Application of ZmBTB130 gene in regulating crop growth and development under low phosphorus stress
By knocking out the ZmBTB130 gene in maize using gene editing technology, the growth capacity of maize under low phosphorus conditions was improved, solving the problem of poor growth and development of maize under low phosphorus stress, and achieving a significant increase in root length, stem diameter and inorganic phosphorus content.
Patent Information
- Application Number
- CN202610287660.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-10
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies are not effective in understanding the growth and development of maize under low phosphorus stress. The phosphorus absorption and transport regulatory network and tolerance mechanism are not fully understood, leading to a decline in maize yield.
By knocking out the ZmBTB130 gene in maize using gene editing technology, the inorganic salt content and enzyme activity in the plant can be regulated, thereby enhancing the plant's growth capacity in low-phosphorus environments.
Under low phosphorus stress, the root length, stem diameter and plant height of maize plants increased significantly, and the inorganic phosphorus content and acid phosphatase activity were significantly improved. The growth status was better than that of the control group, which alleviated the inhibition of maize growth by low phosphorus stress.
Smart Images

Figure CN122104733A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically involving ZmBTB130 Application of genes in regulating crop growth and development under low phosphorus stress. Background Technology
[0002] As a globally important food, feed, and industrial raw material crop, maize has an urgent need for phosphorus during its growth and development. More than 95% of phosphorus in the soil exists in insoluble forms and cannot be directly absorbed and utilized by maize. The scarcity of available phosphorus in the soil is one of the key abiotic stress factors limiting maize yield. Severe phosphorus deficiency in the soil restricts the accumulation of photosynthetic products and grain filling in maize, leading to a significant decrease in yield. Currently, the scientific community has conducted extensive research on the low-phosphorus stress response mechanisms of model plants such as Arabidopsis thaliana and rice. However, a systematic and complete understanding of the phosphorus absorption and translocation regulatory network and tolerance mechanisms of maize, a typical C4 crop, under low-phosphorus environments is still lacking.
[0003] Through plant molecular biology and genetic engineering studies, the transcriptional regulatory network of low phosphorus stress response pathways relies on the synergistic effects of multiple transcription factor families. Among them, the BTB (broad-complex, tramtrack, and bric-a-brac) family is a multifunctional protein family containing conserved BTB domains. Characterized by specific protein-protein interaction domains, it can be divided into several subfamilies based on functional domain differences. Some members also contain TAZ zinc fingers, ANK ankyrin repeat sequences, and other domains, widely participating in plant morphogenesis, secondary metabolic synthesis, hormone signal transduction, and stress resistance. Within the BTB family, the BTB-TAZ subfamily has attracted significant attention due to its dual BTB and TAZ domains. The BT1 / BT2 genes in Arabidopsis thaliana have been confirmed as key regulators of plant nutrient responses, playing a central role in the nitrogen use efficiency regulation network. In recent years, the potential functions of this subfamily in plant abiotic stress responses have gradually gained attention from the scientific community.
[0004] Plant responses to nutrient stresses such as phosphorus and nitrogen are complex processes involving the interaction of multiple genes and signaling pathways. Transcriptional regulation plays a crucial role in this process. Analyzing the expression patterns and regulatory functions of BTB subfamily genes under low phosphorus stress has become an emerging direction in the study of molecular mechanisms of plant tolerance to low phosphorus, and provides new ideas for improving crop nutrient use efficiency through molecular breeding. Summary of the Invention
[0005] The technical problem to be solved by the present invention is: to provide ZmBTB130 The application of genes in regulating crop growth and development under low phosphorus stress aims to address the technical problem of poor crop growth and development under low phosphorus stress.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is: to provide a ZmBTB130 Application of genes in regulating inorganic salt content, enzyme activity, and growth and development in crops under low phosphorus stress. ZmBTB130 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.
[0007] Based on the above technical solution, the present invention can be further improved as follows: Furthermore, through silencing or knocking out ZmBTB130 Genes enable the regulation of inorganic salt content, enzyme activity, and growth and development in crops under low phosphorus stress.
[0008] Furthermore, through silencing or knocking out ZmBTB130 Genes significantly increased the root length, stem diameter, and plant height of crops, and significantly increased the content of inorganic phosphorus and the activity of acid phosphatase in the plant.
[0009] Furthermore, the crop is corn.
