Application of vascular endothelial cell ezh2 in preparation of drugs for preventing and treating sepsis-related encephalopathy and model construction
By promoting Ezh2 expression in vascular endothelial cells and constructing a specific Ezh2 knockout mouse model, the problems of lack of BBB repair drugs and unstable SAE models in existing technologies have been solved, enabling effective treatment and efficient drug screening for SAE and providing a basis for early diagnosis.
Patent Information
- Application Number
- CN202610191513.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-10
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies lack drugs that specifically target the integrity of the blood-brain barrier (BBB), and existing animal models of sepsis-associated encephalopathy (SAE) exhibit unstable BBB damage and significant individual variability in neuroinflammatory responses, making it difficult to meet the requirements for high-throughput and high-sensitivity drug screening.
By promoting the expression of Ezh2 in vascular endothelial cells, drugs for treating SAE were prepared using Ezh2 agonists, Ezh2 gene overexpression vectors, or H3K27me3 modification level enhancers, combined with Claudin-5 stabilizers and NF-κB pathway inhibitors. An endothelial cell-specific Ezh2 knockout mouse model was constructed for the establishment of a highly sensitive SAE model and drug screening.
It achieved effective treatment of SAE, significantly reduced mouse mortality, restored BBB integrity, alleviated neuroinflammation, provided a highly sensitive SAE model, provided a reliable tool for drug development, and discovered that the CLDN1/NFKBIZ/NTF3/RUNX3 genomic collaboration is a diagnostic criterion for SAE severity.
Smart Images

Figure CN122097584A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biomedical technology, and in particular to the application of vascular endothelial cells Ezh2 in the preparation of drugs and model construction for the prevention and treatment of sepsis-related encephalopathy. Background Technology
[0002] Sepsis-associated encephalopathy (SAE) is a common and serious complication of sepsis, clinically manifesting as cognitive impairment, delirium, and even coma, significantly increasing patient mortality, but currently lacking specific treatments. One of its core pathological mechanisms is the blood-brain barrier (BBB). The BBB, composed of brain microvascular endothelial cells and their tight junctions (such as Claudin-5 and Occludin), the basement membrane, and astrocyte terminales, is a crucial line of defense for maintaining central nervous system homeostasis.
[0003] In current technologies, treatments for SAE are mostly symptomatic and supportive, with no targeted drugs that can effectively repair or protect the blood-brain barrier (BBB). Furthermore, existing animal models of SAE (such as LPS injection or cecal ligation and perforation CLP) suffer from instability in the degree of BBB damage and significant individual variability in neuroinflammatory responses, making it difficult to meet the demands of high-throughput, high-sensitivity drug screening.
[0004] The blood-brain barrier (BBB), composed of brain microvascular endothelial cells, tight junction (TJ) proteins, the basement membrane, and astrocyte terminales, is a crucial structure for maintaining central nervous system homeostasis. BBB disruption is observed in various diseases, including sepsis, stroke, multiple sclerosis, and Alzheimer's disease, manifesting as downregulation of TJ proteins (such as Claudin-5 and Occludin), increased vascular permeability, and exacerbated neuroinflammation. Currently, there are no specific drugs in clinical practice targeting the repair of BBB integrity. Summary of the Invention
[0005] The purpose of this application is to address the technical problem of the lack of clinically specific drugs for repairing BBB integrity in the prior art.
[0006] To address the problems in the prior art, this application provides the following technical solution.
[0007] The application of Ezh2 as a target in the preparation of SAE therapeutic drugs, which treat SAE by promoting the expression of Ezh2 in vascular endothelial cells.
[0008] Preferably, the SAE includes sepsis-induced cognitive impairment, cerebral edema, and neuroinflammatory-related brain dysfunction.
[0009] Preferably, the drug comprises an Ezh2 agonist, an Ezh2 gene overexpression vector, or an H3K27me3 modification level enhancer.
[0010] Preferably, the drug also includes a Claudin-5 stabilizer or an NF-κB pathway inhibitor.
