Pseudomonas asiatica hnhmp s-260 and application thereof

The use of fermentation supernatant of Pseudomonas Asiana HNHMPs-260 for the control of root-knot nematode disease in cantaloupe solves the problems of environmental pollution and resistance of chemical pesticides, achieves full-process control of root-knot nematodes and promotes the growth of cantaloupe, and has the effects of efficient and stable biological control and growth promotion.

CN122104488APending Publication Date: 2026-05-29INST OF PLANT PROTECTION HAINAN ACAD OF AGRI SCI (HAINAN ACAD OF AGRI SCI AGRI PROD QUALITY SAFETY & STANDARDS RES CENT)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610029827.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-10
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing chemical pesticides for controlling root-knot nematode disease in cantaloupe pose risks of environmental pollution and pesticide resistance. Furthermore, biocontrol agents have limited efficacy and unstable active substances, making it difficult to achieve the dual effects of "disease prevention" and "growth promotion".

Method used

The fermentation supernatant of Pseudomonas Asiana HNHMPs-260 was used to kill and inhibit root-knot nematodes at multiple life stages and had a significant growth-promoting function. The fermentation supernatant still maintained more than 80% of its nematicidal activity at high temperatures.

Benefits of technology

It achieves comprehensive control over root-knot nematodes, significantly reduces the soil nematode population, improves cantaloupe growth indicators, and has efficient and stable biological control and growth-promoting effects, while reducing the risk of environmental pollution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104488A_ABST
    Figure CN122104488A_ABST
Patent Text Reader

Abstract

The application relates to the field of microbial technology and discloses a Pseudomonas asiatica HNHMPs-260 and application thereof. The strain is preserved in the Guangdong Microbial Culture Collection Center, and the preservation number is GDMCC No: 66854. Fermentation supernatant of the strain can prevent and treat root-knot nematode disease of Hami melon caused by Meloidogyne javanica. Experiments show that the fermentation supernatant has strong toxic effects on second instar larvae of root-knot nematodes and can significantly inhibit the hatching of egg masses and egg grains. In addition, the fermentation supernatant has good thermal stability and storage stability, and still maintains more than 80% nematocidal activity after high-temperature treatment at 121 DEG C and long-term storage at 4 DEG C. Meanwhile, the fermentation supernatant of the strain can promote the growth of Hami melon plants, improve physiological indexes such as root length, stem length, fresh weight and dry weight, and has the application potential of being developed into efficient, environment-friendly and multifunctional biological pesticides.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology and relates to an Asian pseudomonad bacterium HNHMPs-260 and its applications. Background Technology

[0002] cantaloupe( Cucumis melo var. saccharinus As an important economic crop in my country, especially in high-altitude areas such as Hainan, the healthy development of its industry is of great significance to the regional economy. However, the root-knot nematode (Eriocheir sinensis) Meloidogyne enterolobii Root-knot nematode disease caused by this pathogen has become a key obstacle to the sustainable development of the melon industry. This pathogenic nematode ravages continuously cropped fields, leading to morbidity rates as high as 30%-80% and yield losses exceeding 40%, causing huge economic losses to melon farmers.

[0003] Currently, the prevention and control of this disease still heavily relies on chemical nematicides. However, chemical pesticides have insurmountable drawbacks: firstly, their high toxicity and high residue characteristics lead to serious environmental pollution and agricultural product safety risks; secondly, long-term use easily causes nematodes to develop resistance, resulting in reduced efficacy; and thirdly, while killing pathogenic nematodes, chemical pesticides also destroy beneficial microbial communities in the soil, affecting soil health.

[0004] Biological control, as a green and sustainable alternative, has become a research hotspot. Among them, *Pseudomonas* spp. (… Pseudomonas Biocontrol microorganisms, such as [specific examples of biocontrol agents], have attracted much attention due to their abundant metabolites and growth-promoting abilities. However, the practical application of biocontrol agents currently faces a series of key technical bottlenecks: 1. Limited control effect: Many biocontrol agents have a single target, which can only kill second-instar larvae or inhibit egg masses, making it difficult to block the entire life cycle of root-knot nematodes, resulting in unstable and incomplete control.