[0010] The beneficial effects of this invention are: knocking out transcriptional repressors in maize using gene editing technology. ZmBTB130 Subsequently, a high-quality maize line with low phosphorus tolerance was obtained. The inorganic phosphorus content and acid phosphatase activity in the roots of this maize line were significantly increased during the seedling and maturity stages, and its growth was significantly better than that of the control group. The growth inhibition of maize plant height, diameter and root length by low phosphorus stress was greatly alleviated. This provides gene resources and molecular targets for solving the problem of non-renewable phosphorus resources, reducing environmental pollution and creating phosphorus-efficient plant lines. Attached Figure Description
[0011] Figure 1 These are the results of PCR molecular detection of transgenic plants; Figure 2 This is a comparison diagram of the knockout vector and some sequencing results; Figure 3 The images show the phenotypic and root length comparisons of wild-type and ZmBTB130-KO plants under different treatment conditions. Figure A shows the plant height comparison between wild-type and ZmBTB130-KO plants under normal treatment (NP); Figure B shows the root length comparison between wild-type and ZmBTB130-KO plants under normal treatment (NP); Figure C shows the plant height comparison between wild-type and ZmBTB130-KO plants under low phosphorus treatment (LP); and Figure D shows the root length comparison between wild-type and ZmBTB130-KO plants under low phosphorus treatment (LP). Figure 4 The plant height statistics of wild-type and ZmBTB130-KO plants under different treatment conditions are shown in the figure. Figure 5A graph showing the statistical results of taproot length in wild-type and ZmBTB130-KO plants under different treatment conditions; Figure 6 The aboveground dry weight of wild-type and ZmBTB130-KO plants under different treatment conditions is shown in the figure. Figure 7 A graph showing the statistical results of the underground dry weight of wild-type and ZmBTB130-KO plants under different treatment conditions; Figure 8 The images show the phenotypic comparisons of wild-type and ZmBTB130-KO plants at different growth stages under different treatments. Figure A shows the plant height comparison between wild-type and ZmBTB130-KO plants at the seven-leaf stage under normal treatment (NP); Figure B shows the plant height comparison between wild-type and ZmBTB130-KO plants at the seven-leaf stage under low phosphorus treatment (LP); Figure C shows the plant height comparison between wild-type and ZmBTB130-KO plants at the ten-leaf stage under normal treatment (NP); Figure D shows the plant height comparison between wild-type and ZmBTB130-KO plants at the ten-leaf stage under low phosphorus treatment (LP); Figure E shows the plant height comparison between wild-type and ZmBTB130-KO plants at the tasseling stage under normal treatment (NP); and Figure F shows the plant height comparison between wild-type and ZmBTB130-KO plants at the tasseling stage under low phosphorus treatment (LP). Figure 9 The plant height statistics of wild-type and ZmBTB130-KO plants at the seven-leaf stage under different treatment conditions are shown in the figure. Figure 10 The figure shows the statistical results of diameter and diameter of wild-type and ZmBTB130-KO plants at the seven-leaf stage under different treatment conditions; Figure 11 The plant height statistics of wild-type and ZmBTB130-KO plants at the ten-leaf stage under different treatment conditions are shown in the figure. Figure 12 The figure shows the statistical results of diameter and diameter of wild-type and ZmBTB130-KO plants at the ten-leaf stage under different treatment conditions; Figure 13 The plant height of wild-type and ZmBTB130-KO plants at the tasseling stage under different treatment conditions is shown in the figure. Figure 14 The figure shows the statistical results of diameter of wild-type and ZmBTB130-KO plants at the male ejaculation stage under different treatment conditions; Figure 15 A graph showing the statistical results of inorganic phosphorus content in the roots of wild-type and ZmBTB130-KO plants under different treatment conditions; Figure 16 The figure shows the statistical results of acid phosphatase activity in the roots of wild-type and ZmBTB130-KO plants under different treatment conditions. Detailed Implementation
[0012] The specific embodiments of the present invention are described below to facilitate understanding of the invention by those skilled in the art. Unless otherwise specified, specific conditions are applied according to conventional conditions or the manufacturer's recommendations. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various modifications are obvious as long as they fall within the spirit and scope of the invention as defined and determined by the appended claims. All inventions utilizing the concept of this invention are protected.