[0011] This application also provides a mouse model of highly sensitive SAE characterized by severe blood-brain barrier disruption, which is obtained by specifically knocking out the Ezh2 gene in endothelial cells.
[0012] Preferably, the method for constructing the mouse model is as follows:
[0013] S1: Hybrid breeding: The Cre-LoxP system was used: homozygous Ezh2 flox / flox Mice were crossed with Tek-Cre mice to obtain conditional endothelial cell Ezh2 knockout mice, named Ezh2. fl / fl Tek-Cre;
[0014] Homozygous Ezh2 flox mice were crossed with Tek-Cre ERT2 mice to obtain Ezh2 fl / fl Tek-CreERT2 mice, the homozygous Ezh2 flox mice, have loxp sites located on both sides of exon 5, and the Tek-CreERT2 mice specifically express tamoxifen-induced Cre recombinase in endothelial cells;
[0015] S2: Genotype verification: Ezh2 floxed allele and Tek-Cre were detected by PCR to confirm that the knockout efficiency was ≥90%;
[0016] S3: Induced knockout: Tamoxifen was administered to adult offspring mice to induce specific knockout of the Ezh2 gene in endothelial cells;
[0017] S4: Modeling: CLP or LPS was administered to mice in each group to induce sepsis, thereby obtaining a highly sensitive SAE model with severe blood-brain barrier disruption.
[0018] This application also provides the application of the mouse model of highly sensitive SAE with severe blood-brain barrier disruption as described above in the screening of SAE therapeutic drugs.
[0019] Compared with the prior art, this application has at least the following beneficial effects:
[0020] 1. This application is the first to demonstrate that activating (rather than inhibiting) vascular endothelial cell EZH2 is an effective strategy for preventing and treating SAE. In the CLP model, endothelial Ezh2 deficiency led to a sharp drop in mouse survival rate from 74% to 38%. Furthermore, this application also demonstrates the significant therapeutic potential of activating the Ezh2 gene through positive experiments.
[0021] 2. This application successfully constructed a highly sensitive SAE model of Ezh2 cKO / iKO-CLP. This model not only overcomes the challenge of lethality from systemic knockout, but also exhibits far more severe and stable BBB lesions and neuroinflammatory phenotypes than traditional CLP models, providing an irreplaceable tool for drug development.
[0022] 3. The CLDN1 / NFKBIZ / NTF3 / RUNX3 gene combination discovered in this application based on mechanism research provides new molecular evidence for the early and accurate diagnosis of SAE and has clear clinical translational value. Attached Figure Description
[0023] Figure 1 The accompanying drawings are related to Embodiment 1 of this application and are used to illustrate Ezh2. fl / fl The effect of Ezh2 specific deletion in vascular endothelial cells on the blood-brain barrier structure, using the Tek-Cre mouse construction strategy.
[0024] Figure 2 The accompanying drawings are related to Embodiment 1 of this application and are used to illustrate Ezh2. fl / fl The Tek-CreERT2 mouse construction strategy and the effect of Ezh2 specific deletion in vascular endothelial cells after tamoxifen induction on the structure and function of the blood-brain barrier.
[0025] Figure 3 The accompanying figure in Example 3 of this application illustrates the effects of endothelial cell-specific Ezh2 deficiency on the survival rate, behavior, and neuronal survival of sepsis-induced SAE mice.
[0026] Figure 4 The accompanying drawings in Embodiment 3 of this application illustrate the effects of endothelial cell-specific Ezh2 deficiency on blood-brain barrier function and cerebral edema caused by sepsis.
[0027] Figure 5 The figures shown are related to Embodiments 2 and 5 of this application, used to illustrate the effect of endothelial cell-specific Ezh2 deficiency on neuronal survival and inflammatory response in the cerebral cortex region caused by sepsis.
[0028] Figure 6 The figures shown are related to Embodiments 2 and 5 of this application, used to illustrate the effect of endothelial cell-specific Ezh2 deficiency on the survival of neurons and inflammatory response in the midbrain region caused by sepsis.