[0005] 2. Poor stability of biocontrol active substances: Most active metabolites produced by microbial fermentation are sensitive to heat and storage conditions, and are easily inactivated during processing, transportation and storage, which seriously restricts their commercial development and application.

[0006] 3. Disconnect between growth-promoting and biocontrol effects: In existing technologies, strains with biocontrol functions may not have significant growth-promoting functions, and vice versa. It is difficult to achieve the dual benefits of "disease prevention" and "growth promotion", which reduces the overall value and cost-effectiveness of the product.

[0007] Therefore, there is an urgent need in this field to find and develop a biocontrol strain that can act on multiple life stages of root-knot nematodes simultaneously, whose active substances have excellent stability, and which also has significant growth-promoting functions, in order to overcome the shortcomings of existing technologies and provide a new generation of efficient, stable, and multifunctional solutions for the green control of root-knot nematode disease in cantaloupe. Summary of the Invention

[0008] The purpose of this invention is to provide an Asian Pseudomonas bacterium. Pseudomonas asiatica The study also presented its application in controlling root-knot nematode disease in cantaloupe. Further identification showed that the fermentation supernatant of this strain can control root-knot nematode disease in cantaloupe caused by the bean weevil root-knot nematode. Experiments showed that the fermentation supernatant has a strong toxic effect on second-instar larvae of the root-knot nematode and can significantly inhibit the hatching of egg masses and eggs. Furthermore, the fermentation supernatant exhibits good thermal and storage stability, retaining over 80% of its nematicidal activity after long-term storage at 121℃ and 4℃. Simultaneously, the fermentation supernatant of this strain can also promote cantaloupe plant growth, increasing physiological indicators such as stem length, fresh weight, and dry weight, demonstrating its potential for development into a highly efficient, environmentally friendly, and multifunctional biological pesticide.

[0009] To achieve the above objectives, the present invention provides the following technical solution: The first aspect of this invention provides a strain of *Pseudomonas aeruginosa* HNHMPs-260. When grown on LB agar plates, this strain forms colonies that are generally flat, slightly raised above the surface of the medium, and mostly circular, although the edges are not perfectly regular, showing faint wavy and serrated edges. The colonies are grayish-white, dull in color, without obvious luster, and evenly distributed across the entire colony surface. The colony surface is smooth with a certain degree of gloss; when picked up with an inoculation loop, the texture feels relatively soft, and the colonies exhibit a certain degree of moisture.

[0010] The strain has the accession number GDMCC No: 66854, the accession date is August 18, 2025, and the accession classification name is *Pseudomonas aeruginosa*. Pseudomonas asiatica The depository is Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, Postcode: 510070, Tel: 020-87137633.

[0011] The second aspect of the present invention provides the fermentation supernatant of the strain HNHMPs-260.

[0012] The fermentation conditions for strain HNHMPs-260 are as follows: (1) Preparation of fermentation seed liquid: single colonies of activated strain HNHMPs-260 were picked and inoculated into a conical flask containing 250 mL of BPY liquid medium and placed in a shaker and incubated at 37°C and 180 rpm for 12 h. (2) Preparation of fermentation broth: The fermentation seed liquid was inoculated into a conical flask containing 500 mL of BPY liquid culture medium at a ratio of 1% (volume ratio), and placed in a shaker and cultured at 37°C and 180 rpm for 48 h to obtain the fermentation broth; (3) Preparation of fermentation supernatant: The fermentation broth was pipetted into a 50 mL centrifuge tube and centrifuged at 12000 rpm for 10 min at 4℃. The supernatant was then drawn up with a syringe, filtered through a 0.22 μm filter membrane for sterilization, and the supernatant was stored at 4℃ for later use.

[0013] The third aspect of the present invention provides the application of the above-mentioned fermentation supernatant, the application being any of the following: (1) the application in the prevention and control of root-knot nematode disease of cantaloupe caused by root-knot nematode of bean weevils.

[0014] (2) Application in plant growth promotion, wherein the plant is cantaloupe; the growth promotion is to increase the stem length, fresh weight and dry weight of cantaloupe.