[0013] ZmBTB130 The nucleotide sequence of the gene is as follows:
[0014] Example 1: Construction and transformation of ZmBTB130-KO vector into Agrobacterium tumefaciens EHA105 1. Activation of bacterial strains and plasmid extraction Single colonies of pYL-CRISPR / Cas9-HYG (kanamycin, Kana) and pYL-gRNA-U3 (ampicillin, Amp) strains were streaked onto plates containing the corresponding antibiotics. Each colony was incubated overnight in 5 mL of LB broth. Then, 1 mL of the colony was inoculated into 50 mL of LB broth for further culture and plasmid extraction. pYL-CRISPR / Cas9-HYG and pYL-gRNA-U3 have been previously published in the journal “A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants.”
[0015] 2. Target Connector Preparation Obtain the target gene from the Phytozome website. ZmBTB130 Based on the CDS sequence, single-knockout primers BTB130KOT-F and BTB130KOT-R were designed using the CRISPR-Pv2.0 website and ligated into the PYL-gRNA-U3 vector. Primers BTB130KOT-F and BTB130KOT-R were dissolved in 10µM stock solutions, and 5µL of each was added to 10µL of ddH2O. The mixture was then annealed at 95℃ for 1 min and 94℃ for 30 s. 4℃, 30 s; store at 4℃.
[0016] The nucleotide sequences of the target primers BTB130KOT-F and BTB130KOT-R are as follows: BTB130KOT-F: ggcaAACGTAGGAGTGTGCGGCGA (SEQ ID NO: 2); BTB130KOT-R: aaacTCGCCGCACACTCCTACGTT (SEQ ID NO: 3).
[0017] 3. gRNA expression vector enzyme digestion edge-ligation reaction Take the annealing primers obtained in step 2, mix them according to the system prepared in Table 1, and perform a cleavage and ligation reaction in a PCR instrument. The reaction program is: 37℃, 5 min, 20℃, 5 min, 8 cycles.
[0018] Table 1 PCR reaction system
[0019] 4. Amplification of gRNA expression vector (1) First round of amplification Using the ligation product obtained in step 3 as a template, amplification was performed using universal primers UF and gRNA-R, and a high-fidelity enzyme. The nucleotide sequences of universal primers UF and gRNA-R are as follows: UF: CTCCGTTTTACCTGTGGAATCG (SEQ ID NO: 4); gRNA-R: CGGAGGAAAATTCCATCCAC (SEQ ID NO: 5).
[0020] Table 2 PCR reaction system
[0021] Table 3 PCR reaction procedure
[0022] (2) Second round of amplification Using the expression cassette product from the first round of PCR as a template, a second amplification was performed using position-specific primers M-B1 and M-B2. The nucleotide sequences of position-specific primers M-B1 and M-B2 are as follows: M-B1: TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG (SEQ ID NO: 6); M-B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC (SEQ ID NO: 7).
[0023] Table 4. Second-round amplification PCR reaction system
[0024] Table 5. Second-round amplification PCR reaction procedure
[0025] After the second round of amplification, the product length was checked by 1% agarose gel electrophoresis to see if it met the requirements (U3-gRNA=599bp). The gel was then cut, and the DNA fragments were recovered using the Tiangen Universal DNA Purification and Recovery Kit.
[0026] 5. Assembly and ligation of CRISPR and gRNA The CRISPR vector and gRNA expression vector were assembled and ligated, and the reaction was carried out according to the reaction system in Table 6 and the procedure in Table 7.
[0027] Table 6 Assembly reaction system
[0028] Table 7 Assembly Reaction Procedure
[0029] The ligation product was transformed into E. coli, following these steps: (1) Add 5µL of the ligation product to 50µL of DH5α competent cells (purchased from TOLOBIO, catalog number CC96102) melted on ice, gently tap the tube wall to mix, and incubate on ice for 30 min. (2) Heat shock at 42℃ for 90 seconds, followed by ice bath for 2-3 minutes; (3) Add 600µL of LB liquid medium (antibiotic-free) and revive at 37℃ and 200rpm for 50min; (4) Centrifuge at 4000 rpm for 60 s; (5) Discard 500µL of supernatant, mix by pipetting, and lightly spread it onto solid culture medium containing the corresponding antibiotic using a sterile applicator; (6) Incubate at 37℃ upside down for 12-14 hours.
