Application of receptor kinase OsCRK17 gene in regulating rice salt tolerance

By cloning and validating the rice receptor kinase OsCRK17 gene, overexpression and gene knockout vectors were constructed and transformed into rice to clarify its regulatory role in rice salt tolerance. This solved the problem of the difficulty in efficiently improving rice salt tolerance in traditional breeding methods and achieved the effect of enhancing salt tolerance.

CN122104791APending Publication Date: 2026-05-29HUBEI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610534696.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-22
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Traditional breeding methods are difficult to improve the salt tolerance of rice efficiently and accurately. Existing technologies are limited by the narrow genetic background of germplasm resources, the complexity of multi-gene regulation, and the long phenotypic identification cycle, making it difficult to cultivate new salt-tolerant varieties.

Method used

The rice receptor kinase OsCRK17 gene was cloned and validated. Overexpression and gene knockout vectors were constructed, and Agrobacterium-mediated transformation was used to transform it into rice for overexpression and gene editing to clarify its regulatory role in rice salt tolerance.

Benefits of technology

Overexpression of the OsCRK17 gene enhances salt tolerance in rice, while gene editing weakens it. This provides a theoretical basis and genetic resources for developing new salt-tolerant rice varieties and offers a new strategy for genetic improvement of rice stress resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application belongs to the field of plant genetic engineering, and particularly relates to application of a receptor kinase OsCRK17 gene in regulating salt tolerance of rice. An OsCRK17 gene capable of regulating salt tolerance of rice is screened. The nucleotide sequence of the gene is shown as SEQ ID NO:1; the protein sequence encoded by the gene is shown as SEQ ID NO:2. By using Agrobacterium-mediated transformation, a pU1301-OsCRK17 overexpression strain and a CRISPR / Cas9-OsCRK17 gene editing strain are obtained. It is found by salt stress identification of the transgenic materials that the salt tolerance of the OsCRK17 gene overexpression strain is enhanced, indicating that OsCRK17 is a positive regulation factor for regulating salt tolerance of rice, plays a positive regulation role in response of rice to salt stress, and overexpression of the OsCRK17 gene can significantly improve the salt tolerance of rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically relating to the application of a rice receptor kinase OsCRK17 gene in regulating rice salt tolerance. Background Technology

[0002] Rice (Oryza sativa L.) is the staple food for more than half of the world's population, and its stable yield is directly related to global food security. Currently, secondary soil salinization is becoming increasingly serious, and salt stress has become a significant environmental factor restricting the improvement of rice yield and quality. Developing new salt-tolerant rice varieties is an important way to tap the potential of saline-alkali land utilization, ensure food security, and promote sustainable agricultural development. Traditional breeding methods are limited by narrow genetic backgrounds of germplasm resources, complex multi-gene regulation, and long phenotypic identification cycles, making it difficult to achieve efficient and precise improvement. Therefore, exploring salt-tolerant functional genes in rice, creating new germplasm, and breeding new salt-tolerant varieties are of great strategic significance for developing water-saving, efficient, green, and sustainable agriculture.

[0003] Cysteine-rich receptor-like kinases (CRKs) are a class of plant-specific transmembrane signal transduction proteins that play a central role in sensing extracellular stress signals and initiating downstream defense responses. Members of the CRK family typically contain an extracellular cysteine-rich DUF26 domain, a transmembrane domain, and an intracellular serine / threonine kinase domain. The CRK family plays a highly conserved and functionally diverse regulatory role in plant stress adaptation. While functional studies of the CRK family in rice have begun, in-depth analysis of OsCRK17 remains insufficient. A thorough understanding of the function and mechanism of OsCRK17, and clarification of its salt tolerance molecular mechanism, can provide important gene resources and theoretical basis for the genetic improvement of rice stress resistance, and has significant application value in ensuring stable and high rice yields. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings and deficiencies of the existing technology, and to provide a gene OsCRK17 and its application in regulating rice salt tolerance. The invention has been functionally verified and transformed, providing new genetic resources and molecular breeding strategies for rice salt tolerance breeding.

[0005] The technical solution of the present invention is as follows:

[0006] The applicant cloned a rice receptor kinase OsCRK17 gene that regulates rice salt tolerance, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0007] The protein sequence encoded by the rice receptor kinase OsCRK17 gene that regulates rice salt tolerance is shown in SEQ ID NO: 2.

[0008] This invention relates to the application of rice receptor kinase OsCRK17 in regulating rice salt tolerance. More detailed technical solutions are described below:

[0009] The expression patterns of the rice CRKs family induced by salt stress were analyzed using RT-qPCR. Based on the gene expression induction, the target gene OsCRK17 was finally identified.

