Method for improving the expression of foreign glycoproteins by yeast
By introducing GnT1 genes from different species into Pichia pastoris, an engineered biosynthesis platform was constructed, solving the problems of exogenous glycoprotein expression and complex N-glycan construction in existing technologies. This platform achieves efficient expression and glycan structure optimization, making it suitable for the production of biomedicine and functional foods.
Patent Information
- Application Number
- CN202610268838.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-06
- Publication Date
- 2026-05-29
AI Technical Summary
Existing Pichia pastoris expression systems struggle to achieve efficient expression of exogenous glycoproteins and construction of complex N-glycan structures without altering system complexity, especially for macromolecules like lactoferrin and proteins with polysaccharide sylation sites, making it difficult to meet the needs of biomedicine and functional foods.
By introducing N-acetylglucosamine transferase I (GnT1) genes from different species into Pichia pastoris, an engineered biosynthesis platform was constructed. By utilizing the synergistic effect of GnT1 and the host cell's endogenous N-glycosylation pathway, the high-mannose N-glycan chain was controlled to stop at the Man5 structural stage and enter the complex N-glycan processing pathway, thereby achieving efficient expression and precise glycosylation modification of exogenous glycoproteins.
It significantly increased the expression level of exogenous glycoproteins, improved the proportion of complex N-glycans, enhanced the production capacity of biopharmaceuticals and functional proteins, and met the needs of biomedicine and functional foods.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of protein engineering and fermentation engineering technology, and specifically relates to a method for improving the expression of exogenous complex glycoproteins in yeast. Background Technology
[0002] The expression and glycosylation modification of recombinant glycoproteins are key foundational technologies in modern biomanufacturing, biomedicine, functional food, and nutritional ingredient production. With the increasing demand for lactoferrin, immune-related glycoproteins, antibody proteins, and various functional glycoproteins in pharmaceutical, nutritional, and industrial applications, establishing a production system that can both efficiently express exogenous glycoproteins and effectively regulate their N-glycan structures has become a crucial problem urgently needing to be solved in the field of industrial biotechnology.
[0003] Among existing eukaryotic expression systems, Pichia pastoris (Komagataella phaffii) is widely used for the large-scale production of recombinant proteins due to its ability to achieve high-density fermentation, its eukaryotic post-translational modification capabilities, relatively simple culture conditions, and good industrial scale-up potential, especially in the preparation of food-grade and nutrient-grade proteins. However, the endogenous N-glycosylation pathway in Pichia pastoris is characterized by high-mannose glycans, and its glycan structure differs significantly from the complex N-glycans of mammalian-derived glycoproteins. When used to express exogenous glycoproteins with polysaccharide sacs or those highly sensitive to glycan structure, it often fails to meet the requirements of functional activity and application adaptability.
[0004] Taking lactoferrin and other typical glycoproteins as examples, these proteins not only have large molecular weights and complex spatial structures, but also typically contain multiple N-glycosylation sites. Their biological activity, stability, in vivo metabolic behavior, and immune-related characteristics are all closely related to their glycan structure. While a certain level of secretory expression can be achieved when expressing these proteins in Pichia pastoris, their N-glycans are usually predominantly of a high-mannose type structure, making it difficult to form complex N-glycans. This limits their application in biomedicine, functional foods, or high-end raw materials.
[0005] In eukaryotic N-glycosylation, the conversion of high-mannose N-glycans to complex N-glycans depends on a series of glycan modification and processing reactions. N-acetylglucosamine transferase I (GnT1) is considered a key initiating enzyme in the biosynthesis of complex N-glycans. However, in non-mammalian hosts such as Pichia pastoris, the endogenous N-glycosylation pathway tends to rapidly elongate high-mannose glycans, resulting in a lower proportion of Man5-type glycan intermediates suitable as GnT1 substrates. This limits the further construction of complex N-glycans at the overall pathway level.
[0006] To address the aforementioned issues, current glycosylation engineering research primarily focuses on introducing exogenous glycosyltransferases, knocking out or weakening some endogenous glycosylation-related genes, or employing multi-enzyme cascade reconstruction to attempt to achieve complex glycan structures. For example, such methods are reported in patent documents with publication numbers CN105671109A and CN113549560A. However, these strategies often involve multiple enzymes and regulatory nodes, resulting in complex construction, difficulty in balancing pathways, insufficient genetic stability, and limited applicability to different target proteins, making it difficult to develop a technological platform with good versatility and industrial feasibility. In particular, achieving the controllable construction of complex N-glycan structures while ensuring efficient expression of exogenous glycoproteins remains a significant technological bottleneck in current technologies.
[0007] Therefore, a new engineering strategy is urgently needed to regulate the endogenous N-glycosylation pathway in Pichia pastoris by focusing on key nodes in the N-glycosylation pathway. This strategy would guide high-mannose N-glycans into complex N-glycan processing pathways without significantly increasing system complexity, thereby enabling the efficient construction of complex N-glycan structures for exogenous glycoproteins. This would meet the urgent demand for high-quality recombinant glycoproteins in the fields of biomedicine, functional proteins, nutritional health raw materials, and industrial biomanufacturing. Summary of the Invention
[0008] In our long-term research on yeast glycosylation engineering and recombinant glycoprotein expression, we have found that GnT1 is not only a key initiating enzyme for the biosynthesis of complex N-glycans, but its expression status in yeast hosts is also related to differences in the source species, and it significantly affects the overall expression efficiency and glycosylation characteristics of exogenous glycoproteins. Using GnT1 as an engineering driving node, we systematically evaluated the expression and functional effects of GnT1 from different species in yeast hosts. We then constructed an engineered biosynthesis platform that balances efficient expression of exogenous glycoproteins with controllable construction of complex N-glycans. We found that without altering the endogenous genes in Pichia pastoris host cells and without introducing exogenous glycan processing enzymes, simply introducing the GnT1 gene from the source species into the yeast host for expression can engineer and regulate the endogenous N-glycosylation pathway in the host cell. This allows the high-mannose N-glycans carried by the exogenously expressed glycoprotein to be controlled and stationary at the Man5 structural stage, serving as substrates for GnT1 in the complex N-glycan processing pathway, thereby achieving the construction of the complex N-glycan structure of the exogenous glycoprotein. Based on this research, the present invention includes the following technical solutions.
