exogenous loading based on tumor cell lysates or peptides. This technical solution ensures stable expression and efficient processing of the antigen within dendritic cells and effectively drives dendritic cell maturation through the immunostimulatory properties of the lentiviral vector itself, thereby producing a standardized vaccine with high antigen specificity and strong immunogenicity. This method not only significantly improves the accuracy and intensity of the vaccine-induced antigen-specific cytotoxic T lymphocyte response but also effectively avoids potential off-target and safety risks caused by loading complex antigen mixtures. Furthermore, its genetically engineered preparation process lays a reliable foundation for product quality control and large-scale standardized production, ultimately demonstrating excellent potential application value in the treatment of Claudin-18.2-positive gastric cancer. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 Construction and identification of lentiviral vectors encoding CLDN18.2; Figure 2 Preparation and phenotypic validation of human dendritic cell vaccine loaded on CLDN18.2; Figure 3 The CLDN18.2-DC vaccine induced a potent antigen-specific cytotoxic T lymphocyte response in vitro. Figure 4 The CLDN18.2-DC vaccine was used to inhibit tumor growth and modulate the tumor microenvironment in vivo. Figure 5 To construct a gastric cancer cell line stably expressing CLDN18.2 and to validate a mouse bone marrow-derived DC (BMDC) vaccine. Detailed Implementation

[0019] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] This invention relates to the field of tumor immunotherapy, specifically to a dendritic cell vaccine targeting the tight junction protein Claudin-18.2 (hereinafter referred to as CLDN18.2), its preparation method, and its application.

[0021] In specific embodiments of the present invention, unless otherwise stated, Claudin-18.2 and CLDN18.2 have the same meaning, both referring to human or mouse Claudin-18.2 protein or its functional fragments, and the two can be used interchangeably.

[0022] Example 1: Construction and preparation of a lentiviral vector encoding human CLDN18.2 1. Plasmid construction: Total RNA was extracted from the human gastric cancer cell line KATO III (CLDN18.2 positive) and reverse transcribed into cDNA. The full-length human Claudin-18.2 (CLDN18.2) cDNA sequence (786 bp) was amplified by polymerase chain reaction (PCR). The gene sequence of Claudin-18.2 is shown in SEQ ID NO.1.

[0023] A Flag tag coding sequence was introduced into the PCR primers for subsequent detection. The CLDN18.2 cDNA fragment with the Flag tag was ligated by enzyme digestion and cloned into the multiple cloning site of the pLVX lentiviral transfer vector (Addgene, 85140) to construct the recombinant plasmid pLVX-CLDN18.2-Puro. Positive clones were initially screened by colony PCR and agarose gel electrophoresis. The results are shown in [Figure number missing]. Figure 1A, and the sequence was confirmed to be correct by Sanger sequencing.

[0024] Figure 1 A confirmed that human CLDN18.2 (786 bp) cDNA was successfully inserted into the pLVX backbone, with lane 1: pLVX-CLDN18.2; lane 2: DNA marker.

[0025] To verify the expression capacity of the constructed plasmid in mammalian cells, the pLVX-CLDN18.2-Puro plasmid was transiently transfected into HEK293T cells. 72 hours after transfection, the expression of CLDN18.2 protein in the cells was detected by flow cytometry. The results are shown below. Figure 1 B.

[0026] Figure 1 The results showed that approximately 99.7% of the transfected cells were CLDN18.2 positive, confirming that the recombinant plasmid could drive the efficient expression of CLDN18.2 protein in eukaryotic cells.