[0015] (3) Application in the production of bio-organic fertilizer suitable for Hami melons.

[0016] The fourth aspect of the present invention provides a bio-organic fertilizer containing the above-mentioned fermentation supernatant.

[0017] The beneficial effects of this invention are: (1) Significant biological control effect: The fermentation supernatant of the strain provided by this invention has highly efficient direct nematode killing activity and has a strong direct toxic effect on second-instar larvae of root-knot nematodes. The corrected mortality rate of the fermentation liquid after 48 hours is as high as 96.78% within 12 hours. It can not only kill larvae, but also significantly inhibit the hatching of egg masses and has a strong inhibitory and toxic effect on eggs. This full-process attack mode of "larva-egg mass-egg" can effectively reduce the base number of nematodes in the soil from the root and block their life cycle. The control effect is more lasting and more thorough than that of agents that only target a single insect stage. Pot experiment showed that after applying the fermentation supernatant, the number of root knots, the number of egg masses and the soil insect population density of cantaloupe were significantly reduced by about 48.9%, 53.5% and 68.4% respectively compared with the disease control group, and the disease control effect was extremely significant.

[0018] (2) Significant plant growth-promoting effect: Under the stress of root-knot nematodes, the application of this fermented liquid can restore the growth indicators of Hami melon, such as stem length, fresh weight, and dry weight, to a level close to that of healthy plants; even in healthy soil without nematode damage, this fermented liquid can still directly promote the growth of Hami melon, increasing the root length, stem length, fresh weight, and dry weight by about 1.87%-8.23% compared to the water control group, thus achieving the dual effects of "disease prevention" and "growth promotion".

[0019] (3) Excellent thermal stability and good storage stability: The active substances in the fermentation supernatant are extremely stable. Even after treatment at 121°C for 30 minutes, the lethality against nematodes remains above 80%. This characteristic overcomes the bottleneck of many biological agents' active substances being intolerant to high temperatures; after storage at 4°C for 30 days, the fermentation broth still retains about 80% of its nematicidal activity. This provides a solid guarantee for the production, transportation, storage, and shelf life of the product, greatly reducing the difficulty and cost of commercialization.

[0020] (4) High biosafety: As a microbial preparation, it can reduce the use of highly toxic and persistent chemical pesticides, and help alleviate problems such as environmental pollution, pesticide residues and ecosystem damage. Attached Figure Description

[0021] Figure 1 The images show the colony morphology of Pseudomonas Asiana HNHMPs-260 and its toxicity effect on second-instar larvae of root-knot nematodes in Example 1 of this invention. Figure 2 This is a graph showing the Gram detection results of Pseudomonas Asiana HNHMPs-260 in Example 1 of this invention; Figure 3 This is a diagram showing the BIOLOG microbial identification results of Pseudomonas Asiana HNHMPs-260 in Example 1 of this invention; Figure 4 This is a phylogenetic tree diagram of the Asian Pseudomonas HNHMPs-260 strain constructed from the 16S rDNA gene sequence in Example 1 of the present invention. Figure 5 This is a diagram illustrating the effect of the fermentation broth of Pseudomonas Asianae HNHMPs-260 strain on inhibiting egg mass hatching in Example 2 of this invention. Figure 6 This is a diagram illustrating the effect of the fermentation broth of Pseudomonas Asianae HNHMPs-260 strain on killing egg masses in Example 2 of this invention. Figure 7 This is a diagram illustrating the effect of the fermentation broth of Pseudomonas Asianae HNHMPs-260 strain on inhibiting egg hatching in Example 2 of this invention. Figure 8 This is a graph showing the toxicity effect of the fermentation broth of Pseudomonas aeruginosa HNHMPs-260 strain in Example 3 of the present invention on second-instar larvae of root-knot nematodes under different temperature and storage days. Figure 9 This is a diagram illustrating the biocontrol effect of the fermentation broth of Pseudomonas Asianae HNHMPs-260 strain on cantaloupe crops in Example 3 of the present invention. Figure 10 This image shows the effect of the fermentation broth of Pseudomonas Asiana HNHMPs-260 strain on the growth-promoting effect of cantaloupe in Example 3 of this invention. Detailed Implementation