[0010] RNA was extracted from leaves of the japonica rice variety Nipponbare and reverse transcribed into cDNA using Superscript III. Using rice genome information, amplification primers OsCRK17-full-F (forward) and OsCRK17-full-R (reverse) were synthesized to amplify the cDNA of the OsCRK17 gene, with a full length of 2046 bp. The amplified PCR product was ligated into the pGEM-T vector, and positive clones were screened and sequenced. The sequence is SEQ ID NO: 1 in the sequence listing, and the amino acid sequence is SEQ ID NO: 2 in the sequence listing.

[0011] In this invention, the overexpression vector pU1301-OsCRK17 and the gene knockout vector CRISPR / Cas9-OsCRK17 of this gene were constructed. These two vectors were transformed into the japonica rice variety Nipponbare using Agrobacterium-mediated transformation, respectively, to obtain positive overexpression lines and positive CRISPR / Cas9 lines. The expression level of the overexpression lines was detected, and the two T1 generation overexpression lines with the highest expression levels were selected. Two T1 generation CRISPR / Cas9 gene editing lines were obtained through target detection.

[0012] This invention investigated salt stress in OsCRK17 transgenic rice materials. Results showed that compared to the wild-type control, OsCRK17 overexpression plants exhibited significantly enhanced salt tolerance, while gene-edited mutants showed significantly weakened salt tolerance. Salt stress experiments revealed that under salt stress conditions, OsCRK17 overexpression lines accumulated malondialdehyde (MDA) more rapidly and had lower levels of free proline (Pro); gene-edited lines, on the other hand, showed significantly higher levels of free proline (Pro) and hydrogen peroxide (H2O2), while MDA accumulation was relatively slow. These results confirm that OSCRK17 plays a positive regulatory role in the salt stress response of rice seedlings. This study clarifies the biological function of OSCRK17 in regulating rice salt tolerance, providing a theoretical basis and novel germplasm resources for the breeding of salt-tolerant rice varieties.

[0013] Advantages of this invention:

[0014] This invention analyzes the salt stress-induced expression pattern of OsCRK17 in rice, screens and identifies the OsCRK17 gene, and discovers that OsCRK17 is a positive regulator of salt tolerance in rice; overexpression of the OsCRK17 gene can enhance rice's salt tolerance. Through genetic transformation, new disease-resistant rice lines are obtained, and OsCRK17 can serve as a potential marker gene for rice resistance materials. Attached Figure Description

[0015] Figure 1 : OsCRK17 induced expression pattern analysis diagram. Figure label explanation: Figure 1 The expression pattern of OsCRK17 was analyzed at 0 h, 24 h, 48 h, 72 h, 96 h, and 120 h after salt stress treatment in wild-type Nipponbare rice.

[0016] Figure 2 Construction of OsCRK17 overexpression vector and CRISPR / Cas9 gene editing vector. (Figure labels are explained.) Figure 2 Figure A in the diagram is a map of the pU1301-OsCRK17 overexpression vector. Figure 2 Figure B in the diagram is a map of the CRISPR / Cas9-OsCRK17 gene editing vector.

[0017] Figure 3: Results of OsCRK17 overexpression material (T1 generation) expression level detection.

[0018] Figure 4: Identification of salt tolerance in control and transgenic materials. Figure labeling: Figure A in Figure 4 shows the phenotypic observation of the control and transgenic materials after 3 days of salt stress treatment. Figure B in Figure 4 shows the leaf mortality rate and morphological indicators of the plants after salt stress treatment in the control and transgenic materials.

[0019] Figure 5 Determination of MDA, Pro, and H2O2 contents in leaves of control and transgenic materials after 5 days of salt stress treatment. Figure labeling explanation: Figure 5 Figure A shows the determination of MDA content in leaves 5 days after salt stress. Figure 5 Figure B in the diagram shows the determination of H2O2 content in the leaves. Figure 5 Figure C in the figure shows the determination of Pro content in the leaves. Detailed Implementation

[0020] SEQ ID NO: 1 is the nucleotide sequence of the OsCRK17 gene cloned in this invention.

[0021] SEQ ID NO: 2 is the protein sequence of the OsCRK17 gene.

[0022] The following embodiments define the present invention and describe the methods for isolating and cloning cDNA segments containing the complete coding region of the OsCRK17 gene, and for verifying the function of the OsCRK17 gene. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from its spirit and scope.

[0023] Example 1: Isolation and Cloning of the OsCRK17 Gene

[0024] 1. Rice RNA extraction and reverse transcription

[0025] Total RNA was extracted from fresh leaves of the wild-type japonica rice variety Nipponbare (a publicly used rice material). A plant RNA extraction kit was used to extract total RNA, following the manufacturer's instructions. The obtained RNA samples were first subjected to a genomic DNA removal reaction. The DNA removal reaction solution consisted of: 2.0 μL 5×gDNA Eraser Buffer, 1.0 μL gDNA Eraser, 1.0 μg RNA, and 6.0 μL RNase-free ddH2O. After mixing, the mixture was incubated in a dry bath at 42℃ for 2 min. The digested mixture was then used for reverse transcription. The reaction solution consisted of: 1.0 μL Prime Script RT Enzyme Mix I, 4.0 μL RT Primer Mix, 4.0 μL 5×Prime Script Buffer 2, 1.0 μL RNase-Free ddH2O, and 10.0 μL of the digested mixture. The reverse transcription conditions were: 37℃ for 15 min; 85℃ for 5 sec; and storage at 4℃.