[0009] The main aspect of this invention provides a method for improving the expression of exogenous glycoproteins in yeast, comprising the following steps: integrating an exogenous N-acetylglucosaminyltransferase I (GnT1) gene, derived from a different species than the yeast host, into the genome of the yeast host strain expressing the glycoprotein, constructing an engineered yeast strain expressing the exogenous GnT1, and expressing and secreting the glycoprotein through fermentation.
[0010] This exogenous GnT1 can synergize with the endogenous glycan processing pathways of yeast hosts such as Pichia pastoris to form a scalable glycosylation regulatory system, which drives the efficient expression and precise glycosylation modification of exogenous glycoproteins in Pichia pastoris. This allows for a controllable shift in the N-glycan structure of glycoproteins from a high-mannose type to a more complex type, increasing the proportion of complex N-glycans.
[0011] When a yeast host cell expresses a foreign glycoprotein, the foreign GnT1 causes the foreign glycoprotein expressed by the yeast host cell to form a controlled Man5-type N-glycan intermediate during the endoplasmic reticulum-Golgi apparatus processing. This intermediate then serves as a substrate for GnT1 and enters the complex N-glycan biosynthesis pathway, thereby achieving the efficient construction of the complex N-glycan structure of the foreign glycoprotein.
[0012] Preferably, in the above method, the exogenous GnT1 gene is introduced into the yeast host cell without altering the endogenous gene of the yeast host cell expressing the glycoprotein, preferably an exogenous complex glycoprotein (e.g., a gene related to the N-glycosylation pathway), and / or without introducing an exogenous glycan processing enzyme module (including but not limited to mannosidase, glycosyltransferase, etc.).
[0013] In one embodiment, the exogenous GnT1 is derived from animals, insects, plants, or fungi.
[0014] Preferably, the exogenous GnT1 is derived from Holstein cattle (Bos taurus, Bt), humans (Homo sapiens, Hs), mice (Mus musculus, Mm), Arabidopsis thaliana (Arabidopsis thaliana, At), or Saccharomyces cerevisiae (Saccharomyces cerevisiae, Sc), wherein...
[0015] The amino acid sequence of GnT1 from Saccharomyces cerevisiae (Sc) is shown in SEQ ID NO: 1, and the nucleotide sequence of the CDS region encoding the gene is shown in SEQ ID NO: 2.
[0016] The amino acid sequence of GnT1 derived from Arabidopsis thaliana (At) is shown in SEQ ID NO:3, and the nucleotide sequence encoding the CDS region of the gene is shown in SEQ ID NO:4;
[0017] The amino acid sequence of GnT1 derived from mice (Mus musculus, Mm) is shown in SEQ ID NO: 5, and the nucleotide sequence encoding the CDS region of the gene is shown in SEQ ID NO: 6.
[0018] The amino acid sequence of GnT1 derived from human (Homo sapiens, Hs) is shown in SEQ ID NO: 7, and the nucleotide sequence encoding the CDS region of the gene is shown in SEQ ID NO: 8.
[0019] The amino acid sequence of GnT1 derived from Holstein cattle (Bos taurus, Bt) is shown in SEQ ID NO: 9, and the nucleotide sequence encoding the CDS region of the gene is shown in SEQ ID NO: 10.
[0020] The yeast host is preferably Pichia pastoris (Komagataella phaffii, Pichiapastoris), such as Pichia pastoris GS115 or Saccharomyces cerevisiae (baker's yeast), and more preferably Pichia pastoris.
[0021] Preferably, the glycoprotein is an exogenous glycoprotein with a complex N-glycan structure. The glycoprotein is selected from polyglycosylated proteins with two or more glycosylation sites, high isoelectric point proteins (high pI proteins, pI≥8), and complex folded proteins with tertiary structure, such as bovine lactoferrin (BLF), preferably buffalo lactoferrin (wbLF, amino acid sequence as shown in SEQ ID NO: 11, nucleotide sequence of the encoding gene as shown in SEQ ID NO: 12).
[0022] After introducing GnT1 from different species into the aforementioned yeast host bacteria, the elongation, modification, or processing pathways of high-mannose N-glycans in the yeast host bacteria were weakened, inhibited, or reconstructed, limiting the further elongation of high-mannose N-glycans to Man6 and above structures, and increasing the relative proportion of Man5 N-glycans in the cell.
[0023] Through the above-mentioned regulatory methods, the proportion of complex N-glycans can be increased, thereby enhancing the substrate accessibility of GnT1, leading to increased expression of exogenous glycoproteins in yeast host bacteria such as Pichia pastoris, while the proportion of high-mannose N-glycans decreases and the proportion of complex N-glycans increases.
[0024] Optionally, an exogenous glycan processing enzyme module may be further introduced into the yeast host strain, the glycan processing enzyme module including mannosidase and / or glycosyltransferase.
[0025] In one embodiment, the integration of the exogenous GnT1 gene in the above method is selected from gene editing technology or positive transformants obtained by transforming GnT1 gene overexpression plasmids.
[0026] The gene editing technologies mentioned above can be selected from the following group: homologous double crossover, Red homologous recombination, TALEN system, CRISPR-Cpf1 system, CRISPR-Cas12a system, MuGENT (multiplex genome editing by natural transformation), and MUCICAT (multi-copy chromosomalin integration by CRISPR-associated transposase), which is a bacterial chromosome multicopy integration technology based on CRISPR-associated transposases (CASTs).