[0022] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0023] Explanation of the sequence list: SEQ ID NO: 1 SEQ ID NO: 2: AGAGTTTGATCCTGGCTCAG SEQ ID NO: 3: GGTTACCTTGTTACGACTT Example 1: Isolation and identification of Pseudomonas Asiana HNHMPs-260 The Asian Pseudomonas aeruginosa HNHMPs-260, resistant to root-knot nematode disease of cantaloupe, was obtained by culturing and identifying in the laboratory under the following conditions from the rhizosphere soil of cantaloupe planting fields in Tongtian Village, Xinlong Town, Dongfang City, Hainan Province.

[0024] Method for obtaining Pseudomonas Asianae HNHMPs-260: Select a suitable soil sample. Weigh 10.0 g of soil and place it into a sterilized Erlenmeyer flask containing 3-5 sterile glass beads and 90.0 mL of sterile water. Place the flask in a shaker at 37°C and shake at 180 rpm for 40 min to disperse the soil particles and revive the bacterial strain. Use a pipette to draw 1.0 mL of the soil suspension from the Erlenmeyer flask and inject it into a test tube containing 9.0 mL of sterile water. Shake well and serially dilute the three test tubes to 10 mL. -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 10 -9 10 -10 Nine different test tubes were selected for each gradient, and 200 μL of the gradient dilution was placed in a 200 mL Erlenmeyer flask containing BPY liquid medium. The flasks were then incubated at 37°C and 180 rpm for 48 h on a shaker. The fermentation broth was obtained by centrifugation and used for toxicity testing. Based on the toxicity test results, appropriate gradient solutions were selected for strain screening.

[0025] The Asian Pseudomonas HNHMPs-260 was identified based on colony morphology, individual morphological characteristics, physiological and biochemical characteristics, and phylogenetic tree of 16S rDNA gene sequence.

[0026] The morphology and colony characteristics of this bacterium are as follows: The colonies are generally flat, slightly raised above the surface of the culture medium, and basically circular, although the edges are not completely regular, with faintly visible slight wavy and serrated edges. The colonies are light gray in color, without obvious luster, and are evenly distributed across the entire colony surface. It is a Gram-negative bacterium; the colony surface is smooth with a certain degree of gloss. When picking up a colony with an inoculation loop, its texture feels relatively soft, and a certain degree of moisture can be observed. The colony diameter is 1–2 mm. Figure 1 Colony morphology, Figure 2 This is the result of Gram testing.

[0027] 16S rDNA homology analysis: Using the genomic DNA of this strain as a template, PCR amplification of the 16S rDNA gene was performed using the universal bacterial primers 27-F / 1492-R. The primer sequences were: 27-F: 5'-AGAGTTTGATCCTGGCTCAG-3', 1492-R: 5'-GGTTACCTTGTTACGACTT-3'. The PCR product was a single band, which was recovered, purified, and sequenced. The 16S rDNA sequence of this strain was 1402 bp in length, and the specific nucleotide sequence is shown in SEQ ID NO: 1. The 16S rDNA sequence of this strain was submitted to the GenBank database, and the sequence number was obtained as GenBank NO. SUB14112590. Figure 3 Phylogenetic tree of Asian Pseudomonas HNHMPs-260 strain constructed based on 16S rDNA gene sequence.

[0028] Example 2: Analysis of the effects of Pseudomonas Asiana HNHMPs-260 on root-knot nematodes (second instar larvae, eggs, and granules). Preparation of fermentation supernatant of strain HNHMPs-260: (1) Preparation of fermentation seed liquid: single colonies of activated strain HNHMPs-260 were picked and inoculated into a conical flask containing 250 mL of BPY liquid medium and placed in a shaker and incubated at 37°C and 180 rpm for 12 h. (2) Preparation of fermentation broth: The fermentation seed liquid was inoculated into a conical flask containing 500 mL of BPY liquid culture medium at a ratio of 1% (volume ratio), and placed in a shaker and cultured at 37°C and 180 rpm for 48 h to obtain the fermentation broth; (3) Preparation of fermentation supernatant: The fermentation broth was pipetted into a 50 mL centrifuge tube and centrifuged at 12000 rpm for 10 min at 4℃. The supernatant was then drawn up with a syringe, filtered through a 0.22 μm filter membrane for sterilization, and the supernatant was stored at 4℃ for later use.

