A method for the production of an engineered DEAR nucleic acid manipulation system
Patent Information
- Application Number
- CN202480064645.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-10-17
- Filing Date
- 2024-01-30
- Publication Date
- 2026-05-29
AI Technical Summary
The CRISPR-Cas nuclease system has off-target effects, low transfection efficiency caused by excessive proteins, and potential immune response problems, which limits the widespread use of its gene editing.
The RNA ribozyme-based DEAR nucleic acid manipulation system has been engineered to improve its specificity and cleavage activity by extending substrate recognition zones, adding recruitment sequences, forming heterodimers, and inserting extended recognition zones.
It has achieved the improvement of the specificity and cleavage activity of the DEAR nucleic acid manipulation system, breaking through the limitations of its gene editing ability, and enhancing the recognition and cleavage efficiency of target nucleic acids.
Smart Images

Figure CN122122298A_ABST
Abstract
Description
A method for preparing an engineered DEAR nucleic acid manipulation system Priority and related applications The present invention claims priority to Chinese patent application 202311344851.3 filed on October 17, 2023, entitled “A method for preparing an engineered DEAR nucleic acid manipulation system”, and all the contents of the application including the appendix are incorporated herein by reference. Technical Field The invention belongs to the field of biotechnology, and in particular relates to a method for preparing an engineered DEAR nucleic acid manipulation system. Background Art At present, the gene editing technologies commonly used in my country are all developed based on RNA-guided CRISPR-Cas nucleases, whose core patents are owned by European and American countries. my country's gene editing technology lacks original innovation and core patents. However, the CRISPR-Cas system still has some problems: first, the CRISPR-Cas system has off-target effects, and editing of the Cas protein in non-target areas may cause uncontrollable harmful mutations; second, the CRISPR-Cas system has the problem of too large proteins. The protein size of the currently used CRISPR-Cas editing tool molecules SpyCas9 and AsCas12a both exceeds 1,300 amino acids. The excessive molecular weight affects the transfection efficiency of the CRISPR-Cas system tools; at the same time, the CRISPR-Cas system has potential immune responses. The SpyCas9 and AsCas12a proteins currently used are derived from pathogenic bacteria that humans have been exposed to, which may cause human immune responses. Therefore, the CRISPR-Cas nuclease system is limited by the limitations of its protein components. If a new generation of nucleic acid targeting manipulation technology based entirely on RNA can be developed that combines both gene sequence-specific targeting and catalytic activity, it is expected to overcome the limitations of the application of protease-based gene editing systems. The applicant has identified a number of RNA ribozyme-based DEAR nucleic acid manipulation systems with high cutting activity and editing efficiency in bacteria through biochemical means, but its structural basis is still unknown. Therefore, its atomic structure is urgently needed to provide a basis for subsequent transformation and application. In addition, the applicant has discovered that the RNA ribozyme-based DEAR nucleic acid manipulation system (Chinese patent application number: 202310424082.1) has RNA, DNA and plasmid cutting activity, and has gene editing activity in cells and bacteria. However, for the DEAR nucleic acid manipulation system, due to its short substrate recognition window, there are still certain limitations for gene editing. In order to break through this limitation, the present invention intends to improve its specificity and cutting activity by engineering the DEAR nucleic acid manipulation system. Summary of the invention Problem that the invention aims to solve Based on the various problems existing in the CRISPR-Cas nuclease system in the prior art, the applicant has developed a DEAR nucleic acid manipulation system based on RNA ribozymes and applied it to the targeted modification (e.g., cutting) of nucleic acids (DNA, RNA). The applicant of the present invention provides a method for preparing an engineered DEAR nucleic acid manipulation system to obtain a The original RNA ribozyme-based DEAR nucleic acid manipulation system and an engineered DEAR nucleic acid manipulation system with improved activity. Solutions for solving problems [1]. A method for preparing an engineered DEAR nucleic acid manipulation system, wherein the original DEAR nucleic acid manipulation system comprises an RNA molecule derived from a bacterial C-type second intron, wherein the RNA molecule comprises a substrate recognition region that hybridizes with a target sequence in a target nucleic acid, and the RNA molecule comprises at least one of domains I to VI; The preparation method comprises at least one selected from the following (a) to (d): (a) extending the substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system to a length of 7 to 14 nucleotides to obtain an extended substrate recognition region; (b) adding a recruitment sequence to the 3' end of the RNA molecule of the original DEAR nucleic acid manipulation system, and