A method for detecting and / or assessing milk quality traits in chinese holstein cows

CN122104937APending Publication Date: 2026-05-29GUANGDONG OCEAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGDONG OCEAN UNIVERSITY
Filing Date
2026-03-10
Publication Date
2026-05-29

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application relates to a method for detecting and / or evaluating milk quality traits of Chinese Holstein cows, and the present application takes IFI47 as a research object, detects genetic variations in a Chinese Holstein cow population, finds that the IFI47 gene exists a SNPs, namely g.40461076 C>G, and exists three genotypes of GG, CG and CC, wherein the dry matter content of the individual with the GG genotype is significantly lower than that of the individuals with the CG and CC genotypes. A solid foundation is laid for subsequent breeding of high-quality cow new strains based on the gene marker assisted selection technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of molecular breeding technology for livestock, and in particular to a method for detecting and / or evaluating milk quality traits in Chinese Holstein dairy cows. Background Technology

[0002] Chinese Holstein cows are a core breed developed through long-term crossbreeding and selection in my country's dairy industry. Their superior milk production performance has laid a solid foundation for the development of my country's dairy industry. Currently, the focus of my country's dairy industry development has shifted from quantity expansion to quality improvement, with milk quality becoming a key indicator for measuring the industry's modernization level and market competitiveness. Milk quality directly determines the nutritional and economic value of dairy products. Dry matter content in milk is a key comprehensive indicator for evaluating the total solids level of milk, and its level directly determines the processing yield and nutritional value of various dairy products such as cheese and butter. Higher dry matter content indicates a richer concentration of nutrients such as fat, protein, lactose, and minerals in the milk, thus improving the quality grade, processing suitability, and commercial value of the raw milk, leading to higher economic benefits and industry returns. Dry matter content in milk is one of the important milk quality traits.

[0003] In dairy cow breeding practices, traditional methods rely on phenotypic selection and pedigree recording, which have limitations such as long cycles, high costs, and susceptibility to environmental interference, making it difficult to efficiently breed superior individuals that combine high yield, high quality, and disease resistance. With the development of molecular biology techniques, molecular breeding has provided a new pathway for the genetic improvement of dairy cows. By locating gene markers associated with target traits, early and accurate selection can be achieved, significantly shortening the generation interval in breeding, improving the efficiency of genetic progress, and enhancing the quality of dairy milk.

[0004] Interferon gamma-inducible protein 47 (IFI47) is an important immune-related gene located on chromosome 7 of the bovine genome. The protein encoded by this gene belongs to the interferon-stimulated gene family and plays a crucial role in the body's immune response. Currently, functional studies of the IFI47 gene are primarily focused on human medicine and mouse models, particularly in the areas of infection, tumors, and autoimmune diseases. It is highly expressed in various immune-related tissues, and its expression level is closely related to disease progression, prognosis, and immune status. However, studies on the correlation between the IFI47 gene and milk quality traits in dairy cows have not yet been reported. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for detecting and / or evaluating the milk quality traits of Chinese Holstein cows.

[0006] The first objective of this invention is to provide the application of a reagent for detecting the SNP site g.40461076 C>G in the preparation of a kit for detecting and / or evaluating milk quality traits in Chinese Holstein cows.

[0007] A second objective of this invention is to provide an application for detecting and / or evaluating milk quality traits in Chinese Holstein dairy cows and / or for molecular breeding of milk quality traits in Chinese Holstein dairy cows.

[0008] A third objective of this invention is to provide a kit for detecting and / or evaluating milk quality traits in Chinese Holstein cows.

[0009] A fourth objective of this invention is to provide the application of the aforementioned kit in molecular breeding of milk quality traits in Chinese Holstein dairy cows.

[0010] The fifth objective of this invention is to provide a method for detecting and / or evaluating milk quality traits of Chinese Holstein cows.

[0011] The sixth objective of this invention is to provide the application of the method in molecular breeding of milk quality traits in Chinese Holstein dairy cows.