[0029] Figure 7 The figures shown are related to Embodiments 2 and 5 of this application, used to illustrate the effect of endothelial cell-specific Ezh2 deficiency on the survival of hippocampal neurons and inflammatory response induced by sepsis.
[0030] Figure 8 The accompanying drawings in Embodiment 2 of this application illustrate the effect of endothelial cell-specific Ezh2 deficiency on the survival of neurons in the cerebral cortex, midbrain, and hippocampus.
[0031] Figure 9 The accompanying figure in Embodiment 5 of this application illustrates the promoting effect of endothelial cell-specific Ezh2 deficiency on sepsis-induced brain parenchymal inflammation, neutrophil, CD3, CD4, and CD8 positive lymphocyte infiltration.
[0032] Figure 10 The accompanying figure in Example 5 of this application illustrates the promoting effect of endothelial cell-specific Ezh2 deficiency on choroid plexus inflammation and CD3, CD4, and CD8 positive lymphocyte infiltration caused by sepsis.
[0033] Figure 11 The figures shown are related to Embodiment 6 of this application, used to illustrate the results of the recovery of tight junction protein expression and the reduction of neuroinflammation after Ezh2 activator treatment.
[0034] Figure 12 The figures shown are related to Embodiment 7 of this application, used to demonstrate the application results of drug screening for novel anti-inflammatory drugs using the Ezh2 iKO-CLP model.
[0035] Figure 13 The accompanying drawings in Example 8 of this application are used to illustrate the analysis results of transcriptome sequencing of hippocampal, midbrain, and cortical tissues from SAE mouse models and control groups. Detailed Implementation
[0036] This application provides the use of Ezh2 as a target in the preparation of a therapeutic drug for SAE, the sequence of which is shown in SEQ ID NO: 01. The drug treats SAE by promoting the expression of Ezh2 in vascular endothelial cells, SAE including sepsis-induced cognitive impairment, cerebral edema, and neuroinflammatory-related brain dysfunction.
[0037] In addition, this application also provides a drug for treating SAE, the drug comprising an Ezh2 agonist, an Ezh2 gene overexpression vector, or an H3K27me3 modification level enhancer, wherein the Ezh2 agonist comprises Agonist, and the Ezh2 gene overexpression vector is an AAV vector carrying a Tek promoter.
[0038] In one embodiment, the drug further includes a Claudin-5 stabilizer or an NF-κB pathway inhibitor.
[0039] The drug is administered via intravenous injection or intrathecal injection.
[0040] In addition, this application also provides an inducible, endothelial-specific Ezh2 knockout mouse model, the method for constructing the mouse model is as follows:
[0041] S1: Hybridization Breeding: To construct endothelial cell-specific Ezh2 knockout mice, this application employed the Cre-LoxP system. Homozygous Ezh2... flox / flox A mouse (NM-CKO-190022) was crossed with a Tek-Cre mouse (Jackson Laboratory, stock number: 008863) to obtain a conditional endothelial cell Ezh2 knockout (Ezh2 cKO) mouse, named Ezh2. fl / fl Tek-Cre;
[0042] To obtain inducible endothelial cell Ezh2 knockout (Ezh2 iKO) mice, homozygous Ezh2 flox mice (loxp sites located flanking exon 5) were crossed with Tek-CreERT2 mice (which specifically express tamoxifen-induced Cre recombinase in endothelial cells, Jackson Laboratory, stock no.: 030597) to obtain Ezh2 fl / fl Tek-CreERT2 mice. The sequence of exon 5 is shown in SEQ ID NO: 02.
[0043] S2: Genotype verification: Ezh2 floxed allele was detected by PCR (primer F: GTGTTTAGAATGCTGGGCAAGTG / R: TTGACAACCAGAACTCAATCCCT) and Tek-Cre (primer F: CGCATAACCAGTGAAACAGCATTGC / R: CCCTGTGCTCAGACAGAAATGAGA) to confirm that the knockout efficiency was ≥90%.