the recruitment sequence hybridizes with at least a portion of the target nucleic acid; (c) respectively setting a first dimerization motif and a second dimerization motif in the III domain of the first RNA molecule and the second RNA molecule from the original DEAR nucleic acid manipulation system, wherein the first dimerization motif and the second dimerization motif hybridize with each other, so that the first RNA molecule and the second RNA molecule form a heterodimer; (d) inserting an extended recognition region downstream of the 3′ end of the substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system, wherein the extended recognition region hybridizes with at least a portion of the target nucleic acid. [2] The preparation method according to [1], wherein in (a), the substrate recognition region in the RNA molecule is extended to an extended substrate recognition region having a length of 7 to 12 nucleotides; Preferably, the substrate recognition region in the RNA molecule is extended to an extended substrate recognition region having a length of 7 to 10 nucleotides. [3] The method according to [1] or [2], wherein in (b), the length of the recruitment sequence is 10 to 40 nucleotides; Preferably, the recruitment sequence is 14 to 26 nucleotides in length. [4] The method according to any one of [1] to [3], wherein in (b), the portion of the target nucleic acid that hybridizes to the recruitment sequence and the target sequence in the target nucleic acid that hybridizes to the substrate recognition region are located at different positions in the target nucleic acid; Preferably, the portion of the target nucleic acid that hybridizes to the recruitment sequence and the target sequence in the target nucleic acid that hybridizes to the substrate recognition region are separated by 10 to 60 nucleotides, preferably 20 to 50 nucleotides. [5]. The preparation method according to any one of [1] to [4], wherein in (b), it also includes deleting the VI domain of the RNA molecule of the original DEAR nucleic acid manipulation system. [6]. The method according to any one of [1] to [5], wherein in (c), the first dimerization motif and the second dimerization motif have the same length, and optionally, the first dimerization motif and the second dimerization motif have a length of 4 to 10 nucleotides, preferably 5 to 9 nucleotides, more preferably 6 nucleotides, and / or, The first substrate recognition region of the first RNA molecule and the second substrate recognition region of the second RNA molecule recognize the same portion of the target nucleic acid, or respectively recognize different portions of the target nucleic acid. [7]. The method according to any one of [1] to [6], wherein in (d), the extended recognition region is replaced by The substrate recognition region is replaced with any one of the 20th to 60th nucleotides, preferably any one of the 30th to 50th nucleotides, downstream of the 3' end of the substrate recognition region and inserted into the original DEAR nucleic acid manipulation system. [8]. The preparation method according to any one of [1] to [7], wherein in (d), the target sequence in the target nucleic acid that hybridizes with the substrate recognition region and the sequence in the target nucleic acid that hybridizes with the extended recognition region are continuous nucleotide sequences in the target nucleic acid. [9]. The method according to any one of [1] to [8], wherein in (d), the length of the extended recognition region is 1 to 24 nt, preferably 1 to 14 nt.
[0010] . The preparation method according to any one of [1] to [9], wherein the engineered DEAR nucleic acid manipulation system has improved specificity and / or cleavage activity compared to the original DEAR nucleic acid manipulation system.
[0011] . The preparation method according to any one of [1] to
[0010] , wherein the original DEAR nucleic acid manipulation system comprises at least domain I, domain II, domain III and domain V; Optionally, the length of the original DEAR nucleic acid manipulation system ranges from 100-5660 nt, preferably 124-3897 nt. Optionally, the I domain comprises 2-6 stem-loop / hairpin structures, with a length ranging from 50-400 nt; preferably, the I domain comprises 3-5 stem-loop / hairpin structures, with a length ranging from 65-384 nt; and / or, The II domain comprises 1-4 stem-loop / hairpin structures, with a length ranging from 10-300 nt; preferably, the II domain comprises 1-3 stem-loop / hairpin structures, with a length ranging from 10-218 nt; and / or, The III domain comprises 1-3 stem-loop / hairpin structures, with a length ranging from 10-200 nt; preferably, the III domain comprises 1-2 stem-loop / hairpin structures, with a length ranging from 10-140 nt; and / or, The IV domain comprises 0-4 stem-loop / hairpin structures, with a length ranging from 0-4500 nt; preferably, the IV domain comprises 0-4 stem-loop / hairpin structures, with a length ranging from 0-3000 nt; and / or, The V domain comprises one stem-loop / hairpin structure with a length ranging from 20 to 60 nt, preferably, the V domain comprises one stem-loop / hairpin structure with a length ranging from 29 to 43 nt; and / or, The VI domain comprises one stem-loop / hairpin structure with a length ranging from 10 to 200 nt. Preferably, the VI domain comprises one stem-loop / hairpin structure with a length ranging from 10 to 112 nt.