[0012] To achieve the above objectives, the present invention is implemented through the following technical solution: This invention claims protection for the use of reagents for detecting the SNP locus g.40461076 C>G in the preparation of kits for detecting and / or evaluating milk quality traits in Chinese Holstein dairy cows. The key feature is that g.40461076 C>G is located at NC_037334.1:40461076, which is the 40461076th position on chromosome 7 of the bovine genome in ARS-UCD2.0. Individuals with the GG genotype exhibit significantly lower dry matter content in their milk quality traits compared to individuals with the CG or CC genotypes.

[0013] Furthermore, the application of detecting and / or evaluating milk quality traits in Chinese Holstein dairy cows and / or in molecular breeding of milk quality traits in Chinese Holstein dairy cows is characterized by the fact that g.40461076 C>G is located at NC_037334.1:40461076, which is the 40461076th position on chromosome 7 of the bovine genome in ARS-UCD2.0, and the dry matter content of the milk quality traits in individuals with the GG genotype is significantly lower than that in individuals with the CG or CC genotypes.

[0014] Preferably, the reagent is a primer with a nucleotide sequence as shown in SEQ ID NO:1-2.

[0015] The present invention also claims a kit for detecting and / or evaluating milk quality traits of Chinese Holstein cows, containing said reagent.

[0016] Preferably, the reagent is a primer with a nucleotide sequence as shown in SEQ ID NO: 1-2.

[0017] And the application of the kit in molecular breeding of milk quality traits in Chinese Holstein dairy cows.

[0018] This invention also claims a method for detecting and / or evaluating milk quality traits in Chinese Holstein dairy cows, specifically detecting the SNP sites described in the invention.

[0019] Preferably, primers with nucleotide sequences as shown in SEQ ID NO:1-2 are used to detect the SNP sites described in claim 1 or 2 of Chinese Holstein dairy cows.

[0020] And the application of the method in molecular breeding of milk quality traits in Chinese Holstein dairy cows.

[0021] Preferably, g.40461076 C>G is located at NC_037334.1:40461076, which is the 40461076th position on chromosome 7 of the bovine genome in ARS-UCD2.0. Individuals with the GG genotype have significantly lower dry matter content in milk quality traits than individuals with the CG or CC genotypes.

[0022] Compared with the prior art, the present invention has the following beneficial effects: This invention uses IFI47 as the research object, and detects its genetic variation in a Chinese Holstein dairy cattle population. It analyzes the association between different genotypes and milk quality traits (such as milk protein content, milk fat content, and somatic cell count). The study found that the IFI47 gene contains one SNP, g.40461076 C>G, and has three genotypes: GG, CG, and CC. Among these, individuals with the GG genotype had significantly lower dry matter content than those with the CG and CC genotypes. This provides a theoretical basis and technical support for future molecular breeding of dairy cattle using genetic markers and for developing high-quality new breeds. Attached Figure Description

[0023] Figure 1 Sequencing results of IFI47 gene pooled amplification products from Chinese Holstein dairy cows; M represents DL-2 000 Marker; 1 and 2 are blood DNA pooled samples.

[0024] Figure 2 Sequencing results of the IFI47 gene pool amplification product from Chinese Holstein dairy cows.

[0025] Figure 3 The results are PCR amplification of the IFI47 gene from a single sample of Chinese Holstein dairy cows; M is the DL-2 000 Marker; 1-5 are blood DNA samples from some individuals.

[0026] Figure 4 Sequencing profiles of the IFI47 gene g.40461076 C>G genotypes; individuals with genotypes I to III being GG, CG, and CC, respectively. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0028] Example 1 I. Experimental Methods 1. Sample collection DNA was extracted from blood samples of 86 Chinese Holstein dairy cows at the same lactation stage under the same environment and then stored in a -80 ℃ freezer.

[0029] The DNA extraction method was as follows: blood samples were collected, and DNA was extracted from Chinese Holstein dairy cows using a blood genomic DNA extraction kit, following the product instructions. The purity and concentration of the DNA were determined using a microphotometer, and the DNA quality was assessed using agarose gel electrophoresis.