[0030] 6. Colony-positive identification (1) Pick a single spot in 600µL of LB liquid medium containing the corresponding antibiotic and revive it at 37℃ and 200rpm for 5-8h; (2) After the bacterial culture becomes turbid, it is subjected to PCR amplification, and the amplified target band is detected by agarose gel electrophoresis; (3) Send the bacterial culture with the correct target fragment size to Sangon Biotech (Shanghai) Co., Ltd. for sequencing; (4) Use Unipro UGENE or Snap Gene bioinformatics software to analyze and compare the gene sequences downloaded from the Phytozome database maize genome database; (5) After the correct bacterial culture is amplified, plasmids are extracted and stored at -20℃ for later use.
[0031] 7. Plasmid extraction Plasmids were extracted using the Tiangen endotoxin-free plasmid mini-extraction kit (centrifuge column type, catalog number: DP123).
[0032] (1) Add 500µL of equilibration solution BL to the adsorption column CP4, centrifuge at 12000rpm for 60s, and discard the waste liquid; (2) Take 40 mL of overnight culture, centrifuge at 13000 rpm for 60 s, and discard the supernatant; (3) Add 1.5 mL of solution P1 (pre-added with RNase A) to resuspend the bacterial cells, and dispense them into 3 2 mL centrifuge tubes; (4) Add 500µL of solution P2 to each tube and mix by inverting until the bacterial solution becomes clear and viscous; (5) Add 500µL of solution P4, invert and mix until a white flocculent precipitate appears, let stand for 10 min, and centrifuge at 12000rpm for 10 min; (6) Add the supernatant to the CS filter column, centrifuge at 12000 rpm for 90 s, and collect the filtrate; (7) Add 0.3 times the volume of the filtrate of isopropanol and mix gently; (8) Transfer the mixture to the equilibrated adsorption column CP4, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 60 s, and discard the waste liquid; (9) Add 500µL of PD to CP4, centrifuge at 13000rpm for 60s, and discard the waste liquid; (10) Add 500µL of washing buffer PW (already containing anhydrous ethanol), let stand at room temperature for 2 min, centrifuge at 12000rpm for 60s, discard the waste liquid, and repeat this step once; (11) Centrifuge at 12000 rpm for 2 min, and let the adsorption column CP4 open and air dry for 3 min; Place the CP4 adsorption column in a clean centrifuge tube, add 50-100 µL of elution buffer TB dropwise to the middle of the adsorption membrane, incubate at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, collect the plasmid solution in the centrifuge tube, measure the concentration using a Nanodrop 2000c, and store at -20℃ for later use.
[0033] The ZmBTB130-pYL-CRISPR plasmid was finally obtained, and then transformed into Agrobacterium. The specific operation is as follows: ① Take 1 µg of ZmBTB130-pYL-CRISPR plasmid and add it to 100 µL of Agrobacterium EHA105 competent cells, then mix well.
[0034] ② Immediately place on ice for 10 minutes, then quickly immerse in liquid nitrogen for 5 minutes, followed by a 37°C water bath for 5 minutes and an ice bath for 5 minutes.
[0035] ③ Add 800µL of antibiotic-free LB liquid medium, mix well, and incubate at 28℃ and 200rpm for 4-6h.
[0036] ④ Centrifuge at 6000 rpm for 2 min to collect the bacteria. Leave about 100 µL of bacterial solution at the bottom and gently resuspend the bacterial block by pipetting. Use a sterilized and cooled spreader to evenly spread 100 µL of bacterial solution onto LB + 20 µg / mL Rif (rifampicin) + 50 µg / mL Kanamycin (kanamycin) solid medium. Incubate upside down at 28 °C for 2 days to obtain recombinant bacteria EHA105-ZmBTB130-pYL-CRISPR. Add 50% glycerol and store at -80 °C for subsequent genetic transformation experiments.
[0037] Example 2: PCR detection and identification of transgenic plants (1) Take the first leaf (about 3cm in length) of a corn seedling at the two-leaf-one-heart stage and place it in a 2mL centrifuge tube containing two steel balls. Quickly freeze it with liquid nitrogen and use a sample crusher to quickly crush the sample. After the sample is crushed into powder, quickly put it back into liquid nitrogen to prevent thawing. (2) Quickly add 600µL of 65℃ preheated DNA extraction buffer (CTAB extraction buffer: β-mercaptoethanol = 100:2, v:v), shake well by inverting the container, and place it in a 65℃ water bath for 60 min, shaking well once every 15 min. (3) After cooling to room temperature after the water bath, add 600µL of a mixture of chloroform and isoamyl alcohol (volume ratio of 24:1), invert and mix well, and let stand at room temperature for 8 minutes. (4) Centrifuge at 12000 rpm for 10 min, collect the supernatant, add an equal volume of pre-cooled isopropanol, mix by inversion until white flocculent appears, centrifuge at 12000 rpm for 3 min, and discard the waste liquid. (5) Add 300µL of 75% anhydrous ethanol, invert the container, centrifuge at 12000rpm for 2min, discard the supernatant, open the lid and air dry at room temperature, add 100-500mL of TE (Tris-EDTA buffer), wait for the DNA to dissolve, and store at -20℃ for later use.