[0012] . The preparation method according to any one of [1] to
[0011] , wherein the C-type second class intron is a C-type second class intron in which an open reading frame encoding an intron-encoded protein is present or absent in the IV domain; optionally, the length of the open reading frame encoding the intron-encoded protein is 0-4000 nt; and / or, The substrate recognition region is located in the I domain.
[0013] . The preparation method according to any one of [1] to
[0012] , wherein the nucleotide sequence of the RNA molecule of the original DEAR nucleic acid manipulation system is selected from any one of the following: (i) comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 1 to 9 and 132; (ii) a nucleotide sequence comprising the reverse complementary sequence of the sequence shown in any one of SEQ ID NOs: 1 to 9 and 132; (iii) a reverse complementary sequence of a sequence that can hybridize to the nucleotide sequence shown in (i) or (ii) under high stringency hybridization conditions or very high stringency hybridization conditions; (iv) a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, and most preferably at least 99% sequence identity with the nucleotide sequence shown in (i) or (ii).
[0014] . The preparation method according to any one of [1] to
[0013] , wherein the substrate recognition region of the RNA molecule of the original DEAR nucleic acid manipulation system has a length of 6 nucleotides; Preferably, the substrate recognition region is programmable to hybridize to different target sequences.
[0015] . The preparation method according to any one of [1] to
[0014] , wherein the target nucleic acid is DNA or RNA.
[0016] . The preparation method according to any one of [1] to
[0015] , wherein the primary cleavage site of the original DEAR nucleic acid manipulation system is 0-1 nucleotides downstream of the 3' end of the target sequence in the target nucleic acid.
[0017] .An engineered DEAR nucleic acid manipulation system, which is prepared by the preparation method described in any one of [1] to
[0016] .
[0018] . An isolated polynucleotide, wherein the polynucleotide comprises a nucleotide sequence encoding the engineered DEAR nucleic acid manipulation system as described in
[0017] .
[0019] .A nucleic acid construct, wherein the nucleic acid construct comprises the isolated polynucleotide as described in
[0018] .
[0020] . A vector, wherein the vector comprises the isolated polynucleotide as described in
[0018] , or the nucleic acid construct as described in
[0019] .
[0021] . A cell, wherein the cell comprises the engineered DEAR nucleic acid manipulation system as described in
[0017] , the isolated polynucleotide as described in
[0018] , the nucleic acid construct as described in
[0019] or the vector as described in
[0020] .
[0022] . A reagent or kit, wherein the reagent or kit comprises the engineered DEAR nucleic acid manipulation system as described in
[0017] , the isolated polynucleotide as described in
[0018] , the nucleic acid construct as described in
[0019] , the vector as described in
[0020] or the cell as described in
[0021] .
[0023] .A pharmaceutical composition, wherein the pharmaceutical composition comprises the engineered DEAR nucleic acid manipulation system as described in
[0017] , the isolated polynucleotide as described in
[0018] , the nucleic acid construct as described in
[0019] , the vector as described in
[0020] or the cell as described in
[0021] ; and, optionally, a pharmaceutically acceptable carrier.
[0024] .A method for modifying a target nucleic acid, the method comprising the step of contacting the target nucleic acid with a DEAR nucleic acid manipulation system as described in
[0017] , an isolated polynucleotide as described in
[0018] , a nucleic acid construct as described in
[0019] , a vector as described in
[0020] , a cell as described in
[0021] , or a reagent or kit as described in
[0022] .