[0027] The above plasmid transformation can be selected from traditional electrochemical transformation, chemical transformation and thermal shock methods.
[0028] Experimental results showed that exogenous GnT1 from different species introduced and expressed in Pichia pastoris host cells could engineer and regulate the endogenous N-glycosylation pathway in the host cells. This enabled the high-mannose N-glycans carried by exogenously expressed glycoproteins to be controlled and stationary at the Man5 structural stage, serving as substrates for GnT1 in the complex N-glycan processing pathway, thereby achieving the construction of complex N-glycan structures for exogenous glycoproteins. Compared with control strains without GnT1, the expression levels of target glycoproteins were significantly increased after introducing GnT1 from different species, with an overall increase of approximately 1-2.4 times, indicating that the introduction of GnT1 has a significant promoting effect on the expression of exogenous glycoproteins. This method can enhance the biosynthesis of polysaccharidated proteins, high isoelectric point proteins, and complex folded proteins, and has promising prospects for application in biopharmaceuticals, functional proteins, nutritional and health raw materials, and industrial biomanufacturing. Attached Figure Description
[0029] Figure 1The diagram shows the structural schematic of the fusion gene expression vector constructed in this invention, which expresses a foreign glycoprotein and simultaneously introduces GnT1 in Pichia pastoris. Figure a shows the linear structure of the expression cassette int1-GnT1, illustrating the relative layout of the target glycoprotein expression cassette and the GnT1 expression cassette within the vector, as well as the arrangement of each functional module during genome integration or vector construction. This figure illustrates the overall structural design and modular organization of the engineered GnT1 and foreign glycoprotein co-expression system in this invention. Figure b shows the overall circular structure of the constructed recombinant expression vector, including the promoter for driving target protein expression, the secretory signal peptide region, the target glycoprotein coding sequence, the expression module for driving GnT1 expression, the terminator, the resistance selection marker, and the bacterial origin of replication (ori), among other basic functional elements.
[0030] Figure 2 The results of plasmid-level construction and identification of GnT1 expression cassettes from different species are shown. Figure a shows an agarose gel electrophoresis image used to verify the correct construction of GnT1 expression cassettes from different species in the vector; Figure b illustrates the relative positions of the GnT1 coding sequence, promoter, and terminator within the expression cassette, and marks the primer binding sites used to verify the correctness of the construction. Electrophoresis results showed that each GnT1 expression construct produced amplified bands consistent with the theory, and sequencing verification results confirmed the correct sequence construction.
[0031] Figure 3 The results show the validation of strains where the target glycoprotein expression cassette and the GnT1 expression cassette were integrated into the Pichia pastoris genome after introducing GnT1 from different species. Figure a shows agarose gel electrophoresis of the genomic PCR identification. Using specific primers to amplify the integrated fragment, each transformant showed amplified bands of the theoretical size, indicating successful integration of the target expression cassette into the host genome. Figure b shows a photograph of the resistance selection culture plate of positive transformants, showing multiple successfully obtained positive Pichia pastoris engineered strains, which were used for subsequent fermentation expression and functional analysis.
[0032] Figure 4 The results of the analysis on the effects of GnT1 from different species on the expression levels of exogenous glycoproteins are presented. Figure a shows the SDS-PAGE electrophoresis diagram of the expression products after affinity purification; different lanes correspond to Pichia pastoris transformants introduced with GnT1 from different species. Protein bands consistent with the theoretical molecular weight of the target glycoprotein were detected in each sample. Figure b shows a statistical graph based on optical density. The experimental results show that compared with the control strain without GnT1, the expression levels of the target glycoproteins were significantly increased after introducing GnT1 from different species, with an overall increase of approximately 1-2.4 times, indicating that the introduction of GnT1 has a significant promoting effect on the expression of exogenous glycoproteins (Table 2).
[0033] Figure 5 The results of the analysis of the N-glycan structure of exogenous glycoproteins after the introduction of GnT1 are shown. The experimental results show that, compared with the control sample without the introduction of GnT1, the proportion of high-mannose N-glycans in the target glycoprotein was significantly reduced after the introduction of GnT1, while the proportion of complex N-glycans was significantly increased. This indicates that the engineered GnT1 platform of the present invention can effectively reconstruct the glycan structure while increasing the expression level.
[0034] Figure 6 This study presents a comparative analysis of the expression of secreted buffalo lactoferrin by Pichia pastoris engineered strains expressing GnT1 from different species under the same fermentation conditions. In Figure a, the left image is a Western blotting image, and the right image is an SDS-PAGE image; Figure b is a statistical graph of the optical density of the fermentation broth. Detailed Implementation
[0035] Currently, existing research on engineering N-glycosylation pathways in yeast hosts mainly focuses on altering glycan structure by introducing single or multiple exogenous glycosyltransferases, or inhibiting the formation of high-mannose N-glycans by knocking out or weakening endogenous glycosylation-related genes in the host. However, these approaches generally emphasize the modification of the glycan structure itself, paying less attention to the systematic impact of key glycosylation initiation nodes on the overall expression efficiency and glycosylation level of exogenous glycoproteins under different species conditions. To date, there are no reports on the driving effects of N-acetylglucosamine transferase I (GnT1) from different species in yeast hosts, nor are there any reports on engineering strategies that can synergistically enhance the expression of exogenous glycoproteins while achieving the construction of complex N-glycans by introducing GnT1 from different sources.