[0038] Using DNA from the wild-type line (B73) and the transgenic line ZmBTB130 as templates, specific primers BTB130KO-F and BTB130KO-R were designed targeting the CRISPR / Cas9 gene editing region. PCR detection was then performed. The nucleotide sequences of the specific primers BTB130KO-F and BTB130KO-R are as follows: BTB130KO-F: 5′-CATTCTCGCACCGCACTTCGTTAG-3′ (SEQ ID NO: 8); BTB130KO-R: 5′-CTTACCTGGAGGAGTAGAGTAGGT-3′ (SEQ ID NO: 9); Table 8 PCR Reaction System
[0039] The reaction program was as follows: 98℃ pre-denaturation for 30 s, 1 cycle; 98℃ denaturation for 10 s, 60℃ annealing for 5 s, 72℃ extension for 1 min, for a total of 35 cycles; 72℃ final extension for 1 min. The amplification products were detected by 1% agarose gel electrophoresis, and the PCR results are as follows. Figure 1 As shown; the PCR products of the positive plants were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing identification. The sequencing results are as follows. Figure 2 As shown.
[0040] Example 3 Phenotypic Observation 1. Phenotypic observation of maize seedlings Seedling stage treatment conditions: soil cultivation, using nutrient soil; after testing, the available phosphorus content in the soil was less than 5 mg / kg. -1 This soil is classified as low-phosphorus soil. The NP (normal phosphorus) group consists of a 1:1 volume ratio of nutrient soil and low-phosphorus soil, while the LP (low-phosphorus) group consists of an equal amount of low-phosphorus soil.
[0041] Fifteen wild-type (WT) and ZmBTB130 knockout lines (ZmBTB130-KOS2, ZmBTB130-KOS4, and ZmBTB130-KOS9) maize seeds were sown in the NP and LP group soils that had been sterilized with boiling water and cooled. The soils were placed in a culture room (28℃, 14h light; 25℃, 10h dark). After 10 days of growth, plants of uniform growth from each line were selected, and the substrate was washed clean with water. Plant height and taproot length were measured. Additionally, three plants from each treatment group of each line were placed in a 105℃ oven for 30 min to kill the greens, then dried at 65℃ to constant weight. The aboveground and underground dry weights were measured, and the mean and standard deviation were calculated.
[0042] The results are as follows Figures 3-7 As shown, there was no significant difference in seedling height under low phosphorus treatment, while the diameter and root length of the knockout line were significantly increased compared to the wild type, and the dry weight of both the aboveground and underground parts were significantly increased.
[0043] 2. Phenotypic observation of maize plants during growth stages Wild-type and transgenic materials were raised in the field and hardened off when they reached the V1 stage. After hardening off, at the V3 stage, the sample plants were transplanted into 30cm flowerpots containing soil from the NP and LP groups, with 6 plants in each line and 3 plants in each treatment group for self-pollination.
[0044] Plant height and diameter were measured at the seven-leaf stage, ten-leaf stage, and tasseling stage, and photographs were taken at each corresponding measurement time point.
[0045] The results are as follows Figures 8-14As shown, measurements of maize plant height and diameter at different growth stages revealed that under normal phosphorus conditions, the knockout lines showed no significant difference compared to the wild type, while maize under low phosphorus treatment exhibited better growth at all stages, with plant height and diameter significantly higher than the wild type.
[0046] Example 4: Determination of Inorganic Phosphorus Content and Acid Phosphatase Activity The root tissue of seedlings that were 10 days old was taken for determination of inorganic phosphorus content and acid phosphatase activity.
[0047] 1. Determination of inorganic phosphorus content The inorganic phosphorus content was determined using the tissue inorganic phosphorus detection kit from Beijing BoxBIO Technology Co., Ltd. Specifically, 0.1g of wild-type and transgenic tissues from the NP and LP groups were weighed, and 1mL of extraction buffer was added to treat the sample. Each line was processed in triplicate. The samples were homogenized on ice, centrifuged at 10000g for 10 minutes at 4℃, and the supernatant was collected as the test sample for the determination group. The sample was placed on ice for testing.