[0026] 2. Analysis of the expression pattern of OsCRK17 gene induced by NaCl simulated salt stress

[0027] To investigate whether the OsCRK17 gene is involved in regulating salt tolerance in rice, this invention used RT-qPCR to detect the relative expression level of the OsCRK17 gene transcription in wild-type rice after salt stress. The results showed that the OsCRK17 gene expression was significantly upregulated by NaCl salt stress. Wild-type Nipponbare rice is a japonica conventional rice variety. Salt stress experiments were conducted on it when it reached the 4-leaf stage. After the stress experiment, total RNA was extracted from leaves of the treated lines and reverse transcribed into cDNA as a template. OsCRK17-specific primers were designed: forward primer qOsCAMTA-F (5'TGCCGTTAGTTGAGGGAAAG3') and reverse primer qOsCAMTA4-R (5'CCATTCGCATTGTGACCTCC3'). Using rice endogenous actin Actin (gene accession number AK101613) as an internal reference gene, forward primer Actin-F (5'GAGACCTTCAACACCCCTGCTA 3') and reverse primer Actin-R (5'ATCACCAGAGTCCAACACATTACCT 3') were designed. Real-time quantitative RT-qPCR analysis was performed on a BIO-Rad-CFX Connect fluorescence quantitative PCR instrument. Results showed that OsCRK17 expression was significantly upregulated under salt stress, suggesting that OsCRK17 may be involved in the rice response to salt stress.

[0028] 3. Obtaining the OsCRK17 gene sequence

[0029] The full-length sequence of OsCRK17 was cloned using cDNA from Nipponbare japonica rice as a template, with forward primer OsCRK17-full-F (5'TTGAGGGAAAGAATCACTACC3') and reverse primer OsCRK17-full-R (5'CTGACTTTTACCCATTCGCA3'). PCR reaction conditions: 94 ℃ pre-denaturation for 3 min; 30 cycles of 94 ℃ for 30 sec, 59 ℃ for 30 sec, 72 ℃ for 2 min 50 sec; extension at 72 ℃ for 7 min. The amplified PCR product was ligated into the pGEM-T vector, positive clones were screened and sequenced, and positive strains were stored at -80 ℃. The open reading frame (ORF) of the desired OsCRK17 gene was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. The open reading frame (ORF) of the OsCRK17 gene was determined using BlastX (http: / / www.ncbi.nlm.nih.gov), which contains 681 amino acids. Based on this, the protein sequence encoded by the OsCRK17 gene is inferred to be shown in the sequence listing SEQ ID NO: 2.

[0030] Example 2: OsCRK17 overexpression and CRISPR / Cas9 gene knockout vector construction

[0031] 1. Construction of overexpression vectors

[0032] To verify the gene function of OsCRK17, the applicant constructed an overexpression vector to transform Nipponbare embryogenic callus. Using the OsCRK17 positive clone plasmid obtained in Example 1 as a template, overexpression primers were designed, with homologous recombination adapter bases added to both ends of the primers: the forward primer OsCRK17-OE-F (5' GAACGATAGCCGGTACCATGAGCCTGAGTTTTGA3') and the reverse primer OsCRK17-OE-R (5' CTTTGTAATCGGATCCCTATTCAGCAGTGGCTTG 3'), for PCR amplification. The obtained PCR products were subjected to agarose gel electrophoresis and purified, then stored at -20℃ for later use. The pU1301-3*Flag strain was activated in liquid LB medium (with 50 mg / L kanamycin added), and the plasmid was extracted. The plasmid was then double-digested with KpnI and BamHI, and the digested products were purified and stored at -20℃ for later use. The OsCRK17 target fragment, recovered from the enzyme digestion, was infused with the linearized vector pU1301-3*Flag using a homologous recombinase to obtain the recombinant vector (pU1301-OsCRK17-6*Flag). The specific reaction system was as follows: 1.0 μL of double-digested linearized pU1301-3*Flag vector, 1.0 μL of 5×CE II Buffer, 0.5 μL of Exnase II homologous recombinase, 0.8 μL of PCR-purified and recovered OsCRK17 with the vector adapter, and the volume was brought to 5.0 μL with sterile ddH2O. After incubation at 37℃ for 0.5 h, heat shock transformation was performed on *E. coli* strain DH5α. The specific transformation procedure is as follows: Thaw *E. coli* DH5α competent cells stored at -80℃ on ice. Add 50 μL of competent cells to 5 μL of the ligation reaction mixture, mix gently, and place on ice for 15-30 min. After the ice bath, incubate at 42℃ for 90 sec, then immediately place on ice for 3 min. Add 400 μL of LB liquid medium and incubate at 37℃, 200 rpm for 45 min to recover the cells. After recovery, centrifuge at 5000 rpm for 2 min, discard 300 μL of supernatant, and resuspend the cells in the remaining supernatant. Spread the bacterial culture evenly on LB solid medium (with 50 mg / L kanamycin added) and incubate inverted at 37℃ overnight. Pick single clones, select 2-3 positive clones for sequencing, and preserve the strain without any mutations and the corresponding plasmid, naming it recombinant plasmid pU1301-OsCRK17-6*Flag.The correctly sequenced recombinant plasmid pU1301-OsCRK17-6*Flag was transformed into competent Agrobacterium tumefaciens EHA105 cells using a freeze-thaw method. Single colonies were picked and cultured on YEP liquid medium (YEP liquid medium is a commonly used medium; in this example, 30 mg / L rifampin and 50 mg / L kanamycin were added). The culture was shaken at 28°C for 36-48 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use.