[0027] SEQ ID NO.1 atggccgtgactgcctgtcagggcttggggttcgtggtttcactgattgggattgcgggcatcattgctgccacctgcatggaccagtggagcaccca agacttgtacaacaaccccgtaacagctgttttcaactaccaggggctgtggcgctcctgtgtccgagagagctctggcttcaccgagtgccggggct acttcaccctgctggggctgccagccatgctgcaggcagtgcgagccctgatgatcgtaggcatcgtcctgggtgccattggcctcctggtatccatc tttgccctgaaatgcatccgcattggcagcatggaggactctgccaaagccaacatgacactgacctccgggatcatgttcattgtctcaggtctttgt gcaattgctggagtgtctgtgtttgccaacatgctggtgactaacttctggatgtccacagctaacatgtacaccggcatgggtgggatggtgcagac tgttcagaccaggtacacatttggtgcggctctgttcgtgggctgggtcgctggaggcctcacactaattgggggtgtgatgatgtgcatcgcctgcc ggggcctggcaccagaagaaaccaactacaaagccgtttcttatcatgcctcaggccacagtgttgcctacaagcctggaggcttcaaggccagcact ggctttgggtccaacaccaaaaacaagaagatatacgatggaggtgcccgcacagaggacgaggtacaatcttatccttccaagcacgactatgtgtaa 2. Lentiviral Packaging and Production: HEK293T cells in good growth condition were packaged at 2.5 × 10⁻⁶ cells / cells. 7 Cells were seeded at a density of 10 cells / dish in 15 cm cell culture dishes and co-transfected with the following four plasmids using polyethyleneimine (PEI) transfection reagent: recombinant transfer plasmid pLVX-CLDN18.2-Puro (or empty vector pLVX-Puro as a control), packaging plasmid pMDL (Addgene, 12253), envelope plasmid pVSVG, and helper plasmid pRSV-Rev.

[0028] 3. Virus Collection and Concentration: 72 hours after transfection, the cell culture supernatant was collected. The supernatant was centrifuged at 500 g for 10 minutes (4°C) to remove cell debris, and then filtered through a 0.45 μm PVDF membrane. Pre-chilled 5×PEG-6000 / NaCl solution (1 / 4 the volume of the supernatant) was added to the filtered supernatant, and the mixture was incubated overnight at 4°C to allow virus particles to precipitate. The virus pellet was collected by centrifugation at 7,000 g for 10 minutes (4°C). The virus pellet was resuspended in a small amount of pre-chilled phosphate-buffered saline (PBS), aliquoted, and stored at -80°C.

[0029] 4. Virus identification and titer determination: Transmission electron microscopy (TEM) observation: 10 μL of concentrated virus solution was dropped onto a 200-mesh carbon copper grid, negatively stained with 1% uranium acetate for 15 seconds, and then air-dried for 3 hours. The sample was observed under an H-7650 TEM (Hitachi) at 80 kV. The results are shown below. Figure 1 C.

[0030] like Figure 1 As shown in Figure C, dispersed, nearly spherical virus particles with a diameter of approximately 100-150 nm are visible.

[0031] Nanoparticle tracking analysis: Particle size distribution was further analyzed using nanoparticle tracking analysis (NTA) with a NanoSight NS300 (Malvern Panalytical). Results are shown in [Figure number missing]. Figure 1 D.

[0032] Figure 1 The results from D show that the peak diameter of the particles is approximately 120 nm.

[0033] Titer determination: The viral genome copy number was determined by quantitative PCR using the TransLy™ lentiviral qPCR titer assay kit. Results are shown below. Figure 1 E.

[0034] The steps for RNA extraction, reverse transcription, and qPCR are as follows: Total RNA was extracted using TRIzol reagent (TaKaRa, 9109). 1 µg of RNA was reverse transcribed using the PrimeScript RT Reagent Kit (TaKaRa, RR036A). qPCR was performed on a LightCycler 96 instrument (Roche) using TB Green Premix Ex Taq II (TaKaRa, RR820). 2 -ΔΔCtThe relative expression level was calculated using a method with GAPDH as an internal reference. Primer sequences are shown in Table 1.