[0036] This invention provides an engineered GnT1-driven complex N-glycoprotein biosynthesis platform, namely, an engineered yeast strain. Using *Pichia pastoris* as the host cell, N-acetylglucosamine transferase I (GnT1) is introduced and expressed in the host cell to engineer and regulate the host's endogenous N-glycosylation pathway. This allows the high-mannose N-glycans carried by exogenous glycoproteins to be controlled and stationary at the Man5 structural stage, serving as substrates for GnT1 in the complex N-glycan processing pathway. In this platform, GnT1 acts as a key driving node in the biosynthesis of complex N-glycans, guiding the transformation of exogenously expressed glycoprotein N-glycans from high-mannose to complex forms, thereby achieving controllable construction of glycan structures.
[0037] While traditional yeast expression systems can achieve a certain level of exogenous protein secretion, their endogenous N-glycosylation pathways are dominated by high-mannose N-glycans. This not only limits the formation of complex N-glycan structures but also, in some cases, negatively impacts the overall expression efficiency of exogenous glycoproteins. Current research on yeast glycosylation engineering largely focuses on multi-gene cascade modifications or overall pathway reconstruction, resulting in complex and unstable structures that are difficult to develop into universal platforms suitable for industrial production. The complex N-glycoprotein biosynthesis platform created in this invention solves the problem of simultaneously achieving high expression efficiency and glycan quality for lactoferrin, glycoproteins, and other exogenous proteins sensitive to glycosylation structures or with high isoelectric points in existing Pichia pastoris expression systems.
[0038] In our long-term research on yeast glycosylation engineering and recombinant glycoprotein expression, we have observed that N-acetylglucosamine transferase I (GnT1) plays a crucial initiation role in the biosynthesis of complex N-glycans. Its functional state not only determines whether the glycan can enter the complex processing pathway but may also influence the overall expression behavior of exogenous glycoproteins in the yeast host. However, no systematic study has yet been conducted to evaluate the comprehensive impact of GnT1 as a core engineered node on the expression efficiency and glycosylation characteristics of exogenous glycoproteins in the yeast host.
[0039] The engineered complex N-glycoprotein biosynthesis platform of the present invention, with GnT1 as the core driving factor, namely the yeast engineered strain, introduces and expresses GnT1 in Pichia pastoris. Combined with the engineered regulation of the host's endogenous N-glycosylation pathway, high-mannose N-glycans serve as effective substrates for GnT1 at appropriate stages, thereby guiding the glycans into the complex N-glycan processing pathway and achieving synergistic optimization of the glycan structure and expression efficiency of exogenous glycoproteins.
[0040] In one specific implementation case, lactoferrin was used as a model glycoprotein. The differences in exogenous protein expression levels and N-glycan structures between yeast strains with and without GnT1 were systematically constructed and compared. Simultaneously, to verify the platform's universality, GnT1 from bovine, human, mouse, Arabidopsis, and Saccharomyces cerevisiae were selected to construct engineered expression systems in Pichia pastoris. Experimental results showed that, compared to the control strain, the introduction of GnT1 from different species significantly increased the secretory expression levels of exogenous glycoproteins, with an overall increase of approximately 1-2.4 times. Simultaneously, the proportion of high-mannose N-glycans in the obtained glycoproteins was significantly reduced, while the proportion of complex N-glycans was significantly increased.
[0041] The above results indicate that GnT1 from different species, especially from higher organisms, can stably function in the Pichia pastoris host. Its promoting effect is not dependent on any specific species sequence, but mainly stems from GnT1's role as a key driver in the N-glycosylation pathway. This engineering strategy demonstrated good reproducibility and stability in multiple independent experiments and is applicable to lactoferrin, glycoproteins, and other exogenous proteins that are sensitive to or have complex glycan structures.
[0042] In this article, the terms “(exogenous glycoprotein expression level) increase”, “enhancement” or “enhancement” used above refer to an increase of at least 20% or more compared to the reference level, such as at least 30% or more, at least 50% or more, at least 80% or more, at least about 1, at least about 2, at least about 3, at least about 4 or at least about 5 times.
[0043] Effective ways to achieve co-expression of GnT1 and exogenous glycoproteins in yeast include constructing the GnT1 encoding gene and the exogenous protein expression cassette in the same expression vector, or constructing expression vectors separately and introducing them into host cells, so as to achieve synergistic expression of the two in the same host.
[0044] The general implementation methods for constructing an engineered GnT1-driven complex N-glycoprotein biosynthesis platform, i.e., engineered yeast, include the following aspects:
[0045] a. GnT1 coding sequence selection and design: GnT1 coding sequences from different species were selected and optimized for expression in Pichia pastoris to ensure that they have the enzymatic activity of GnT1;
[0046] b. Construction of GnT1 expression cassette and exogenous protein expression cassette: The GnT1 coding sequence was assembled with a promoter suitable for yeast expression, such as the AOX1 promoter (nucleotide sequence as shown in SEQ ID NO: 13) and a terminator, such as the AOX1 terminator (nucleotide sequence as shown in SEQ ID NO: 14), to form a GnT1 expression cassette, which was then co-constructed with an exogenous glycoprotein expression cassette in the expression vector;
[0047] c. Pichia pastoris transformation and screening of engineered strains: The expression vector was introduced into the Pichia pastoris host by electroporation, positive transformants were screened and identified, and stable engineered strains were established;
[0048] d. Induced expression and analysis: The engineered strain was fermented under the same culture and induction conditions. The expression levels and N-glycan structures of exogenous glycoproteins were compared and evaluated using protein analysis and glycan analysis methods.
[0049] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and are not intended to limit the scope of protection of the present invention.
[0050] Example
[0051] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.
[0052] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).
[0053] Materials and methods
[0054] In the embodiments, the whole gene synthesis, primer synthesis and sequencing were all completed by Suzhou Genewiz Biotechnology Co., Ltd.