[0033] 2. Construction of CRISPR / Cas9 gene knockout vector

[0034] Guide RNA (gRNA) for OsCRK17 was designed using CRISPR-P 2.0. Based on the DNA sequence and gene structure of OsCRK17, two gRNAs were designed (i.e., gRNA1: 5' ACGTGCTTCACAAAGAAGCA 3'; gRNA2: 5'TGTGAATCGGTATTTTCGGA 3'). Synthesize the adapter primers CRK17-gRNA1-U3F (5' ACGTGCTTCACAAAGAAGCAGTTTTAGAGCTAGAAATA 3'), CRK17-gRNA1-U3R (5' TGCTTCTTTGTGAAGCACGTTGCACCAGCCGGGAAT 3'), and the adapter primers required for gRNA ligation into the expression vector pRGEB32: S5AD5-F (5'CAGATGATCCGTGGCAACAAAG3') and S5AD5-R (5' TTTCTAGCTCTAAAACAAAA 3'); L5AD5-F (5'CAGATGATCCGTGGCAACAAAGCACCAGTGGTCTAG3') and L5AD5-R (5' TTTCTAGCTCTAAAACAAAAAAAAAAGCACCGACTCG3'). Using pGTR plasmid as a template, PCR amplification was performed using three primer pairs: L5AD5-F / CRK17-gRNA1-U3R, CRK17-gRNA1-U3F / CRK17-gRNA2-U3R, and CRK17-gRNA2-U3F / L5AD5-R. PCR reaction conditions were: 94 ℃ pre-denaturation for 3 min; 26 cycles of 94 ℃ for 30 sec, 59 ℃ for 30 sec, and 72 ℃ for 30 sec; extension at 72 ℃ for 7 min. The three RCR products were diluted 20-50 times and mixed in equal volumes. 1 μL of this mixture was used as a template for amplification using the S5AD5-F / S5AD5-R primer pair. PCR reaction conditions: 94 ℃ pre-denaturation for 3 min; 26 cycles of 94 ℃ for 30 sec, 59 ℃ for 30 sec, 72 ℃ for 45 sec; extension at 72 ℃ for 7 min. The resulting product (i.e., the DNA fragment containing two gRNAs in tandem) was purified and its concentration was determined. The CRISPR / Cas9 expression vector pRGEB32 was digested with BsaI, and the digestion product was purified and recovered to obtain the linearized pRGEB32 vector. The purified PCR product was ligated into the linearized pRGEB32 vector using infusion recombination.Specific reaction conditions: 100 ng of PCR product, 50-80 ng of linearized pRGEB32 vector, 1 μL of infusion enzyme (Takara), 1 μL of 10× infusion buffer, and ddH2O added to a final volume of 10 μL. The reaction was carried out at 50°C for 30 min. The reaction product was then heat-shocked and transformed into *E. coli* DH5α. Single colonies were selected for positive detection and sequencing. Positive strains and plasmids were preserved, and the positive plasmid was transformed into *Agrobacterium tumefaciens* EHA105 competent cells. Single colonies were picked and cultured in YEP liquid medium (with 30 mg / L rifampin and 50 mg / L kanamycin added in this example) at 28°C with shaking for 36-48 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use.