[0035] Table 1

[0036] Figure 1 The results showed that the functional titer of the empty vector virus (Lv-Vec) was 1.84 × 10⁻⁶. 7 The functional titer of the virus carrying CLDN18.2 (Lv-CLDN18.2) was 1.86 × 10⁻¹¹ IU / mL. 7 IU / mL indicates that a virus of comparable titer was successfully produced.

[0037] Example 2: Establishment of a gastric cancer cell line stably expressing CLDN18.2 To conduct in vitro killing experiments and construct in vivo tumor models, it is necessary to establish a target cell line that stably expresses CLDN18.2.

[0038] Cell transduction: CLDN18.2-negative human gastric cancer cell lines AGS and HGC27, and mouse pregastric cancer cell line MFC, were seeded in 6-well plates at 40-50% confluence. Lv-CLDN18.2 lentiviral particles prepared in Example 1 were added to the cells, with a multiplicity of infection (MOI) of 50. Polygel was also added at a final concentration of 8 µg / mL to enhance infection efficiency.

[0039] Screening of stable cell lines: 48 hours after viral infection, the medium was replaced with complete medium containing 2 µg / mL puromycin for screening. The cells were cultured for approximately 1-2 weeks until all cells in the control group (untransduced with virus) died, while the experimental group developed a resistant cell population.

[0040] Expression validation: Selected cells were collected, and the expression of CLDN18.2 protein was detected by Western blotting. The results are shown in [Figure number missing]. Figure 5 .

[0041] The steps for Western blotting of proteins are as follows (the same applies below): Cells were lysed with RIPA buffer containing a protease inhibitor (Thermo Fisher, 693132001). Protein concentration was determined using a BCA kit (Thermo Fisher, 23227). An equal volume of protein was subjected to SDS-PAGE electrophoresis, transferred to a PVDF membrane, and blocked with 5% skim milk. The membrane was incubated overnight at 4°C with primary antibodies (all 1:1000): CD8α (Immunoway, YM8067), CLDN18.2 (Immunoway, YM9290), Ki-67 (Immunoway, YM8189), and β-tubulin (Immunoway, YM8332). Then, HRP-labeled goat anti-rabbit IgG secondary antibody (Immunoway, RS0002, 1:100000) was used. Developed on a Gel Doc XR system (Bio-Rad) using ECL reagent (Abbkine Scientific Co., Ltd, BMU102).

[0042] Figure 5 The results confirmed that transduced AGS, HGC27, and MFC cells could stably express the CLDN18.2 protein ( Figure 5 A and B), named AGS-CLDN18.2, HGC27-CLDN18.2 and MFC-CLDN18.2 respectively, will be used for subsequent experiments.

[0043] Example 3: Preparation of a human lentiviral dendritic cell vaccine targeting CLDN18.2 Induction of immature dendritic cells: Based on the informed consent form, 50 mL of peripheral blood was collected from healthy volunteers. Peripheral blood mononuclear cells (PBMCs) were isolated using a human peripheral blood mononuclear cell separation kit (Solarbio, P8680).

[0044] PBMCs were resuspended in RPMI-1640 complete medium containing 10% fetal bovine serum (FBS), seeded into cell culture dishes, and incubated at 37°C in a 5% CO2 incubator for 2 hours. Non-adherent cells were discarded to obtain adherent monocytes.

[0045] Add complete culture medium containing 100 ng / mL recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) and 50 ng / mL recombinant human interleukin-4 (IL-4) to adherent cells, and seed approximately 5 × 10⁶ cells per well. 6 Cells. Change half the medium every 48 hours, culture until day 5, results are shown in [see table].Figure 2 B.

[0046] Figure 2 B shows a bright-field image depicting the morphological changes of human monocytes as they differentiate into immature dendritic cells (iDCs) from day 1 to day 5. The cell morphology changes from round to irregular, semi-adherent, and has typical dendritic processes, which are the characteristics of immature dendritic cells.