[0055] The molecular biology experiments in the examples included plasmid construction, enzyme digestion, ligation, competent cell preparation, transformation, culture medium preparation, etc., mainly referring to "Molecular Cloning: A Laboratory Manual" (4th Edition), edited by M.R. Green and J. Sambrook (USA), translated by He Fuchu, Science Press, Beijing, 2017. Specific experimental conditions can be determined through simple experiments if necessary.
[0056] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.
[0057] The strains used included Pichia pastoris GS115, which was purchased from the Shanghai Institute of Microbiology.
[0058] The PCR amplification primers for some gene fragments in this embodiment are listed in Table 1.
[0059] Table 1. Primers for PCR amplification of gene fragments in this embodiment
[0060] Primername Sequence(5’-3’) int12-up-F catgtaacagtccttcaacacatgg int12-up-GAP-R ACGAGGACACCAAGACATTTCTACAAAAAcatcagtcattcaatctcctgacattcctg int12-up-GAP-F caggaatgtcaggagattgaatgactgatgTTTTTGTAGAAATGTCTTGGTGTCCTCGT GAP-int12-dn-F cgtcctgtattatcttcaacctgaaagagtctttggaagggaccacgggggatgtttttc GAP-int12-dn-R gaaaaacatcccccgtggtcccttccaaagactctttcaggttgaagataatacaggacg int12-dn-R ggtgctaaccctcttattgtgaaca int10-UP-F cacaacaacaacaacaactattcaaaacagtctttg PGAP-INT12UP-R GACGAGGACACCAAGACATTTCTACAAAAAgggagttcctttctatagaatgtccatc INT10-UP-PGAP-F atggacattctatagaaaggaactcccTTTTTGTAGAAATGTCTTGGTGTCCTCGTC TGAP-INT10-DN-F TCCGTCCTGTATTATCTTCAACCTGAAcagctgctcaagaagggactgtacattg INT10-DN-TGAP-R ccaatgtacagtcccttcttgagcagctgTTCAGGTTGAAGATAATACAGGACGGAC INT10-DN-R gccacagtcacaattctttactccatg in1-up-F atgacttcttggaatcgtgtgctc pGAP-int1-up-R GAGGACACCAAGACATTTCTACAAAAAgaaagtggcactggagttccaaatttc in1-up-pGAP-F taaaggaaatttggaactccagtgccactttcTTTTTGTAGAAATGTCTTGGTGTCCTC int1-dn-Tgap-R cttttgcaacgtaaatactagtctaaaagctttcaggttgaagataatacaggacggac tGAP-int1-dn-F cgtcctgtattatcttcaacctgaaagcttttagactagtatttacgttgcaaaagaag int1-dn-R aaccagaaaattctggacagcaatatagg External int-1-Ver-R ctacatgcttcgcctttccagatg tVER-F gcttgaacaatgcgggctgtag AOX-T-ZEO-F CAGAGTACAGAAGATTAAGTGAGAatcaatGATCCCCCACACACCATAGC ZEO-AOX-TR GCTATGTGTGTGGGGGATCattgatTCTCACTTAATCTTCTGTACTCTG ver-R1 TAGTATGCTGTGCTTGGGTG VER-F1 TTCTGTACAGACGCGTGTAC Zeo-ORI-F CGCTCGAAGGCTTTAATTTGCaatacggttatccacagaatcag ORI-Zeo-R attctgtggataaccgtattGCAAATTAAAGCCTTCGAGCGTC VER-F2 agagttggtagctcttgatc ori-AOX1-F ggatcttcacctagatccttGATCTAACATCCAAAGACGAAAG AOX1-ori-R1 TCGTCTTTGGATGTTAGATCaaggatctaggtgaagatcc VER-EAEA-F3 ATTGCGACTGGTTCCAATTG VER-R2 CAATCAGCAGTAGATTCACC VER-F4 CTGTTACTGAAGCTCAATCTTG 3-AOX-R GGCAAATGGCATTCTGACAT External AOX-F caacgcattcacgccattgc VER-R1 TAGTATGCTGTGCTTGGGTG
[0061] In Table 1, the suffix "F" in primer names indicates forward direction; "R" indicates reverse direction.
[0062] Example 1: Construction of Pichia pastoris GS115 engineered strains expressing GnT1 from different species and expression of bovine lactoferrin
[0063] (I) Construction and identification of engineered GnT1 expression integration structures (combined with...) Figure 1 a and Figure 2 )
[0064] like Figure 1 As shown in Figure a, the integration structure used to stably express GnT1 in the Pichia pastoris genome in this embodiment is designed with the int1 site as the target. The integration structure includes, from the 5' end to the 3' end, the int1-up homologous arm, the GAP promoter, the Kre2p (1-100) localization sequence, the GnT1 coding sequence, the GAP terminator, and the int1-dn homologous arm, which together constitute the int1-GnT1 integration fragment.
[0065] In the specific construction process, the HZP-sgRNA plasmid (gifted by Professor Lian Jiachang's research group at Zhejiang University, its structural description can be found in the literature DOI: 10.1021 / acssynbio.1c00307) was used as a template, and PCR amplification was performed using primers lox71-ResP-F / lox66-ResT-R to obtain the zeocin fragment containing the selection marker.
[0066] Using Pichia pastoris genomic DNA as a template, the int1-up homologous arm (approximately 899 bp) and the int1-dn homologous arm (approximately 898 bp) were amplified using primers int1-up-F / pGAP-int1-up-R and tGAP-int1-dn-F / int1-dn-R, respectively.
[0067] like Figure 1 As shown in the linear structure above 'a', the constitutive promoter GAPpromoter serves as the driving element for GnT1 expression. To achieve efficient localization of GnT1 in the subcellular compartments related to the secretion pathway, a Kre2p (1-100) localization sequence derived from a yeast Golgi-related protein was introduced at the 5' end of the GnT1 coding sequence and fused with the human GnT1 (HsGnT1) coding sequence. The GnT1 coding sequence is approximately 2259 bp in length and was obtained through gene synthesis after codon optimization.