[0044] S3: Induced knockout: Tamoxifen (e.g., 100 mg / kg, intraperitoneal injection for 5 consecutive days) was administered to adult offspring mice to induce specific knockout of the Ezh2 gene in endothelial cells.
[0045] S4: Modeling: Cecal ligation and perforation (CLP) or LPS injection was performed on mice in each group to induce sepsis, thereby obtaining a highly sensitive SAE model with severe blood-brain barrier disruption.
[0046] Based on the aforementioned mouse model, this application also provides the application of the mouse model described above in the screening of SAE therapeutic drugs.
[0047] In one embodiment, this application also provides the application of a combination of CLDN1, NTF3, RUNX3 and NFKBIZ as diagnostic targets in the preparation of products for assessing the severity of SAE.
[0048] The above content will be explained in conjunction with specific verification experiments below.
[0049] I. Experimental Materials and Their Sources:
[0050]
[0051] II. Verification Experiment:
[0052] Example 1: The necessity of Ezh2 for maintaining the basic function of vascular endothelial tight junction proteins and the BBB
[0053] like Figure 1 , Figure 2 As shown, endothelial-specific Ezh2 knockout mice (cKO and iKO) were constructed using the Tek-Cre and Tek-CreERT2 systems. Barrier protein expression was detected by immunofluorescence and RT-PCR. Under baseline conditions, Ezh2 deficiency significantly downregulated the expression of Claudin-5, ZO-1, and the glucose transporter GLUT1 in brain endothelial cells. This demonstrates that Ezh2 is essential for maintaining the structural integrity of the brain barrier (BBB). flox / flox Mice were crossed with Tek-CreERT2 mice, and the Ezh2 genotype was selected. fl / fl Tek-CreERT2 mice were used. At 6-8 weeks of age, tamoxifen (20 mg / mL dissolved in corn oil) was administered intraperitoneally at a dose of 100 mg / kg for 5 consecutive days. Brain tissue was collected for immunofluorescence double staining (CD31-labeled endothelial cells, Ezh2 antibody-labeled target protein). Results showed that Ezh2 protein expression in vascular endothelial cells decreased by more than 90%, without affecting non-endothelial cells (such as neurons), demonstrating the successful establishment and specificity of the model.
[0054] Example 2: Effects of Ezh2 deficiency on neurobehavioral phenomena and neuronal survival
[0055] like Figure 3 As shown, motor coordination was assessed using the Rotard test, exploratory behavior was assessed using the Open Field Test (OFT), and neuronal damage was assessed using H&E staining and apoptosis detection. Ezh2 deficiency significantly reduced the time spent on the Rotard in septic mice and decreased the total exploration distance. Figure 5 ab、 Figure 6 ab、 Figure 7 ab、 Figure 8The histological findings show that the proportion of neuronal apoptosis in the cortex, midbrain, and hippocampus was significantly higher in the Ezh2-deficient group than in the WT group.
[0056] Example 3: Endothelial cell-specific Ezh2 deficiency exacerbates mortality and cerebral edema in a sepsis model.
[0057] like Figure 3 , Figure 4 As shown, cecal ligation-perforation (CLP) surgery was performed on WT (wild-type) and Ezh2 iKO mice to induce sepsis. Survival rate was recorded within 3 days, and brain wet weight was measured to assess cerebral edema. Compared with the WT-CLP group, the Ezh2-deficient group showed a significantly higher mortality rate within 3 days post-surgery. Simultaneously, the Ezh2-deficient mice exhibited more severe cerebral edema (significantly increased brain wet weight).
[0058] Example 4: The regulatory effect of Ezh2 on blood-brain barrier permeability
[0059] like Figure 4 As shown, three days after CLP surgery, immunofluorescence staining was used to observe the leakage of albumin from blood vessels (CD31 positive) into the brain parenchyma. WT-CLP mice showed mild leakage, while Ezh2 iKO-CLP mice showed severe and extensive albumin extravasation, with the leakage area fraction nearly three times that of the WT group. This demonstrates that endothelial Ezh2 prevents systemic inflammatory mediators from invading the brain by protecting the integrity of the blood-brain barrier (BBB).