[0047] like Figure 2 A schematic diagram illustrates the workflow for DC vaccine preparation and subsequent T cell induction. Human monocytes isolated from PBMCs differentiated into immature dendritic cells (iDCs) in the presence of GM-CSF and IL-4 after 6 days.

[0048] Lentiviral transduction and antigen loading: Immature dendritic cells (iDCs) were collected on day 5 of induction. Cells were resuspended and mixed with either Lv-CLDN18.2 or Lv-Vec (MOI = 200), and then infected with a polygel to a final concentration of 8 µg / mL. The cells were incubated for 24 hours to complete gene transduction.

[0049] Dendritic cell maturation induction: 24 hours after transduction, recombinant human tumor necrosis factor-α (TNF-α) was added to the culture system at a final concentration of 10 ng / mL to promote dendritic cell maturation. Culture continued until day 10. Mature dendritic cells (DCs) were collected on day 10, and the expression of CD11c, HLA-ABC, HLA-DR, CD80, and CD86 was analyzed by flow cytometry.

[0050] Flow cytometry assay procedure (hereinafter the same): For phenotypic analysis of human dendritic cells (DCs) and T cells, single-cell suspensions were prepared and stained. Cells were resuspended in flow cytometry staining buffer and incubated with an antibody conjugated to the fluorescent dye on ice in the dark for 30 minutes. After washing, cells were fixed and data were immediately acquired on a BD FACSCanto II flow cytometer.

[0051] The antibodies used are as follows: APC anti-human CD14 (BioLegend, 301806), FITC anti-human CD11c (BioLegend, 301604), PE anti-human HLA-DR (BioLegend, 317416), APC anti-human HLA-ABC (Thermo Fisher, 17-9983-42), ABflo™ 647 anti-human CD80 (Abclonal, A23730) and PE anti-human CD86 (Thermo Fisher, 12-0869-42), Brilliant Violet 650 anti-human CD3 (Thermo Fisher, 16-0038-42), APC anti-human CD4 (BioLegend, 301006), FITC anti-human CD8a (BioLegend, 307606) and PE anti-human CD25. (Thermo Fisher, 12-0259-42). Flow cytometry data were acquired on a BD FACSCanto II and analyzed using FlowJo software (v10).

[0052] Vaccine phenotypic validation: Dendritic cells were collected on day 10 for validation; results are shown below. Figure 2 CF.

[0053] Purity assessment: Flow cytometry analysis showed that 99.8% of the induced cell population expressed the dendritic cell marker CD11c, but did not express the monocyte marker CD14 or the T cell marker CD3. Figure 2 C) indicates that high-purity dendritic cells were obtained.

[0054] Antigen expression verification: Western blot analysis confirmed that Lv-CLDN18.2 transduced dendritic cells (Lv-CLDN18.2-DC) specifically expressed CLDN18.2 protein, while PBS-treated or Lv-Vec transduced control cells (Lv-Vec-DC) did not express it. Figure 2 D).

[0055] Mature phenotype analysis: CD11c analysis by flow cytometry + Expression of surface molecules in cell populations. Compared with Lv-Vec-DC, Lv-CLDN18.2-DC highly expressed the co-stimulatory molecules CD80 (37.30% vs 10.43%) and CD86 (98.87% vs 72.63%), as well as the antigen-presenting molecules HLA-ABC (99.93% vs 13.83%) and HLA-DR (84.10% vs 26.97%).Figure 2 E, F), indicating that a mature dendritic cell vaccine with high antigen expression was successfully obtained.

[0056] Example 4: Preparation of a mouse bone marrow-derived vaccine targeting CLDN18.2 dendritic cells To conduct in vivo animal experiments, a mouse homologous dendritic cell vaccine was prepared.

[0057] Bone marrow cell acquisition: Bone marrow cells were flushed from the femur and tibia of 6-8 week old male 615 mice. Red blood cells were lysed, and the remaining cells were washed twice to obtain bone marrow mononuclear cells.