[0030] 2. Primer design According to Ensembl's post about cows IFI47 Gene sequence (ENSBTAE00000170894) was used for primer design. The forward primer was 5′-GCAGGCAGATTCTTCACA-3′ (SEQ ID NO.1); the reverse primer was 3′-CAGTCGGCTCAGATACAAT-5′ (SEQ ID NO.2). The primers were synthesized by Genewiz (Guangzhou) Biotechnology Co., Ltd.

[0031] 3. PCR amplification and sequencing Using a pool of blood DNA from 86 Chinese Holstein dairy cows as a template, PCR amplification was performed under the following conditions: 2.0 µL DNA template, 0.5 µL each of forward and reverse primers, 10 µL Green Taq Mix, and 7.0 µL ddH2O. The PCR amplification program was set as follows: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 30 s, followed by annealing at 58℃ for 30 s and extension at 72℃ for 1 min; 35 cycles were run, with a final extension at 72℃ for 5 min. After confirming the target bands by 1.5% agarose gel electrophoresis, the PCR products were sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing.

[0032] II. Experimental Results Using pooled DNA as a template, PCR amplification was performed using designed primers, such as... Figure 1As shown, the PCR amplification product of the IFI47 gene from Chinese Holstein dairy cows, after detection by 1.5% agarose gel electrophoresis, has a length of 969 bp.The amplified sequence of the PCR product, SEQ ID NO:3, is as follows: GCAGGCAGATTCTTCACAACTGAGCCACCTATAAATCCATATATGTGTAACTGGATCACTTTGTTGTACACCAGAAACTAACACAATGCTATAAATCAACTATACTTCAATAAAATAAGTCATCAGAGAAAATAAATTAACTGTAGAGACATGAGTCTGCATGAGGGATGGGACTGGTCGGTTAAGACCAGTGTATTTTCTCAGCTGACTTTGTGTCTGTTCTGTTGCTTCATTCACCTTATCTCCTAATTCTCTCTTCTTTTCCACAGATTATTCAGTTAACTGGCATGGATCCACTCCTCTTAAACGTCATTAAAAAAAATGATTCTAAGCAACTAGCCTCAGAGTTTCTGTCTGGCTACAAAACATTAGTCAGTGAAGTGGGGGGGATCCTCTCTCAGGTAAGCCTTAAACGTATTCTAAAAGGCTTTGAGAAGGGGCAACCGAAAGACGTGGCTGATGAGATTCAGAGAGCACTTCAGAGCGCCGAGAATGCTCGCCAGAATGTGGCTGTGATTGGGCAATCTGGTTCTGGCAAGTCCAGTTTCATCAATGTCTTGCGAGGAATTGGTCATGAAGGGGCTGGATCTGCTTCTGTTGGAGTTGTGCCAACCACCAGAAAGAAAACTCCCTATCCACATCCAAAGTATCCCAACGTGACCTTCTGGGACCTGCCTGGAACGGGGACCCCAGAATCCCTTCCAAACCCTTATCAAGAAGTAGTGGGAGATGATAACTATGACTATTTCATCATTATTTCGTCCTCACGGTTTAGCTCAAACGATGCTTTCCTGGCCCAGAAGATTCAGGAGAAGGGAAAAAAATTCTACTTTGTTAGAACCAAGGTGGATAGTGATTTATATAATGAAAGTAAAAGCAAACCCAGATCTTTCAATAAGGAGACAGTCCTTCAGCAGATCCGAGACAACTGTCTGATCAATCTCAGCAAAATTGTATCTGAGCCGACTG。,

[0033] This indicates that the primers exhibit good specificity, with uniform and clear electrophoretic bands, and no dimers, tails, or non-specific amplification bands were observed, making them suitable for subsequent sequencing experiments.