[0029] Verification of poisoning against second-instar larvae of root-knot nematodes: A disposable 96-well plate was prepared, and a poisoning system was constructed: a total system of 100 μL, including 20 μL of fermentation supernatant; 50 μL of nematode suspension with a total count of more than 50 nematodes; 10 μL of chloramphenicol at 50 IU / mL; 10 μL of tetracycline at 50 IU / mL; and 10 μL of sterile water. After preparing the poisoning system, it was thoroughly mixed, and the 96-well plate was incubated at 28℃ for 12 h. The poisoning system in the 96-well plate was aspirated and examined under a microscope. 10 μL of 1 mol / L sodium hydroxide was added to each well, and the nematode count was performed after shaking. The nematode count was performed within 3 minutes of this process. Second-instar larvae that did not react to NaOH were defined as dead, while second-instar larvae that changed their body morphology were defined as alive. This was repeated 3 times, and the total number and number of deaths were recorded. The mortality rate and corrected lethality rate were calculated based on these results. The results showed that the fermentation supernatant of the strain had a strong toxic effect on second-instar larvae; after 12 hours of treatment with the fermentation supernatant at 48 hours, the corrected mortality rate was 96.78%. (See Table 1 for mortality rate table.) Figure 1 .

[0030] Table 1 Mortality rate of second-instar larvae of root-knot nematodes

[0031] Verification of hatching inhibition of root-knot nematode egg masses: A disposable 96-well plate was prepared. The system consisted of a total volume of 100 μL, including 20 μL of fermentation supernatant; one well-formed and homogeneous egg mass; 10 μL of 50 IU / mL chloramphenicol; 10 μL of 50 IU / mL tetracycline; and 60 μL of sterile water. After preparation, the 96-well plate was incubated at 28℃. Every 12 h, the 96-well plate was examined under a microscope to observe the hatching of second-instar larvae, recording the number of hatched larvae and taking photographs. The results showed that treatment with a 20% concentration of the bacterial fermentation broth for 24 h resulted in very few second-instar larvae hatching from the egg mass. Even those that hatched were mostly dead. Statistical analysis of hatching numbers at different time points (0, 12, 24, 36, and 48 h) further clarified that the bacterial fermentation broth effectively inhibited egg mass hatching. Figure 5 ).

[0032] Verification of poisoning of root-knot nematode egg masses: (1) Construction of poisoning system: The total system was 100 μL, including 80 μL of fermentation supernatant; one egg mass with good appearance and uniformity; 10 μL of 50 IU / mL chloramphenicol; and 10 μL of 50 IU / mL tetracycline. After the system was prepared, the 96-well plate was placed in a 28℃ incubator for 24 h and then the egg mass was washed with sterile water. Then, 100 μL of sterile water was added to the 96-well plate and the plate was placed in a 28℃ incubator for 24 h. Every 12 h, the 96-well plate was examined under a microscope to observe the hatching of second-instar larvae in the 96-well plate, the number of hatched larvae was recorded, and photographs were taken. The results showed that after the egg masses were transferred to sterile water and incubated for 24 hours, the number of second-instar larvae hatching from the egg masses in the experimental group treated with the bacterial fermentation broth was extremely low. Starting from the time the egg masses were transferred to sterile water, the number of hatchings at different time points (0, 12, 24, 36, and 48 hours) was recorded. This indicated that none of the egg masses in the three experimental groups showed good hatching in sterile water. This suggests that the inhibitory effect of the bacterial fermentation broth on egg hatching was actually due to its toxic effect on the egg masses, causing them to lose their activity. Figure 6 ).