[0048] Preheat the microplate reader for at least 30 minutes, adjust the wavelength to 660 nm, and zero the instrument with distilled water. Add the following reagents to the 96-well plate in sequence as shown in Table 9 to set up the test group, standard group, and blank group.
[0049] Table 9 Composition of the reaction system for determining inorganic phosphorus content
[0050] After thorough homogenization, the sample was placed at 40℃ for 10 min for color development, cooled to room temperature, and allowed to stand for 10 min. The absorbance of each group at 660 nm was measured within 30 min after color development, and the inorganic phosphorus content of the tissue was calculated. ; ; ; Where, ΔA 测定 Abs; A represents the difference in absorbance between the assay group and the blank group. 测定 Abs; A represents the absorbance of the measurement group. 空白 Abs represents the absorbance of the blank group; ΔA 标准 Abs is the difference in absorbance between the standard group and the blank group. 标准 B represents the absorbance of the standard group (Abs); C represents the inorganic phosphorus content in the plant tissue (mmol / g); D represents the absorbance of the standard group (Abs); E represents the inorganic phosphorus content in the plant tissue (mmol / g); C represents the absorbance of the standard group (Abs); D ... absorbance of the standard group (Abs); E represents the absorbance of the standard group (Abs); F 标 V represents the concentration of the inorganic phosphorus standard solution, in mmol / L. 样总 is the total volume of the sample to be tested, mL; W is the sample mass, g.
[0051] 2. Acid phosphatase activity analysis Acid phosphatase (ACP) activity was determined using a kit (sodium phenyl phosphate microplate method) from Beijing Leagene Biotechnology Co., Ltd. Specifically, 0.2 g of cleaned roots from wild-type and transgenic lines in the NP and LP groups were weighed, added to 1000 μL of physiological saline, incubated on ice for 15-30 min, filtered through gauze, centrifuged at 10000 rpm for 20 min, and the supernatant was collected and its volume measured. The supernatant was then stored at -20℃.
[0052] Dilute the standard sample by taking a 1.5 mL centrifuge tube and adding 30 µL of the test sample, 180 µL of distilled water, 60 µL of acidic base solution, and 30 µL of ACP assay buffer in sequence. Incubate at 37 °C for 15 min and use immediately for ACP activity detection. Set up blank, standard, and assay wells as shown in Table 10, and add the three replicate solutions sequentially and mix well.
[0053] Table 10 Composition of the reaction system for acid phosphatase activity assay
[0054] Place the test solution at room temperature for 10 minutes, zero the blank well, and measure the absorbance at 510 nm using an ELISA reader.
[0055] A standard curve was plotted with the absorbance of the standard wells as the ordinate and the phenol concentration as the abscissa, and a regression equation was fitted. The corresponding phenol concentration was calculated based on the standard curve, and finally, the ACP activity was calculated.
[0056] ; ; Where D1 represents ACP activity; c represents phenol concentration (nmol / mL); t represents sample processing time (min); and D2 represents standardized ACP activity normalized to fresh weight (FW) (nmol / mL). min -1 g -1 FW; d represents the activity of the reaction solution, in nmol mL -1 min -1 V2 is the total volume of the extract, mL; m is the fresh weight of the sample, g.
[0057] like Figure 15 and Figure 16 As shown, compared with wild-type plants, the acid phosphatase activity and inorganic phosphorus content in the roots of transgenic plants were significantly increased under normal phosphorus and low phosphorus conditions, indicating that the knockout... ZmBTB130 After gene therapy, the plant's tolerance to low phosphorus stress was improved.
Claims
1. A kind ZmBTB130 The application of genes in regulating inorganic salt content, enzyme activity, and growth and development in crops under low phosphorus stress is characterized by, The ZmBTB130 The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
2. The application according to claim 1, characterized in that, Through silence or knockout ZmBTB130 Genes enable the regulation of inorganic salt content, enzyme activity, and growth and development in crops under low phosphorus stress.
3. The application according to claim 2, characterized in that, Through silence or knockout ZmBTB130 Genes significantly increased the root length, stem diameter, and plant height of crops, and significantly increased the content of inorganic phosphorus and the activity of acid phosphatase in the plant.
4. The application according to any one of claims 1-3, characterized in that, The crop in question is corn.