[0034] The results of the mixed-pool genotype peak diagram are shown below. Figure 2 The results showed that one SNP mutation site was found in the gene: g.40461076C>G (located at NC_037334.1:40461076, i.e., position 40461076 on chromosome 7 of the bovine genome in ARS-UCD2.0).

[0035] Example 2: Chinese Holstein dairy cows IFI47 Population genetic characteristics analysis of gene loci I. Experimental Methods DNA extracted from blood samples of 86 Chinese Holstein dairy cows in Example 1 was used as a template, and PCR amplification and sequencing were performed according to the method in Example 1. The genotype of each individual in the sequencing results was statistically recorded using SeqMan software. Gene frequency, genotype frequency, heterozygosity (H), effective allele count (NE), and polymorphism information content (PIC) were calculated using Popgene software, and the χ² value was calculated. 2 )value.

[0036] II. Experimental Results See results Figure 3 and Figure 4 Some individuals produced PCR amplification products of 969 bp in size, with uniform electrophoretic bands and no primer dimers, smears, or non-specific amplification bands, meeting the requirements for subsequent experiments.

[0037] The results of population genetic polymorphism analysis are shown in Table 1 below. The g.40461076 C>G locus has three genotypes: CC, CG, and GG. The genotype frequencies of CC, CG, and GG are 0.3372, 0.5930, and 0.0698, respectively. The frequencies of C and G are 0.6637 and 0.3663, respectively, indicating that allele C is the dominant gene in the population. The gene polymorphism information content (PIC) of this locus is between 0.25 and 0.5, indicating moderate polymorphism. Chi-square test (χ² test) analysis showed that the χ² value of the g.40461076 C>G locus of the IFI47 gene in Chinese Holstein dairy cattle is not within the range of χ² < χ² 0.05 (df=2), P > 0.05, indicating that this SNP locus does not conform to Hardy-Weinberg equilibrium in the Chinese Holstein dairy cattle population.

[0038] Table 1. Population genetic effects of SNPs in the IFI47 gene in Chinese Holstein dairy cattle.

[0039] Note: χ 2 0.05(df=2)=5.99 Example 3: Association Analysis of IFI47 Gene SNPs with Milk Quality Traits in Chinese Holstein Cows I. Experimental Methods The milk quality traits of 86 Chinese Holstein dairy cows in Example 1 were tested using the following specific methods: Milk quality characteristics, including milk fat percentage (%), milk protein percentage (%), lactose content (%), urea nitrogen content (mg / L), and dry matter content (%), were detected using a milk composition analyzer.

[0040] Individual milk production, i.e., the milk production of each dairy cow at each lactation stage, is the basis for milk production statistics. Individual milk production and corrected milk production are often expressed as milk production over 305 days and milk production over 305 days, respectively.

[0041] Milk production in 305 days: Milk production from the first day after calving to the 305th day.

[0042] Corrected milk production over 305 days: For lactation periods that do not reach 305 days, or exceed 305 days but have no daily milk production records, the actual milk production of these records is multiplied by a relative coefficient to correct to an approximate production over 305 days.

[0043] The g.40461076 C>G site obtained in Example 1 was analyzed using the one-way ANOVA function of SPSS 27.0 software through multiple comparisons to test the significance of differences.

[0044] II. Experimental Results The association analysis results between different genotypes at this locus and seven important indicators, including milk quality traits, of Chinese Holstein dairy cows are detailed in Table 2 below.

[0045] Table 2. Association analysis of SNPs of the IFI47 gene and milk quality traits in Chinese Holstein dairy cows.

[0046] A p-value less than 0.05 indicates a significant difference. Results are presented as mean ± standard error.

[0047] The results showed that different genotypes at the g.40461076 C>G locus were significantly correlated with the dry matter content of Chinese Holstein dairy cows (P<0.05), with individuals of the GG genotype having significantly lower dry matter content than those of the CG and CC genotypes. However, no significant differences were found between this locus and milk yield, milk protein, milk fat, lactose, urea nitrogen content, and corrected milk yield (P>0.05).