[0033] Hatching inhibition verification of root-knot nematode eggs: Intact eggs were removed from the roots and placed in glass test tubes. The tubes were first cleaned with sterile water, then 10% sodium hypochlorite solution was added to lyse the egg masses. Gently agitate the tubes to ensure thorough lysis. After lysis, all components except the egg masses were transferred to new centrifuge tubes. This process was repeated 3-4 times to ensure as many eggs as possible were transferred. After the new centrifuge tubes stood for 3-5 minutes, a precipitate was clearly visible at the bottom, representing a large number of eggs. The supernatant containing sodium hypochlorite was removed, and the tubes were washed repeatedly with sterile water 3-5 times to minimize sodium hypochlorite residue and avoid affecting subsequent experiments. The poisoning system was constructed as follows: Total system 100 μL, including 20 μL fermentation supernatant; 20 μL solution containing more than 100 eggs; 10 μL chloramphenicol (50 IU / mL); 10 μL tetracycline (50 IU / mL); and 40 μL sterile water. After configuring the system, the 96-well plates were placed in an incubator at 28℃ for constant temperature incubation. Every 12 hours, the 96-well plates were examined under a microscope to observe the hatching of second-instar larvae, and the number of hatched larvae and the total number of eggs were recorded. The hatching rate was calculated based on these records. The results showed that the fermentation broth of the strain had a strong inhibitory effect on egg hatching. At day 7, most eggs in the fermentation broth treatment group showed hollow structures and air bubbles, while the eggs in the two control groups had uniform internal material. Statistical analysis of the number of successfully hatched eggs and the total number of eggs at each stage revealed that the inhibition rate did not change significantly over 7 days, indicating a stable inhibitory effect with an inhibition rate exceeding 90%. Figure 7 ).

[0034] Example 3: Stability analysis of Pseudomonas Asianum HNHMPs-260 The effects of temperature and storage days on the toxic activity of the strain's fermentation supernatant were verified: The fermentation supernatant was treated at -20℃, 4℃, 28℃, 37℃, 45℃, 60℃, 70℃, 80℃, 90℃, 100℃, and 121℃ for 30 min, respectively. After being restored to room temperature, it was centrifuged at 12000 rpm for 10 min. The supernatant was then used for a toxicity test on second-instar larvae of *Heliotropium indicum* root-knot nematodes, and the corrected lethality rate was recorded. Then, fermentation supernatants treated at -20℃, 4℃, 28℃, 37℃, 45℃, and 60℃ were continuously stored for 1, 3, 7, 15, and 30 days, followed by centrifugation and toxicity tests to determine the effects of temperature and storage days on the toxic activity. Each treatment was performed in triplicate, with the original untreated fermentation supernatant as a control, and the corrected lethality rate was recorded. The results showed that the lethality of the fermentation supernatant treated at different temperatures against *Auricularia auricula-judae* root-knot nematodes was relatively stable. Furthermore, at 121℃, the lethality of the fermentation supernatant of strain 260 against nematodes remained above 80%, indicating that the nematicidal activity of the strain's fermentation supernatant did not easily change with heat and exhibited good thermal stability. Storage treatments at different temperatures showed that, compared to storage at 60℃, the nematicidal activity was lost more slowly at -20℃, 4℃, 28℃, 37℃, and 45℃. The stability was best at 4℃, with strain 260 retaining approximately 80% of its nematicidal activity after 30 days of storage at 4℃. Figure 8 ).