[0068] The zeocin fragment, int1-up, GnT1 coding fragment, and int1-dn fragment were amplified by PCR and purified by gel extraction. Subsequently, using overlap PCR, the above fragments were spliced in the order int1-up-pGAP-GnT1-tGAP-int1-dn to obtain an integrated expression fragment of approximately 4056 bp int1-up-pGAP-GnT1-tGAP-int1-dn.
[0069] (II) Construction of exogenous lactoferrin expression vector and plasmid-level identification (combined with...) Figure 1 b and Figure 2 a)
[0070] like Figure 1As shown in Figure b, the exogenous protein expression module was constructed using buffalo lactoferrin (blf1) as the model target gene. Using the codon-optimized buffalo lactoferrin coding sequence as a template, the blf1 fragment was obtained by PCR amplification, and an OST-α-factor secretion signal peptide sequence was attached to its 5' end. This signal peptide includes the OST-derived signal peptide pre-region and the α-factor secretion leader sequence, which drive lactoferrin expression via the secretory pathway.
[0071] The OST-α-factor-blf1 fusion gene was placed between the AOX1 promoter (nucleotide sequence shown in SEQ ID NO: 13) and the AOX1 terminator (nucleotide sequence shown in SEQ ID NO: 14) to construct a foreign protein expression cassette. This cassette, along with elements such as the Zeocin resistance selection marker, the EM7 promoter, the CYC1 terminator, and the bacterial origin of replication (ori), was then assembled into a Pichia pastoris expression vector to form... Figure 1 The lactoferrin expression plasmid shown in b is shown in the image.
[0072] like Figure 2 As shown in Figure a, using the constructed recombinant expression plasmid as a template, PCR amplification was performed using the verification primers VER-F4 / VER-R2, and a specific band of approximately 5536 bp in theoretical size was obtained, indicating that the lactoferrin expression plasmid was correctly constructed at the plasmid level.
[0073] like Figure 2 As shown in Figure a, the obtained int1-up, GnT1, int1-dn and full-length integrated fragments were identified by PCR. The amplified band sizes were consistent with the theoretical design, indicating that the GnT1 integrated expression structure was constructed correctly.
[0074] The preparation process of competent cells of Pichia pastoris is as follows:
[0075] (1) Take out the P. pastoris GS115 glycerol bacteria stored in the -80℃ freezer, pick a small amount from the frozen tube and streak it onto YPD antibiotic-free solid medium, and incubate at 30℃ for 3 days until larger colonies grow and then take them out;
[0076] (2) Pick larger colonies from the plate and inoculate them into 10 mL of YPD medium. Incubate at 30°C and 200 rpm for 1 day.
[0077] (3) Secondary activation: Inoculate 1 mL of the bacterial culture obtained in step (2) into 100 mL of YPD medium and culture for 4-5 h to keep the cells highly active.
[0078] (4) Place the culture medium on ice and let it stand. Then dispense it into sterile centrifuge tubes and centrifuge at 4℃, 4,000×g for 5 min. Discard the supernatant. Add 10 mL of sterile water to resuspend the cells and repeat the above operation. Wash with water 3 times in total.
[0079] (5) After washing, add 1 mL of pre-cooled 1M sorbitol solution to each tube to resuspend the cells, transfer to a sterile 1.5 mL centrifuge tube, centrifuge at 4℃ and 4,000×g for 5 min, and discard the supernatant;
[0080] (6) Add 80 μL of pre-cooled 1M sorbitol solution to each tube to resuspend the cells, thus completing the preparation of P. pastoris GS115 competent cells.
[0081] Add the constructed lactoferrin expression integration fragment (5-10 ng) to the prepared competent cells, mix gently, and incubate on ice for 5 min. After the ice incubation, transfer the mixture to a 0.2 cm electroporation cuvette and electroporate at 1,500 V for 5 ms. After electroporation, quickly add 1 mL of ice-cold 1 M sorbitol solution, gently pipette to mix, and transfer to a centrifuge tube for recovery in a 30°C metal bath for 1-2 h. After recovery, centrifuge at 6,000 × g for 5 min, discard the supernatant, gently resuspend the pellet, plate it on MD plates, and incubate at 30°C for approximately 3 days to obtain positive colonies.
[0082] (III) Pichia pastoris transformation, integration, and identification of positive strains (combined with...) Figure 1 , Figure 2 and Figure 3 )
[0083] Identification of GnT1 expression cassette integration into the genome at the int1 site (combined with...) Figure 3 (Lower part of a): Transformant colonies were picked from MD plates as templates for colony PCR identification. For GnT1 site-directed integration events, PCR amplification was performed using the int1 genome outer primer (outer int1-Ver-R) and the GnT1 expression cassette specific primer (tVER-F).
[0084] like Figure 3 As shown in the lower part of section a, the theoretical amplified fragment size is 1366 bp. Electrophoresis results showed that specific bands consistent with the theoretical size were detected in multiple transformant strains, indicating that GnT1 expression cassettes from different species have been successfully integrated into the int1 site of Pichia pastoris GS115 via homologous recombination.
[0085] Genomic integration identification of buffalo lactoferrin (bLF) expression cassette at the AOX1 site (binding) Figure 3(Upper part of a): To verify the integration of the exogenous lactoferrin expression cassette into the genome, genomic PCR identification of the bLF expression cassette was further performed from the same batch of transformants. Amplification was performed using the AOX1 genome outer primer (outer AOX-F) and the bLF expression cassette specific primer (VER-R1), with a theoretical amplified fragment size of 3911 bp. Figure 3 As shown in the upper part of section a, some transformants exhibited a specific band (approximately 3911 bp) consistent with the theoretical size, indicating that the OST-α-factor-bLF expression cassette has been successfully integrated into the AOX1 site of the Pichia pastoris genome. Figure 2 Figure b shows the recombinant expression plasmid map of GnT.