[0058] Immature dendritic cell induction: bone marrow cells were inoculated at a rate of 2 × 10⁻⁶. 5 Cells were seeded at a density of 1 / mL in bacterial culture dishes on RPMI-1640 complete medium containing 20 ng / mL mouse GM-CSF and 10 ng / mL mouse IL-4. An equal volume of fresh medium containing cytokines was added on day 3. On day 6, non-adherent and loosely adherent cells were collected, which were identified as mouse immature bone marrow-derived dendritic cells (iBMDCs).

[0059] Lentiviral transduction and maturation: iBMDCs were re-inoculated into tissue culture-grade dishes and transduced using Lv-CLDN18.2 or Lv-Vec (MOI=200) with 8 µg / mL polygel. After 24 hours, 10 ng / mL mouse TNF-α was added to induce maturation. Culture was continued until day 10, and mature BMDCs were collected.

[0060] Example 5: Induction and Functional Evaluation of Antigen-Specific Cytotoxic T Lymphocytes in Vitro Autologous T cell isolation and expansion: Non-adherent autologous PBMCs from healthy donors were isolated and expanded at 2–5 × 10⁻⁵ mcg. 6 Cells mL - ¹ Resuspended in complete RPMI-1640 medium. CD3 cells were forward sorted using CD3 / CD28-coupled magnetic beads (Abclonal, A25789) at a bead:cell ratio of 3:1. + T cells, and 500 IU mL - ¹ Stimulation with recombinant human IL-2 (Thermo Fisher, RP01039). After 48 hours, cells were cultured at 100 IU / mL. - ¹ Maintain culture in IL-2 for 5-7 days for subsequent experiments.

[0061] CTL induction: Mature DCs prepared in Example 3 (including Lv-CLDN18.2-DC, Lv-Vec-DC, and PBS-treated DCs) were co-cultured with autologous T cells at a ratio of 1:10 in complete medium containing 100 IU / mL IL-2. A T cell-only group was set up as a blank control. After 24 hours of co-culture, cells and supernatant were collected for subsequent analysis.

[0062] T cell phenotype and activation analysis: Cells were stained after co-culture and CD3+ was analyzed by flow cytometry. + CD4 in T cells + and CD8 + The proportion of subgroups, and CD8 + Expression of CD25, an activation marker, on T cells.

[0063] Figure 3 A is a representative dot plot from flow cytometry, showing the CD3+ levels after different DC stimulations. + CD4 in T cells + and CD8 + Distribution of subgroups Figure 3 B is correct. Figure 3 Quantitative statistical analysis of A, Figure 3 C is the CD8+ detection method using flow cytometry. + Histogram of CD25 expression levels, a marker of T cell activation.

[0064] The results showed that, compared with the empty vector control group (Lv-Vec-DC), CD8+ was significantly higher in CTLs induced by Lv-CLDN18.2-DC stimulation. + T cells in CD3 + The proportion in cells was significantly increased (55.60% vs 41.53%). Figure 3 (A, B). This result indicates that the DC vaccine loaded with the CLDN18.2 antigen can preferentially activate and amplify CD8. + T cells, specifically the primary subset of cytotoxic effector T cells. CD8 + T cells are the core force mediating target cell lysis and performing anti-tumor immune functions, and an increase in their proportion directly indicates stronger potential cytotoxicity. Figure 3 C indicates that, compared to the PBS-DC control group and the empty vector Lv-Vec-DC control group, the CD8+ induced by the lentiviral dendritic cell vaccine loaded with CLDN18.2 antigen (Lv-CLDN18.2-DC) was significantly higher. + T cells showed significantly higher CD25 expression levels and a higher proportion of positive cells, directly demonstrating that the vaccine can efficiently and specifically activate CD8+. + T cells are brought into a state of functional activation.