[0035] Example 4: Analysis of the biocontrol effect of Pseudomonas Asiana HNHMPs-260 Healthy soil, after removing impurities, was mixed with sterilized substrate at a ratio of 1:3 (by mass). 2.0 kg of the mixed soil was placed in sterilized flowerpots with an inner diameter of 14 cm and a height of 12 cm. The propagated nematodes were then evenly mixed with the soil to achieve a nematode density of 5 nematodes / g. The nematode used in this invention was cantaloupe, and the tested nematode was *Eriocheir sinensis* root-knot nematode. Four treatment groups were set up: CK1: water treatment without *Eriocheir sinensis* root-knot nematode; CK2: water treatment with exogenous *Eriocheir sinensis* root-knot nematode; CK3: sterilized BPY liquid culture medium aseptic fermentation supernatant with exogenous *Eriocheir sinensis* root-knot nematode; T1: fermentation supernatant of strain HNHMPs-260 with exogenous *Eriocheir sinensis* root-knot nematode. 100 mL of 50% HNHMPs-260 strain fermentation supernatant (OD value 0.6) was injected into the soil. Hami melons were transplanted 3 days later, with 5 replicates per treatment group. Samples were taken 45 days after establishment to measure soil insect population density, root knot number, egg sac number, and growth vigor. Results showed that in group T1 treated with HNHMPs-260, the number of root knots, egg sacs, and insect population density decreased by approximately 48.9%, 53.5%, and 68.4% respectively compared to group CK2, while stem length, fresh weight, and dry weight increased by approximately 83.25%, 315.91%, and 333.94% respectively compared to group CK2. (See Table 2 and...) Figure 9 .

[0036] Table 2. Effects of fermentation broth treatment on root-knot nematode disease in cantaloupe.

[0037] Example 5: Analysis of the growth-promoting effect of Pseudomonas Asiana HNHMPs-260 This invention still uses Hami melon crop samples. The experiment included three treatment groups: (1) CK1: water treatment; (2) CK2: sterile fermentation supernatant of sterilized BPY liquid culture medium; (3) T1: fermentation supernatant of strain HNHMPs-260. 100 mL of 50% of the strain's fermentation supernatant (OD value 0.6) was injected, and Hami melons were transplanted after 3 days of treatment. Each treatment had 5 replicates. Samples were taken 45 days after colonization to measure physiological indicators such as stem length, fresh weight, and dry weight. The results showed that the root length, stem length, fresh weight, and dry weight of T1 (fermentation supernatant of strain HNHMPs-260) increased by 1.87%-8.23% compared to CK1, indicating a certain promoting effect. See Table 3 and... Figure 10 .

[0038] Table 3. Effects of fermentation broth treatment on the growth of cantaloupe crops.

[0039] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are only for illustrating the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the protection scope of the present invention. The protection scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. An Asian Pseudomonas ( Pseudomonas asiatica strain HNHMPs-260, characterized in that, The strain HNHMPs-260 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on August 18, 2025, with accession number GDMCCNo: 66854.

2. The strain HNHMPs-260 according to claim 1, characterized in that, The 16S rDNA sequence of strain HNHMPs-260 is shown in SEQ ID NO:

1.

3. The fermentation supernatant of strain HNHMPs-260 according to claim 1, characterized in that, The method for preparing the fermentation supernatant is as follows: (1) Preparation of fermentation seed liquid: single colonies of activated strain HNHMPs-260 were picked and inoculated into a conical flask containing 250 mL of BPY (LB) liquid medium and placed in a shaker and incubated at 37°C and 180 rpm for 12 h. (2) Preparation of fermentation broth: The fermentation seed liquid was inoculated into a conical flask containing 500 mL of BPY liquid culture medium at a volume ratio of 1% and placed in a shaker and cultured at 37℃ and 180 rpm for 48 h to obtain the fermentation broth. (3) Preparation of fermentation supernatant: The fermentation broth was pipetted into a 50 mL centrifuge tube and centrifuged at 12000 rpm for 10 min at 4℃. The supernatant was drawn with a syringe and filtered through a 0.22 μm filter membrane for sterilization. The supernatant was then stored at 4℃ for later use.

4. The application of the fermentation supernatant according to claim 3 in the prevention and control of root-knot nematode disease of cantaloupe caused by the root-knot nematode of the bean weevil.

5. The application of the fermentation supernatant according to claim 3 in promoting plant growth, wherein the plant is cantaloupe.

6. The application according to claim 5, characterized in that, The growth-promoting effect refers to increasing the root length, stem length, fresh weight, and dry weight of Hami melons.

7. The application of the fermentation supernatant according to claim 3 in the production of bio-organic fertilizer suitable for Hami melons.

8. A bio-organic fertilizer, characterized in that, The bio-organic fertilizer contains the fermentation supernatant as described in claim 3.