[0086] Obtaining and Streak Validating Dual-Module Engineered Strains (Combined with) Figure 3 (b) Based on the combined genomic PCR identification results of the two groups above, positive Pichia pastoris engineered strains carrying both the GnT1 regulatory module (int1 site) and the bLF expression module (AOX1 site) were screened. Transformants identified as positive by PCR were then subjected to streak plating for verification. Figure 3 As shown in Figure b, the left figure shows the streak validation results of the bLF expression-integrating strain, and the right figure shows the streak validation results of the GnT1 site-directed integration strain. The results show that the positive strains can grow stably under the corresponding selection conditions, indicating that the constructed engineered strains have good genetic stability.
[0087] Example 2: Fermentation detection and analysis of bovine lactoferrin expression levels in engineered bacteria and its purification.
[0088] Select the positive transformants and inoculate them into BMGY medium. Incubate at 30°C and 250 rpm for 16-20 hours until OD500 reaches the target value. 600 Centrifuge at 4000×g for 10 min, collect the bacterial cells, and resuspend the cells in BMMY medium until OD500. 600 The value was approximately 1. Expression was performed at 28℃, 250 rpm, and pH 6.0. Methanol, the inducer, was added every 24 hours until the final concentration was 0.5% v / v. The total induction time was 96 hours.
[0089] BMGY medium: yeast extract 10 g / L, peptone 20 g / L, potassium phosphate buffer (pH 6.0) 100 mM, YNB 13.4 g / L, biotin 0.4 mg / L, glycerol 10 mL / L. BMMY medium: yeast extract 10 g / L, peptone 20 g / L, potassium phosphate buffer (pH 6.0) 100 mM, YNB 13.4 g / L, biotin 0.4 mg / L, methanol 5 mL / L.
[0090] The shake-flask fermentation process is as follows:
[0091] (1) Select the positive transformants and incubate them in test tubes with YPD overnight for 24 hours.
[0092] (2) Inoculate into 30ml of BMGY medium at a ratio of 3% v / v, and incubate at 30℃ and 250rpm for 16-20h.
[0093] (3) Centrifuge at 4000×g for 10 min, collect the bacterial cells, and resuspend the cells in 50 ml of BMMY medium until OD. 600 It is around 1.
[0094] (4) Expression was carried out at 30℃, 250rpm and pH 6.0.
[0095] (5) Add methanol as an inducer every 24 hours until the final concentration is 0.5% v / v.
[0096] (6) The total induction time was 96 hours. The endpoint OD600 was approximately 8-10.
[0097] Buffalo lactoferrin secreted by SDS-PAGE and Western blot was detected and analyzed. Results are shown below. Figure 4 .
[0098] Figure 4 The experimental results showed that, compared with the GS115-BLF control strain without GnT1, the secretory expression level of bovine lactoferrin in the GS115-GnT1-BLF engineered strain was significantly increased. Specifically, a more pronounced lactoferrin-specific band was observed in SDS-PAGE analysis, and the secretion amount was also significantly higher than that of the control strain in quantitative analysis. These results indicate that the introduction of GnT1 can effectively improve the secretory expression efficiency of bovine lactoferrin in Pichia pastoris.
[0099] Example 3: Analysis of GnTI gene results from different species
[0100] Following the methods described in Examples 1 and 2, Pichia pastoris engineered strains expressing GnT1 from different species were constructed and obtained. These strains were cultured under the same fermentation conditions, and the secretory expression levels of buffalo lactoferrin were detected and purified. The results are shown in [link to relevant documentation]. Figure 6The experimental results showed that the promoting effect of GnT1 from different species on the secretion and expression level of bovine lactoferrin varied significantly. GnT1 from *Saccharomyces cerevisiae* showed the highest bovine lactoferrin secretion and expression level, followed by GnT1 from *Arabidopsis thaliana*, with mouse GnT1 in the middle. Human and bovine GnT1 showed relatively low bovine lactoferrin secretion and expression levels, and these levels were similar. These results indicate that the functional expression of GnT1 from different species differs in the *Pichia pastoris* host, but all can promote the secretion and expression of bovine lactoferrin to some extent.
[0101] Example 4: Analysis of the synergistic effect of glycosylation regulation modules on glycoprotein expression
[0102] Comparative analysis of ELISA data (see Table 2) revealed that different engineered glycosylation regulatory modules significantly affected the secretory expression level of bovine lactoferrin. Using the control strain GS115-BLF without the glycosylation regulatory module as a reference, its lactoferrin secretion expression level was approximately 1200 μg / L. Based on this, the introduction of GnT1 from different species significantly increased the secretory expression level of lactoferrin, but the magnitude of the increase varied considerably. Specifically: the lactoferrin secretion level in the GS115-ScGnT1-BLF engineered strain reached approximately 4080 μg / L, which was about 2.4 times higher than that of the control strain, and was the highest among all single GnT1 constructs; the lactoferrin secretion level in the GS115-AtGnT1-BLF engineered strain was approximately 3000 μg / L, an increase of about 1.5 times; the lactoferrin secretion level in the GS115-MmGnT1-BLF engineered strain was approximately 2500 μg / L, an increase of about 1.1 times; the lactoferrin secretion level in the GS115-HsGnT1-BLF engineered strain was approximately 2300 μg / L, an increase of about 0.9 times; and the lactoferrin secretion level in the GS115-BtGnT1-BLF engineered strain was approximately 2700 μg / L, an increase of about 1.3 times. The above results indicate that, under the experimental conditions of this embodiment, the promoting effect of GnT1 from different species on bovine lactoferrin secretion expression generally follows the following order: ScGnT1 > AtGnT1 > BtGnT1 ≈ MmGnT1 > HsGnT1.