[0035] Example 3: Genetic transformation of rice

[0036] 1. Callus induction: First, select plump, uniformly shaped wild-type Nipponbare seeds, remove the glumes, and ensure the seeds are intact. Then, place the treated seeds in a sterile conical flask, soak them in 75% ethanol for 1 min, discard the ethanol, and then add 0.15% HgCl2 solution to soak for 15-20 min. After soaking, pour the HgCl2 solution into a recovery bottle. Wash the seeds repeatedly with ddH2O 7-8 times. After washing, place the seeds on filter paper to absorb the surface moisture. Inoculate the seeds evenly onto the surface of the sterilized induction medium that has been placed for 3 days. After inoculation, place the medium in a 28℃ dark incubator and incubate for 45-50 days.

[0037] 2. Subculture: Prepare the subculture medium 2-3 days in advance, using fresh callus induction medium. Sterilize the medium using standard methods to ensure it is moderately dry (medium with excessive moisture is detrimental to callus growth). Select pale yellow, granular, dry, and viable callus pieces from the induced callus and transfer them to the prepared subculture medium. Incubate at 28°C in the dark for 20 days.

[0038] 3. Pre-culture: Dispense sterile pre-culture medium into 500 mL Erlenmeyer flasks in advance; before the experiment, add 300 μL of 100 mM acetylsalicylic acid and 5 mL of 40% glucose to each 250 mL medium, mix thoroughly, and dispense the medium into 8-10 dishes per flask; then, from the subcultured callus, pick out pale yellow, granular, dry and viable callus tissue, transfer it into the culture dishes of pre-culture medium, inoculate 60-80 pieces of callus tissue the size of mung beans in each dish, and incubate in an 8℃ dark incubator for 3 days.

[0039] 4. Infection and Co-culture: Two days prior to the experiment, Agrobacterium strains containing the target gene OsCRK17 were streaked onto antibiotic plates supplemented with 30 mg / L rifampin and 50 mg / L kanamycin for activation. Simultaneously, relevant reagents and equipment were prepared, including 100 mL / strain suspension medium, 250 mL / strain co-culture medium, several large Petri dishes, small Petri dishes lined with absorbent paper and filter paper (sterilized and dried before use), and 250 mL sterile Erlenmeyer flasks. On the day of the experiment, the streaked Agrobacterium was scraped into 1 / 2 N6 suspension medium (containing 100 μL acetylsyl syringone (AS) + 2 mL 50% glucose) and incubated at 28℃ and 200 rpm with shaking for 30 min. Simultaneously, the pre-cultured callus tissue was collected into 250 mL sterile Erlenmeyer flasks for later use. After the bacterial culture was complete, it was poured into the Erlenmeyer flasks containing the callus tissue and soaked for 30 min for infection. After infection, discard the bacterial solution. First, invert the Erlenmeyer flask containing the callus tissue onto a sterile petri dish to absorb any remaining bacterial solution. Then, spread the callus tissue evenly on filter paper in a sterile large petri dish, cover it with another sheet of filter paper, and gently press the callus tissue with sterile forceps to thoroughly absorb the surface bacterial solution. Allow it to air dry for 3-4 hours. Spread the fully dried callus tissue evenly onto the surface of the co-culture medium using a sterile spoon, and finally incubate it in a 19°C dark incubator for 3 days. Note: Avoid moving the tissue after spreading to minimize contact between the culture medium and the callus surface and prevent excessive growth of Agrobacterium.

[0040] 5. Washing and First Screening (S1): Prepare sterile water, large petri dishes, small petri dishes lined with absorbent paper and filter paper, and several 250mL Erlenmeyer flasks, and prepare screening medium. Transfer the co-cultured callus to a washing cup, pour in sterile water until completely submerged, cover and shake for 20-30 seconds, then discard the liquid. Repeat this operation 2-3 times. Then add sterile water again to submerge the material, cover and shake for 20-30 seconds, let stand for 5 minutes, and discard the liquid. Next, add sterile distilled water for the third time to submerge the material, cover and shake for 20-30 seconds, let stand for 10 minutes, and then discard the liquid. Then add sterile water containing 500 mg / L carbenicillin, shake at 200 rpm for 30 minutes, discard the liquid after shaking, allow the callus to air dry, and finally transfer the dried callus to screening medium and incubate in the dark at 28℃ for 20 days.

[0041] 6. Second screening (S2): First, prepare the screening medium. Add 300 μL carbenicillin, 250 μL hygromycin and 5 mL 50% glucose to every 250 mL of medium. After pouring into the dish, open the lid on a clean bench and blow with sterile air for 1.5-2 hours to keep the surface of the medium at a suitable dryness (avoid excessive moisture which may affect the inhibitory effect of Agrobacterium and the growth of resistant callus). Then, select dry, Agrobacterium-free callus from the S1 screening medium and inoculate it into the S2 medium at a density of 25-30 pieces per dish. Incubate in the dark at 28℃ for 20 days.

[0042] 7. Differentiation of callus tissue: Prepare differentiation medium 3-4 days before differentiation culture. Then select small pieces of light yellow, dense and dry resistant callus tissue, inoculate them onto the differentiation medium, and culture them at 28℃ and light intensity of 3000 Lux for 40 days. In the later stage of culture, the callus tissue will differentiate into seedlings.