[0025] . Use of the DEAR nucleic acid manipulation system as described in
[0017] , the isolated polynucleotide as described in
[0018] , the nucleic acid construct as described in
[0019] , the vector as described in
[0020] , and the cell as described in
[0021] in modifying target nucleic acids or preparing reagents or kits for modifying target nucleic acids. Effects of the Invention The applicant has found that the DEAR nucleic acid manipulation system based on RNA ribozymes can achieve DNA and RNA cleavage, and also has DNA cleavage ability in Escherichia coli and mammalian eukaryotic cells. Based on this, the applicant has further improved its specificity and cleavage activity through engineering modification, and provided a method for preparing the engineered DEAR nucleic acid manipulation system. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1A to Figure 1J: Secondary structure display of DEAR1 to 10. Figure 1A to Figure 1J show the secondary structure prediction results of DEAR1-10, respectively. The prediction was performed using RNA fold, and domains I-VI and TRS are marked in the figure. Figure 1K to Figure 1M: Primary sequence and secondary structure characteristics of C-type group II introns. The C-type group II intron RNA in the database (http: / / webapps2.ucalgary.ca / ~groupii / ) was modeled using LocARNA software. Domains I-VI are marked in the figure, corresponding to the primary sequence and secondary structure characteristics of domain I of the C-type group II intron, three primary sequence and secondary structure characteristics of domains II-III (models 1 to 3), and the primary sequence and secondary structure characteristics of domains V-VI. FIG. 2A : Quality identification of RNA ribozyme molecules DEAR1 to 9. FIG. 2B : Quality identification of the RNA ribozyme molecule DEAR10. Figure 3: Verification of RNA cleavage activity of RNA ribozyme molecules DEAR1~9. Figure 4: Verification of the cleavage activity of RNA ribozyme molecules DEAR1 to 6 on unpaired RNA substrates. Figure 5: Verification of ssDNA cleavage activity of RNA ribozyme molecules DEAR1~6. Figure 6: Comparison of cleavage of paired and unpaired DNA substrates by RNA ribozyme molecules DEAR1-6. FIG. 7 : Verification of the ssDNA cleavage sites of the RNA ribozyme molecules DEAR1 to 6. Figure 8: Optimization results of reaction conditions for RNA ribozyme molecule DEAR1. Figure 9: Efficiency curve of reaction condition optimization of RNA ribozyme molecule DEAR1. FIG. 10 : Comparison of DNA cleavage activity of DEAR1 and RNA-guided protein nucleases. Figure 11: Verification of plasmid cleavage activity of RNA ribozyme molecule DEAR1. Figure 12: Verification of plasmid cleavage activity of RNA ribozyme molecules DEAR1-3 in Escherichia coli. FIG. 13 : Further verification of the plasmid cleavage activity of the RNA ribozyme molecule DEAR1 in Escherichia coli. Figure 14: Verification of the plasmid cleavage activity of RNA ribozyme molecules DEAR4-9 in bacteria. FIG. 15 : Verification of the ssDNA cleavage activity of RNA ribozyme molecules DEAR1 to 6 that reprogram the TRS region. FIG. 16 : Schematic diagram of the survival of cells stably transfected with DEAR1 stable transfection plasmid and DEAR-NT stable transfection plasmid in Example 7. FIG. 17A to 17B are schematic diagrams of analysis of sequencing results in Example 7. Figure 18: Schematic diagram of DEARs recognizing substrates, TRS: substrate recognition sequence (substrate recognition region). Target: substrate binding sequence or target sequence, the sequence of DEAR substrate recognized by DEAR (complementary pairing with TRS, i.e., target sequence of target nucleic acid). Figure 19: Schematic diagram of the DEARs structure. The first column is the name of DEARs, the second column is the secondary structure of DEARs, the third column is the cryo-EM 2D classification diagram of DEARs, and the fourth column is the cryo-EM structure of DEARs. The structural domains I, II, III, IV, V, and VI are marked as shown in the figure. Figure 20: Schematic diagram of the catalytic active center structure of DEARs, M1 and M2 are magnesium ions in the catalytic active center. The nucleotides closely related to the catalytic activity are marked: G1, U2, G3, C4, G5, A106, C107, A181, A182, G183, A184, C185, A186 from domain I, where the nucleotides at positions 1-5 are called the 5' end, and the range of 181-186 is also called the substrate recognition