[0103] Based on this, the effect of the multi-enzyme cascade glycosylation regulatory module on lactoferrin secretory expression was further constructed and detected using ELISA. The results showed that in the ScGnT1-ScManII-BLF engineered strain, the lactoferrin secretory expression level was approximately 3400 μg / L, significantly higher than the control strain, but lower than the level of ScGnT1 expression alone; in the ScGnT1-ScManII-ScGnT-II-BLF engineered strain, the lactoferrin secretory expression level was approximately 3000 μg / L; and in the ScGnT1-ScManII-ScGnT-II-ScGal1-BLF engineered strain formed by further introducing ScGal1, the lactoferrin secretory expression level was approximately 3200 μg / L. These results indicate that while the multi-enzyme cascade glycosylation module improves the complexity of the glycan structure, it may also have a certain impact on the overall secretory expression level of the target protein, and its expression level does not necessarily increase linearly with the extension of the glycosylation pathway.
[0104] Table 2. Results of bovine lactoferrin expression level detection in engineered strains
[0105] strain number Bovine lactoferrin expression level (μg / L) GS115-BLF (SEQ ID NO: 11) 1200 GS115-ScGnT1-BLF (SEQ ID NO: 1) 4080 GS115-AtGnT1-BLF (SEQ ID NO: 3) 3000 GS115-MmGnT1-BLF (SEQ ID NO: 5) 2500 GS115-HsGnT1-BLF(SEQ ID NO: 7) 2300 GS115-BtGnT1-BLF(SEQ ID NO: 9) 2700 GS115-ScGnT1-ScManII-BLF 3400 GS115-ScGnT1-ScManII-ScGnT-II-BLF 3000 GS115-ScGnT1-ScManII-ScGnT-II-ScGal1-BLF 3200
[0106] The above embodiments are only used to illustrate the technical solutions of the present invention. Without departing from the spirit of the present invention, those skilled in the art can make various modifications or alterations to the present invention on this basis. Equivalent forms of various variations or modifications should also fall within the scope of the present invention.
Claims
1. A method for improving the expression of exogenous glycoproteins in yeast, characterized in that, The process includes the following steps: integrating an exogenous N-acetylglucosamine transferase I (GnT1) gene, derived from a different species than the yeast host, into the genome of a yeast host expressing a glycoprotein, thereby constructing an engineered yeast strain expressing the exogenous GnT1, and expressing and secreting the glycoprotein through fermentation.
2. The method according to claim 1, characterized in that, The exogenous GnT1 gene is introduced into the yeast host without altering the endogenous genes in the yeast host cell and / or without introducing exogenous glycan processing enzymes.
3. The method according to claim 1, characterized in that, Exogenous GnT1 is GnT1 derived from animals, insects, plants, or fungi.
4. The method according to claim 3, characterized in that, The exogenous GnT1 is derived from Holstein cattle (Bostaurus, Bt), humans (Homo sapiens, Hs), mice (Mus musculus, Mm), Arabidopsis thaliana (Arabidopsis thaliana, At), or Saccharomyces cerevisiae (Saccharomyces cerevisiae, Sc).
5. The method according to claim 1, characterized in that, The amino acid sequence of GnT1 from Saccharomyces cerevisiae (Sc) is shown in SEQ ID NO: 1, and the nucleotide sequence of the CDS region encoding the gene is shown in SEQ ID NO:
2. The amino acid sequence of GnT1 derived from Arabidopsis thaliana (At) is shown in SEQ ID NO: 3, and the nucleotide sequence encoding the CDS region of the gene is shown in SEQ ID NO:
4. The amino acid sequence of GnT1 derived from mice (Mus musculus, Mm) is shown in SEQ ID NO: 5, and the nucleotide sequence encoding the CDS region of the gene is shown in SEQ ID NO:
6. The amino acid sequence of GnT1 derived from human (Homo sapiens, Hs) is shown in SEQ ID NO: 7, and the nucleotide sequence encoding the CDS region of the gene is shown in SEQ ID NO:
8. The amino acid sequence of GnT1 derived from Holstein cattle (Bos taurus, Bt) is shown in SEQ ID NO: 9, and the nucleotide sequence encoding the CDS region of the gene is shown in SEQ ID NO:
10.
6. The method according to claim 1, characterized in that, The yeast host is either Pichiapastoris or Saccharomyces cerevisiae, preferably Pichiapastoris.
7. The method according to claim 1, characterized in that, The glycoprotein is an exogenous glycoprotein with a complex N-glycan structure. The glycoprotein is selected from polyglycosylated proteins with two or more glycosylation sites, high isoelectric point proteins (pI≥8), and complex folded proteins with tertiary structure.
8. The method according to claim 1, characterized in that, After introducing GnT1 from different species into the yeast host, the elongation, modification, or processing pathways of high-mannose N-glycans in the yeast host were weakened, inhibited, or reconstructed, limiting the further elongation of high-mannose N-glycans to Man6 and above structures, and increasing the relative proportion of Man5 N-glycans in the cell.
9. The method according to claim 1, characterized in that, The integration of the exogenous GnT1 gene can be achieved through gene editing technology or transformation with a GnT1 overexpression plasmid.
10. The method according to claim 9, characterized in that, The gene editing technology is selected from the following group: homologous double crossover, Red homologous recombination, TALEN system, CRISPR-Cpf1 system, CRISPR-Cas12a system, MuGENT, MUCICAT.
Citation Information
Patent Citations
Method for preparing animal cell galactosylated modification influenza HA (Hemagglutinin) glycoprotein from glycosyl engineering yeast
CN105671109A
Construction method of engineered yeast for glycoprotein preparation and strain of engineered yeast
CN113549560A