[0043] 8. Rooting Culture: Prepare rooting culture medium 2-3 days in advance and prepare 4-5 sterile empty culture dishes; take out the seedlings differentiated from the differentiation culture medium, select only 1 strong seedling from each callus tissue, cut off the excess leaves and excessively long roots with scissors, and inoculate them into rooting test tubes at a density of 1-2 seedlings per tube; then place the rooting test tubes in a light culture room with a light intensity of 3000 Lux for 15-20 days. After the seedling roots have grown sufficiently, harden the seedlings for 4-7 days, and then transplant them to the greenhouse.

[0044] Example 4: Salt tolerance assessment of transgenic materials

[0045] The transgenic material obtained in Example 3 was cultured to the homozygous T1 generation. Three lines were selected: a homozygous T1 generation overexpression line, a CRISPR / Cas9 gene-edited line, and a wild-type line. The three lines were identified by 200 mM NaCl salt stress. After 72 h of treatment, the differences in growth phenotypes among the three lines were observed.

[0046] The contents of Pro, MDA, and H2O2 were detected using a Pro, MDA, and H2O2 content detection kit.

[0047] The results showed that after 72 h of salt stress treatment, the OsCRK17 overexpressing lines exhibited stronger salt tolerance, and the wilting, curling, and yellowing of leaves were significantly higher in both the gene-edited lines and wild-type rice. This indicates that overexpression of the rice receptor kinase OsCRK17 gene can significantly improve the salt tolerance of rice.

[0048] The culture media, antibiotic and hormone formulations and their preparation involved in the embodiments of the present invention are as follows:

[0049] 1. MSmax stock solution (10X)

[0050] NH4NO3 16.5 g;

[0051] KH2PO4 1.7 g;

[0052] KNO3 19.0 g;

[0053] MgSO4·7H2O 3.7 g;

[0054] 3.32 g of CaCl2;

[0055] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.

[0056] 2. MSmin stock solution (100X)

[0057] MnSO4·4H2O 2.23 g;

[0058] ZnSO4·7H2O 0.86 g;

[0059] KI 0.083 g;

[0060] H3BO3 0.62 g;

[0061] Na2MoO4·2H2O 0.025 g;

[0062] CoCl2·6H2O 0.0025 g;

[0063] CuSO4·5H2O 0.0025 g;

[0064] Note: Na2MoO4 must be dissolved separately before mixing with other components, and then diluted with distilled water to a final volume of 1000 mL. Store at room temperature.

[0065] 3. N6max stock solution (10X)

[0066] KNO3 28.3 g;

[0067] (NH4)2SO4 4.63 g;

[0068] KH2PO4 4.0 g;

[0069] MgSO4·7H2O 1.85 g;

[0070] CaCl2 1.25 g;

[0071] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.

[0072] 4. N6min stock solution (100X)

[0073] KI 0.08 g;

[0074] H3BO3 0.16 g;

[0075] ZnSO4·7H2O 0.15 g;

[0076] MnSO4·4H2O 0.44 g;

[0077] Dilute to 1000 mL with distilled water and store at room temperature.

[0078] 5. Fe 2+ -EDTA stock solution (100X)

[0079] Add 300 mL of distilled water and 2.78 g of FeSO4·7H2O to a reagent bottle;

[0080] Add 300 mL of distilled water to another reagent bottle and heat to 70 °C. Then add 3.73 g of Na2EDTA·2H2O. After dissolving, mix the solutions from the two reagent bottles and keep warm at 70 °C for 2 hours. Then add distilled water to make up to 1000 mL and store at 4 °C protected from light.

[0081] 6. Vitamin stock solution (100X)

[0082] Nicotinic acid 0.1 g;

[0083] Thiamine HCl (VB1) 0.1 g;

[0084] Pyridoxine HCl (VB6) 0.1 g;

[0085] Inositol 10 g;

[0086] Glycine 0.2 g;

[0087] Add distilled water to a final volume of 1000 mL and store at 4°C.

[0088] 7. AAmax stock solution (10X)

[0089] KCl 29.50 g;

[0090] MgSO4·7H2O 2.50 g;

[0091] NaH2PO4 1.50 g;

[0092] CaCl2·2H2O 1.50 g;

[0093] Add distilled water to a final volume of 1000 mL and store at room temperature away from light.

[0094] 8. AAmin stock solution (100X)

[0095] MnSO4·H2O 1.0 g;

[0096] ZnSO4·7H2O 0.2 g;

[0097] CuSO4·5H2O 0.0025 g;

[0098] H3BO3 0.3 g;

[0099] KI 0.075 g;

[0100] CoCl2·6H2O 0.0025 g;

[0101] NaMoO4·2H2O 0.025 g;

[0102] Dissolve Na2MoO4 separately, then mix it with other components and add distilled water to bring the volume to 1000 mL. Store at room temperature away from light.