[0065] Figure 3 D shows the cytokine levels of IFN-γ and TNF-α in the co-culture supernatant as measured by ELISA. The results indicate that, compared with the Lv-Vec-DC group, Lv-CLDN18.2-DC-induced CTLs showed significantly lower levels of CD8+. + The proportion of T cells was significantly increased (55.60% vs 41.53%), and CD8+ was also significantly increased. + The expression rate of CD25 on T cells was also significantly increased (94.03% vs 35.27%). Figure 3 D). CD25 is a key marker for complete T cell activation and entry into the proliferative state. Its significant upregulation indicates that the Lv-CLDN18.2-DC vaccine can not only amplify CD8... + The number of T cells increases the efficiency with which they transition to a highly activated functional state. Activated T cells can respond to growth factors such as interleukin-2 (IL-2), undergo clonal proliferation, and enhance their effector functions.

[0066] Cytokine detection: The supernatant from 24 hours of co-culture was collected, and the secretion levels of interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) were detected using an enzyme-linked immunosorbent assay (ELISA) kit. Results are shown below. Figure 3 E.

[0067] The results showed that the levels of IFN-γ (880.8 pg / mL) and TNF-α (1143 pg / mL) secreted by CTLs in the Lv-CLDN18.2-DC group were significantly higher than those in the Lv-Vec-DC group (669.0 pg / mL and 931.0 pg / mL, respectively). Figure 3 E).

[0068] Killing assay: Target cells stably expressing CLDN18.2 (AGS-CLDN18.2 or HGC27-CLDN18.2) were seeded at 5 × 10³ cells per well in 96-well plates. CTLs induced by different DCs were added to the wells at different effector-to-target ratios (E:T). After co-culturing for 24 hours, target cell viability was assessed using the CCK-8 assay, and the specific killing rate of CTLs was calculated. Results are shown below. Figure 3 F.

[0069] The formula for calculating the inhibition rate is as follows: Inhibition rate (%) = [1 – (OD experimental group – OD blank) / (OD target cells alone – OD blank)] ×100.

[0070] The results showed that at an E:T ratio of 40:1, CTLs induced by Lv-CLDN18.2-DC exhibited the strongest specific killing effect on CLDN18.2 positive target cells, significantly superior to all control groups. Figure 4 F).

[0071] Example 6: In vivo antitumor efficacy evaluation of DC vaccine targeting CLDN18.2 in mouse model Tumor model establishment: 6-8 week old male 615 mice were housed under specific pathogen-free (SPF) conditions. 1×10⁻⁶ mice were subcutaneously injected into the right flank. 6 A syngeneic xenograft model was established using mouse MFC-CLDN18.2 cells.

[0072] Grouping and Treatment: Once the tumors were palpable (approximately day 7 post-inoculation), tumor-bearing mice were randomly divided into four groups (n=4 per group): (1) untreated group; (2) PBS-DC group (injected with untreated BMDCs); (3) Lv-Vec-DC group (injected with empty vector-transduced BMDCs); (4) Lv-CLDN18.2-DC group (injected with Lv-CLDN18.2-transduced BMDCs prepared in Example 4). On days 7, 14, and 21, the mice in each group were intravenously injected with the corresponding DC vaccine, with each mouse receiving 1×10⁻⁶ doses per injection. 6 Cells, results shown Figure 5 A. The mouse DC vaccine was prepared from bone marrow-derived DCs (BMDCs), and the successful loading of the CLDN18.2 antigen was confirmed by Western blotting. Figure 4 C).

[0073] Tumor growth monitoring: The long and short diameters of the tumor were measured every two days using calipers. The tumor volume was calculated using the formula (volume = 0.5 × length × width²), and a growth curve was plotted. The mice were also weighed regularly. Results are shown below. Figure 4 B. Throughout the experiment, there was no significant difference in body weight change among the groups of mice. Figure 4 (B) indicates that the DC vaccine treatment regimen was well tolerated in mice.