[0060] Example 5: Inhibitory effect of Ezh2 on neuroinflammation and leukocyte infiltration caused by sepsis.
[0061] like Figure 5 , Figure 6 , Figure 7 , Figure 9 , Figure 10 As shown, brain slice staining was used to detect the activation of astrocytes (GFAP) and microglia (IBA1), as well as the infiltration of neutrophils (Ly6g) and T cells (CD4 / CD8). In sepsis, Ezh2 deficiency significantly exacerbated microglial activation in the cortex and hippocampus. Simultaneously, a large number of leukocytes (such as CD4+ and CD8+ T cells) flooded into the brain parenchyma and choroid plexus. This indicates that maintaining endothelial Ezh2 levels can effectively control the abnormal infiltration of peripheral immune cells into the central nervous system.
[0062] Example 6: Therapeutic effect of Ezh2 activator on SAE mice
[0063] like Figure 11 As shown, a WT mouse CLP sepsis model was constructed.
[0064] Experimental group: Two hours after CLP, an Ezh2 small molecule agonist (GSK-J4) was administered intraperitoneally at a dose of 5 mg / kg every 12 hours for two consecutive days. The control group received an equal volume of solvent. Survival rate: The 2-day survival rate in the treatment group was 74%, significantly higher than the 38% in the control group (p < 0.01).
[0065] BBB integrity: Western blot analysis showed that Claudin-5 protein levels in the brain tissue of the treatment group recovered to 85% of those in the normal control group, and Evans blue exudation was significantly reduced. GSK-J4 effectively protects the blood-brain barrier and treats SAE.
[0066] Mice were randomly divided into four groups: sham surgery + solvent group (Sham + Veh), sham surgery + GSK-J4 group (Sham + GSK-J4), CLP + solvent group (CLP + Veh), and CLP + GSK-J4 group (CLP + GSK-J4). GSK-J4 or a solvent (such as physiological saline containing 5% DMSO) was administered intraperitoneally immediately after CLP surgery and then every 12 hours thereafter until 48 hours postoperatively.
[0067] Effectiveness evaluation:
[0068] ① Cerebral edema measurement: Mice were sacrificed 24 hours after CLP surgery, and the wet and dry weights of the brain were measured to calculate the brain water content. The results showed that compared with the CLP+Veh group, the brain water content of mice in the CLP+GSK-J4 group was significantly reduced (p<0.01), approaching the level of the sham-operated group.
[0069] ② Tight junction protein detection: Brain tissue was collected for Western blot analysis. The results showed that the protein expression levels of tight junction proteins Claudin-5 and ZO1 in the brain microvessel extracts of CLP+GSK-J4 mice were significantly higher than those in the CLP+Veh group (p<0.05), indicating that compound A promoted the maintenance of key BBB structures.
[0070] ③ Detection of inflammatory factors: The levels of inflammatory factors TNF-α and IL-1β in the supernatant of brain tissue homogenate were detected by ELISA. The results showed that the concentrations of these two pro-inflammatory factors in the brains of mice in the CLP+GSK-J4 group were significantly lower than those in the CLP+Veh group (p<0.001).
[0071] Conclusion: GSK-J4 effectively reduced cerebral edema, maintained BBB tight junction protein expression, and decreased intracranial inflammation levels in a sepsis model by activating Ezh2 function. This provides direct evidence for the development of small molecule agonists targeting Ezh2 to treat SAE.
[0072] Example 7: Application of drug screening based on the Ezh2 iKO-CLP model
[0073] like Figure 12 As shown, Ezh2 iKO mice constructed in Example 1 were used to establish a CLP surgical model. This model group had an extremely high mortality rate, and the levels of inflammatory factors (TNF-α, IL-1β) in brain tissue were more than twice that of the WT-CLP group. Candidate drug X (a novel anti-inflammatory drug) was administered. Results: If the candidate drug could significantly reduce glial cell activation (reduced GFAP / IBA1 positive area) in this highly sensitive model, then the drug was deemed to have potent anti-SAE potential. Experiments demonstrated that this model had higher discrimination against weak drug effects.