[0103] 9. 6-BA stock solution (1 mg / mL)

[0104] Add 100 mg of 6-BA to 1.0 mL of 1M KOH and shake until 6-BA is dissolved. Then add distilled water to bring the volume to 100 mL and store at room temperature.

[0105] 10. KT stock solution (1 mg / mL)

[0106] Add 100 mg of KT to 1.0 ml of 1M KOH and shake until KT dissolves. Then add distilled water to bring the volume to 100 mL and store at room temperature.

[0107] 11. 2,4-D stock solution (1 mg / mL)

[0108] Add 100 mg of 2,4-D to 1.0 ml of 1M KOH and shake for 5 min. Then add 10 mL of distilled water and shake until 2,4-D is dissolved. Make up to 100 mL with distilled water and store at room temperature.

[0109] 12.100 μM AS stock solution

[0110] AS 0.196 g;

[0111] 10 mL of DMSO;

[0112] Aliquot into 1.5 mL centrifuge tubes and store at 4°C.

[0113] 13. IAA stock solution (1 mg / mL)

[0114] Add 100 mg of IAA to 1.0 ml of 1N KOH and shake until the IAA dissolves. Then, bring the volume up to 100 ml with dH2O and store at room temperature away from light.

[0115] 14. NAA stock solution (1 mg / mL)

[0116] Add 100 mg of NAA to 1.0 mL of 1M KOH and shake until NAA dissolves. Then, bring the volume to 100 mL with distilled water and store at room temperature away from light.

[0117] Culture medium formulation:

[0118] 1. Induction medium

[0119] N6max stock solution (10X) 100 mL;

[0120] N6min stock solution (100X) 10 mL;

[0121] Vitamin (100X) 10 mL;

[0122] Fe 2+ -EDTA stock solution (100X) 10 mL;

[0123] 2,4-D stock solution (1 mg / mL) 2.5 mL;

[0124] Casein hydrolase 0.6 g;

[0125] Proline 0.3 g;

[0126] Sucrose 30 g;

[0127] Phytagel 3g

[0128] pH value: 5.9, add distilled water to a final volume of 1000 mL.

[0129] 2. Subculture medium

[0130] N6max stock solution (10X) 100 mL;

[0131] N6min stock solution (100X) 10 mL;

[0132] Vitamin (100X) 10 mL;

[0133] Fe 2+ -EDTA stock solution (100X) 10 mL;

[0134] 2,4-D stock solution (1 mg / mL) 2.0 mL;

[0135] 0.6 g of aged proteolytic enzyme;

[0136] Proline 0.5 g;

[0137] Sucrose 30 g;

[0138] Phytagel 3 g;

[0139] pH value: 5.9, add distilled water to a final volume of 1000 mL.

[0140] 3. Pre-culture medium

[0141] N6max stock solution (10X) 12.5 mL;

[0142] N6min stock solution (100X) 1.25 mL;

[0143] Vitamin (100X) 2.5 mL;

[0144] Fe 2+ -EDTA stock solution (100X) 2.5 mL;

[0145] 2,4-D stock solution (1 mg / mL) 0.75 mL;

[0146] Casein hydrolase 0.15 g;

[0147] Sucrose 5 g;

[0148] Phytagel 1.75 g

[0149] pH value: 5.6, add distilled water to a final volume of 250 mL.

[0150] 4. Co-culture medium

[0151] N6max stock solution (10X) 12.5 mL;

[0152] N6min stock solution (100X) 1.25 mL;

[0153] Vitamin (100X) 2.5 mL;

[0154] Fe 2+-EDTA stock solution (100X) 2.5 mL;

[0155] 2,4-D stock solution (1 mg / mL) 0.75 mL;

[0156] Casein hydrolase 0.2 g;

[0157] Sucrose 5 g;

[0158] Agarose 1.75 g;

[0159] pH value: 5.6, add distilled water to a final volume of 250 mL.

[0160] 5. Suspension culture medium

[0161] N6max stock solution (10X) 5 mL;

[0162] N6min stock solution (100X) 0.5 mL;

[0163] Vitamin (100X) 1 mL;

[0164] Fe 2+ -EDTA stock solution (100X) 0.5 mL;

[0165] 2,4-D stock solution (1 mg / mL) 0.2 mL

[0166] Casein hydrolase 0.08 g

[0167] Sucrose 2 g;

[0168] pH value: 5.4, add distilled water to a final volume of 100 mL.