[0048] Example 4: A method for detecting and / or evaluating milk quality traits in Chinese Holstein cows I. Extracting DNA from Chinese Holstein dairy cows to be tested.

[0049] II. PCR amplification and sequencing.

[0050] PCR amplification system (total volume 20 μL): DNA template 2.0 µL, forward and reverse primers (SEQ ID NO: 1 to 2) 0.5 µL each, Green Taq Mix 10 µL, ddH2O 7.0 µL.

[0051] PCR amplification program: 95℃ pre-denaturation for 30s; 95℃ denaturation for 30s, followed by annealing at 58℃ for 30s, and extension at 72℃ for 1min; run for 37 cycles, and then extend at 72℃ for 5min.

[0052] After the PCR amplification products were detected by 1.5% agarose gel electrophoresis and the target band was confirmed to be correct, sequencing was performed.

[0053] III. Result Interpretation The sequencing results were compared with the ARS-UCD2.0 version of the bovine genome to determine the genotype of the g.40461076 C>G site.

[0054] g.40461076 C>G is located at NC_037334.1:40461076, which is the 40461076th position on chromosome 7 of the bovine genome in ARS-UCD2.0. The dry matter content of milk quality traits in dairy cows with the GG genotype is significantly lower than that of individuals with the CG and CC genotypes.

[0055] Example 5: A kit for detecting and / or evaluating milk quality traits in Chinese Holstein cows 1. Composition Forward and reverse primers (SEQ ID NO: 1 to 2). Green Taq Mix 10 µL and ddH2O 7.0 µL.

[0056] 2. Instructions for use Same as Example 4.

Claims

1. The application of a reagent for detecting the SNP site g.40461076 C>G in the preparation of a kit for detecting and / or evaluating milk quality traits in Chinese Holstein dairy cows, characterized in that... g.40461076 C>G is located at NC_037334.1:40461076, which is the 40461076th position on chromosome 7 of the bovine genome in ARS-UCD2.

0. Individuals with the GG genotype have significantly lower dry matter content in milk quality traits than individuals with the CG or CC genotypes.

2. The application of detecting and / or evaluating milk quality traits in Chinese Holstein dairy cows and / or in molecular breeding of milk quality traits in Chinese Holstein dairy cows, characterized in that, g.40461076 C>G is located at NC_037334.1:40461076, which is the 40461076th position on chromosome 7 of the bovine genome in ARS-UCD2.

0. Individuals with the GG genotype have significantly lower dry matter content in milk quality traits than individuals with the CG or CC genotypes.

3. The application according to claim 1 or 2, characterized in that, The reagent is a primer with a nucleotide sequence as shown in SEQ ID NO: 1-2.

4. A kit for detecting and / or evaluating milk quality traits of Chinese Holstein cows, characterized in that, Contains the reagent described in claim 1 or 2.

5. The reagent kit according to claim 4, characterized in that, The reagent is a primer with a nucleotide sequence as shown in SEQ ID NO: 1-2.

6. The application of the kit according to claim 4 or 5 in molecular breeding of milk quality traits in Chinese Holstein dairy cows.

7. A method for detecting and / or evaluating milk quality traits of Chinese Holstein dairy cows, characterized in that, Detection of the SNP sites described in claim 1 or 2 in Chinese Holstein dairy cows.

8. The method according to claim 4, characterized in that, The SNP sites described in claim 1 or 2 of Chinese Holstein dairy cows were detected using primers with nucleotide sequences as shown in SEQ ID NO: 1-2.

9. The application of the method according to claim 7 or 8 in molecular breeding of milk quality traits in Chinese Holstein dairy cows.

10. The application according to claim 6 or 9, characterized in that, g.40461076 C>G is located at NC_037334.1:40461076, which is the 40461076th position on chromosome 7 of the bovine genome in ARS-UCD2.

0. Individuals with the GG genotype have significantly lower dry matter content in milk quality traits than individuals with the CG or CC genotypes.