[0074] In vivo imaging analysis: At the treatment endpoint (day 28), mice were intraperitoneally injected with 150 mg / kg D-fluorescein. Ten minutes after injection, bioluminescent signals in the tumor region were acquired using a small animal in vivo imaging system (IVIS Spectrum). The results are shown in the table below. Figure 4 C, D.

[0075] The results showed that the bioluminescent signal intensity in the Lv-CLDN18.2-DC treatment group was significantly lower than that in the other groups, indicating the lightest tumor burden. Figure 4 C, D).

[0076] Tumor volume and weight: Mice were sacrificed on day 28, the tumors were dissected and weighed, and the results are shown in the table below. Figure 4 E, F. Measurement results showed that the tumor volume in the Lv-CLDN18.2-DC group ( Figure 4 Both E and F values ​​and weight were significantly lower than those of other control groups.

[0077] Immunohistochemical analysis of tumor tissue: Exfoliated tumor tissue was fixed in 4% paraformaldehyde for 48 hours, then embedded in paraffin, and sectioned to a thickness of 4 µm. After antigen retrieval and blocking, sections were incubated overnight at 4°C with primary antibodies: CLDN18.2 (Thermo, 1:200), CD8α (Proteintech, 66868-1-Ig, 1:200), or Ki-67 (Abcam, ab16667, 1:300). DAB staining was then performed using the UltraSensitive SP IHC Kit (MXBBiotechnologies, KIT-9710) and HRP-conjugated secondary antibody. Under the same exposure settings (three fields of view per tumor, n = 4 tumors per group), the percentage of positive areas was quantified using the ImageJ IHC Profiler plugin. Results are shown in [Figure number missing]. Figure 4 G, H.

[0078] The results showed that compared with the untreated group (36.33%), the PBS-DC group (34.00%), and the Lv-Vec-DC group (36.67%), the percentage of CLDN18.2 positive cells in the tumors of the Lv-CLDN18.2-DC group was significantly reduced (23.00%), indicating effective targeting of tumor cells expressing the antigen. Furthermore, the proliferation marker Ki-67 in these tumors was significantly reduced (12.00% vs. 53.00% in the untreated and PBS-DC groups and 36.00% in the Lv-Vec-DC group). Crucially, CD8+ was significantly reduced in the tumors. + T cell infiltration was significantly increased (36.00%), in stark contrast to the untreated group (5.00%), the PBS-DC group (10.00%), and the Lv-Vec-DC group (13.00%). These findings indicate that the CLDN18.2-DC vaccine effectively inhibits tumor growth in vivo, which is related to CD8+ in the tumor microenvironment. + Increased T cell infiltration is associated with decreased tumor cell proliferation. ​ G, H).

[0079] This invention systematically and completely verifies the effectiveness of the lentiviral dendritic cell vaccine targeting Claudin-18.2 (CLDN18.2) through a series of specific embodiments.

[0080] Specifically: (1) A high-titer lentiviral vector encoding human CLDN18.2 was successfully constructed, and gastric cancer cell lines (human AGS / HGC27 and mouse MFC) that stably express CLDN18.2 were established, providing key tools for subsequent functional studies.

[0081] (2) Using the lentiviral vector, immature human and mouse dendritic cells were successfully transduced to obtain a mature and highly expressed functional DC vaccine containing CLDN18.2 antigen, co-stimulatory molecules (CD80 / CD86) and antigen-presenting molecules (HLA-ABC / DR), which confirmed that the lentiviral system has the dual advantages of antigen delivery and immune adjuvant.

[0082] (3) This DC vaccine can effectively stimulate autologous T cells in vitro, significantly expand and activate CD8 cells. + Cytotoxic T lymphocytes (manifested as CD8) + The induced CTLs showed increased proportions and enhanced expression of the activation marker CD25, and promoted the secretion of high levels of effector cytokines (IFN-γ and TNF-α). More importantly, the induced CTLs exhibited potent and specific killing ability against CLDN18.2 positive gastric cancer cells.