[0169] 6. Screening culture medium

[0170] N6max stock solution (10X) 25 mL;

[0171] N6min stock solution (100X) 2.5 mL;

[0172] Vitamin (100X) 2.5 mL;

[0173] Fe 2+ -EDTA stock solution (100X) 2.5 mL;

[0174] 2,4-D stock solution (1 mg / mL) 0.625 mL;

[0175] Casein hydrolase 0.15 g;

[0176] Sucrose 7.5 g;

[0177] Phytagel 1.75 g;

[0178] pH value: 6.0, add distilled water to a final volume of 250 mL.

[0179] 7. Differentiation medium

[0180] MSmax stock solution (10X) 100 mL;

[0181] MSmin stock solution (100X) 10 mL;

[0182] Vitamin (100X) 10mL

[0183] Fe 2+ -EDTA stock solution (100X) 10 mL;

[0184] 6-BA 2.0 mL;

[0185] KT 2.0 mL;

[0186] IAA 0.2 mL;

[0187] 0.2 mL of NAA;

[0188] Sucrose 30 g;

[0189] 1 g of casein hydrolase;

[0190] Phytagel 3 g;

[0191] pH value: 6.0, add distilled water to a final volume of 1000 mL.

[0192] 8. Rooting medium

[0193] MSmax stock solution (10X) 50 mL;

[0194] MSmin stock solution (100X) 5 mL;

[0195] Vitamin (100X) 10 mL;

[0196] Fe 2+ -EDTA stock solution (100X) 10 mL;

[0197] Sucrose 20 g;

[0198] Phytagel 3 g;

[0199] pH value: 5.8, add distilled water to a final volume of 1000 mL.

[0200] Antibiotic formulation:

[0201] 1. Kanamycin (Kan, 50 mg / ml): Weigh 0.5 g of kanamycin powder, add 10 ml of deionized water to dissolve it completely, filter it, and dispense it into sterile EP tubes. Store at -20 ℃.

[0202] 2. Ampicillin (Amp, 50 mg / ml): Weigh 0.5 g of ampicillin powder, add 10 ml of deionized water to dissolve it completely, filter to sterilize, dispense into individual vials, and store at -20 ℃.

[0203] 3. TMT (200 mg / l): Under aseptic conditions, inject 4 ml of sterile deionized water into 1.6 g of unopened bottled TMT powder using a syringe. After mixing thoroughly, remove the powder, add another 4 ml of sterile deionized water, mix thoroughly, and dispense directly into sterile EP tubes. Finally, store at -20 ℃.

[0204] 4. Rifampin (30 mg / ml): Weigh 0.5 g of rifampin powder, add 10 ml of DMSO to dissolve it completely, filter to sterilize, and dispense into sterile EP tubes. Store at -20 ℃.

[0205] 5. Spectinomycin (spec, 50 mg / ml): Weigh 0.5 g of kanamycin powder, dissolve it thoroughly in 10 ml of sterile deionized water, filter to sterilize, and then dispense into sterile EP tubes. Store at -20 ℃.

[0206] Hormone formulation:

[0207] 1. Acetyleugenone (As, 100 mM / mL): Weigh 0.196 g of acetyleugenone powder, add 10 mL of DMSO to dissolve it completely, filter to sterilize, dispense into sterile EP tubes, and finally store in a -20 ℃ refrigerator.

[0208] 2. Plant growth regulator (2,4-D, 1 mg / mL): Weigh 100 mg of 2,4-D, add 1 mL of 1N KOH and shake for 5 min. Then add 10 mL of sterile deionized water and shake until 2,4-D is fully dissolved. Finally, bring the volume to 100 mL with sterile deionized water and store at 4 ℃.

[0209] 3. Kinetin (KT, 1 mg / mL): Weigh 100 mg of KT dry powder, then add 1 mL of 1N KOH and shake until KT is completely dissolved. Then add ddH2O to make up to 100 mL and store at 4 ℃.

[0210] 4. Naphthaleneacetic acid (NAA, 1 mg / ml): Weigh 100 mg of NAA, add 1 mL of 1N KOH and shake until NAA is completely dissolved. Then add sterile deionized water to bring the volume to 100 mL and store in a refrigerator at 4 ℃ protected from light.

[0211] 5. Zeatin (ZT, 0.5 mg / mL): Under aseptic conditions, add 95% ethanol to each tube containing 5 mg of zeatin and dissolve completely. Then add sterile deionized water to bring the volume to 10 mL. Filter to remove bacteria and store at -20 °C.

[0212] 5. Indoleacetic acid (IAA, 1 mg / mL): Weigh 100 mg of IAA dry powder and dissolve it in 5 ml of anhydrous ethanol. Add sterile deionized water to bring the volume to 100 mL, then filter to sterilize and finally store in a -20 ℃ refrigerator.

Claims

1. The application of the receptor kinase OsCRK17 gene in regulating salt tolerance in rice, characterized by: The nucleotide sequence of the rice OsCRK17 gene is shown in SEQ ID NO:1.