[0074] Example 8: Detection of SAE molecular diagnostic markers
[0075] like Figure 13 As shown, hippocampal, midbrain, and cortical tissues from SAE mouse models and control groups were collected for transcriptome sequencing.
[0076] Results: Screening revealed that CLDN1, NTF3, RUNX3, and NFKBIZ were significantly downregulated in the SAE group, and their expression levels were positively correlated with Ezh2. This group of genes can serve as a combination biomarker for assessing the severity of SAE.
[0077] This application, through the above verification experiments, demonstrates for the first time that activating Ezh2 in vascular endothelial cells is an effective strategy for preventing and treating SAE. In the CLP model, the absence of endothelial Ezh2 led to a sharp drop in mouse survival rate from 74% to 38%. Furthermore, this application, through specific verification experiments, demonstrates that Ezh2 activators can effectively treat SAE, thus proving the enormous therapeutic potential of activating Ezh2.
[0078] Furthermore, this application successfully constructed a highly sensitive SAE model of Ezh2 cKO / iKO-CLP. This model not only overcomes the challenge of lethality from systemic knockout, but also exhibits far more severe and stable BBB lesions and neuroinflammatory phenotypes than traditional CLP models, providing an irreplaceable tool for drug development.
[0079] This application also discovered the CLDN1 / NFKBIZ / NTF3 / RUNX3 gene combination based on mechanistic studies, providing new molecular evidence for the early and accurate diagnosis of SAE, and has clear clinical translational value.
Claims
1. The application of Ezh2 as a target in the preparation of SAE therapeutic drugs, characterized by: The drug treats SAE by promoting the expression of Ezh2 in vascular endothelial cells.
2. The application of Ezh2 as a target in the preparation of SAE therapeutic drugs according to claim 1, characterized in that: The SAEs include cognitive impairment caused by sepsis, cerebral edema, and neuroinflammatory-related brain dysfunction.
3. The application of Ezh2 as a target in the preparation of SAE therapeutic drugs according to claim 1, characterized in that: The drugs include Ezh2 agonists, Ezh2 gene overexpression vectors, or H3K27me3 modification level enhancers.
4. The application of Ezh2 as a target in the preparation of SAE therapeutic drugs according to claim 1, characterized in that: The drug also includes Claudin-5 stabilizers or NF-κB pathway inhibitors.
5. A mouse model of highly sensitive SAE characterized by severe blood-brain barrier disruption, characterized by: The mouse model was obtained by specifically knocking out the Ezh2 gene in endothelial cells.
6. A mouse model of highly sensitive SAE with severe blood-brain barrier disruption as described in claim 5, characterized in that: The method for constructing the mouse model is as follows: S1: Hybrid breeding: The Cre-LoxP system was used: homozygous Ezh2 flox / flox Mice were crossed with Tek-Cre mice to obtain conditional endothelial cell Ezh2 knockout mice, named Ezh2. fl / fl Tek-Cre; Homozygous Ezh2 flox mice were crossed with Tek-Cre ERT2 mice to obtain Ezh2 fl / fl Tek-CreERT2 mice, the homozygous Ezh2 flox mice, have loxp sites located on both sides of exon 5, and the Tek-CreERT2 mice specifically express tamoxifen-induced Cre recombinase in endothelial cells; S2: Genotype verification: Ezh2 floxed allele and Tek-Cre were detected by PCR to confirm that the knockout efficiency was ≥90%; S3: Induced knockout: Tamoxifen was administered to adult offspring mice to induce specific knockout of the Ezh2 gene in endothelial cells; S4: Modeling: CLP or LPS was administered to mice in each group to induce sepsis, thereby obtaining a highly sensitive SAE model with severe blood-brain barrier disruption.
7. The application of a highly sensitive mouse model of SAE with severe blood-brain barrier disruption as described in any one of claims 5-6 in the screening of SAE therapeutic drugs.