[0083] (4) In a syngeneic mouse gastric cancer model, vaccination with this DC vaccine significantly inhibited the growth of CLDN18.2-positive tumors. The mechanism was related to the enhancement of intratumoral CD8. + T cell infiltration, inhibition of tumor cell proliferation, and clearance of CLDN18.2 positive tumor cells are closely related.

[0084] In summary, through examples ranging from molecular construction and cell preparation to in vitro and in vivo functional verification, this invention fully demonstrates that the lentiviral DC vaccine targeting CLDN18.2 can effectively stimulate antigen-specific cellular immune responses and produce a clear anti-tumor effect in preclinical models, providing solid experimental evidence for its potential immunotherapy for treating CLDN18.2-positive gastric cancer.

[0085] Although this document frequently uses terms such as dendritic cells, Claudin-18.2 protein, Claudin-18.2 antigen, recombinant lentiviral transfer plasmid, and viral packaging plasmid, the possibility of using other terms is not excluded. These terms are used merely for the convenience of describing and explaining the essence of the invention; interpreting them as any additional limitation would be contrary to the spirit of the invention.

[0086] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing a lentiviral dendritic cell vaccine targeting Claudin-18.2, characterized in that, Includes the following steps: S1. Obtain immature dendritic cells; S2. Gene transduction of the immature dendritic cells is performed using recombinant lentiviral particles, wherein the recombinant lentiviral particles carry a nucleotide sequence encoding the Claudin-18.2 protein, so that the dendritic cells endogenously express the Claudin-18.2 antigen. S3. Apply maturation-promoting stimulation to the transduced dendritic cells to obtain mature dendritic cell vaccines expressing Claudin-18.2 antigen.

2. The preparation method according to claim 1, characterized in that: The recombinant lentivirus particles described in step S2 are prepared by the following method: (i) Construct a recombinant lentiviral transfer plasmid containing a nucleotide sequence encoding the Claudin-18.2 protein; (ii) The recombinant lentiviral transfer plasmid and the viral packaging plasmid system are co-transfected into packaging cells to produce viral particles; (iii) Collect and concentrate the viral supernatant to obtain the recombinant lentivirus particles.

3. The preparation method according to claim 2, characterized in that: The nucleotide sequence encoding the CLAUDIN-18.2 protein in step (i) is fused with a Flag tag coding sequence; the backbone of the recombinant lentiviral transfer plasmid is pLVX.

4. The preparation method according to claim 1, characterized in that: The immature dendritic cells mentioned in step S1 are obtained by the following method: Adherent mononuclear cells isolated from the peripheral blood of mammalian individuals, or bone marrow cells flushed out of the bone marrow of mice; The dendritic cell precursors were induced and cultured in a medium containing GM-CSF and IL-4 to obtain the immature dendritic cells.

5. The preparation method according to claim 4, characterized in that: During the induction culture, the concentration of GM-CSF was 20-100 ng / mL, and the concentration of IL-4 was 10-50 ng / mL.

6. The preparation method according to claim 1, characterized in that: In step S2, the gene transduction step is performed on day 5 to day 6 of the induced culture of the immature dendritic cells; the infection multiplicity used during gene transduction is 50 to 300.

7. The preparation method according to claim 6, characterized in that: The gene transduction was performed in the presence of a polygel at a concentration of 6-10 µg / mL.

8. The preparation method according to claim 1, characterized in that: In step S3, the maturation-promoting stimulus is the addition of TNF-α, and the concentration of TNF-α used is from 5 ng / mL to 20 ng / mL.

9. A dendritic cell vaccine targeting Claudin-18.2, characterized in that: Prepared by the method according to any one of claims 1 to 8.

10. Use of a dendritic cell vaccine targeting Claudin-18.2 as described in claim 9 in the preparation of a medicament for treating Claudin-18.2-positive gastric cancer.

Images