sequence, i.e. TRS; A337, G338, C339 from domain II, these three nucleotides are also called the intersection J2 / 3; G582, U583 from domain V, A584, C585, C565, C566, G567, C568, wherein positions 566-568 are also referred to as the catalytic triad and nucleotides 584 and 585 are also referred to as the 2-nucleotide bulge; U633 from domain VI. Figure 21: The results of in vitro and in vivo cleavage of TRS after elongation. A in Figure 21 is an abstract schematic diagram of the structure of DEAR1. The TRS region and dimerization motif are marked, and B in Figure 21 is a diagram of the cleavage activity after different TRS sequences are replaced. C in Figure 21 is a schematic diagram and cleavage efficiency diagram of TRS sequences of different lengths. D in Figure 21 is a diagram of the effect of plasmid cleavage in bacteria of TRS of different lengths. Figure 22: A in Figure 22 is a schematic diagram of two different modifications of DERAs relative to the original version, wherein V1 represents the version of DEAR6 without D6, and V2 represents the version without D6 and with the recruitment sequence added. B in Figure 22 is a schematic diagram of the atomic model after the modification, in which the recruitment sequence, recruitment sequence binding sequence, linker sequence, substrate recognition sequence, substrate binding sequence, and cleavage site are marked as shown in the figure. C and D in Figure 22 are schematic diagrams of the activity after the modification. FIG. 23 : Effects of different lengths of linker sequences on the in vitro cleavage activity of DEAR6 with increased recruitment sequences. Figure 24: Effect of adding recruitment sequence on in vitro cleavage activity of DEAR1. Figure 24 A is a comparison of in vitro cleavage activity of the original version of DEAR1 and DEAR1 with D6 deleted and recruitment sequence added, and Figure 24 B is the effect of recruitment sequences of different lengths on the in vitro cleavage activity of engineered DEAR1. Figure 25: Figure A in Figure 25 is a schematic diagram of the transformation of DEARs into heterodimers; Figure 25 B is a molecular sieve and cryo-electron microscopy two-dimensional image of the DEAR1 heterodimer; Figure 25 C is a schematic diagram of different forms of substrates of DEAR1 heterodimer cutting double-stranded DNA, from left to right are schematic diagrams of 5' protruding end, blunt end, and 3' protruding end products; Figure 25 D is a result diagram of DEAR1 heterodimer cutting double-stranded DNA substrates, which are the results of cutting substrates with 5' protruding ends and spacer sequence lengths of 15, 30, and 45 nucleotides, the results of cutting the cutting sites with a distance of 0 nucleotides, i.e., the cutting product is a blunt end product, and the results of cutting substrates with 3' protruding ends and spacer sequence lengths of -6, 0, 15, 30, and 45 nucleotides. Figure 26: Schematic diagram of the results of DEARs heterodimer cutting in bacteria. On the left is a survival experiment of DEARs cutting in bacteria on a plate with streptomycin resistance and with arabinose inducing the expression of the CcdB toxic gene. Only bacteria that have undergone cutting can grow. On the right is a resistance cutting experiment. On a plate with ampicillin resistance, when the DEAR system cuts the resistance plasmid, bacteria that have lost their resistance cannot survive. Figure 27: Schematic diagram of the modified structure of the DEAR system with the addition of an extended recognition zone (RS). Figure 28: Cutting effect of the DEAR system after modification with the extended identification zone (RS). A in FIG28 is a cutting glue diagram of the modified DEAR1 RS+1-14, B in FIG28 is a cutting efficiency diagram of the modified DEAR1RS+1-14, C in FIG28 is a K value diagram of the cutting of the modified DEAR1 RS+1-14, and D in FIG28 is a 24-hour cutting ratio diagram of the modified DEAR1 RS+1-14; E in Figure 28 is the cutting glue diagram of the modified DEAR2RS+1-14, F in Figure 28 is the cutting efficiency diagram of the modified DEAR2RS+1-14, G in Figure 28 is the K value diagram of the cutting of the modified DEAR2RS+1-14, and H in Figure 28 is the 24-hour cutting ratio diagram of the modified DEAR2RS+1-14. Figure 29: Comparison of the cleavage of specific substrates and non-specific substrates by the DEAR system with an extended recognition region. Figure 29 A shows the comparison of the cleavage of RS-paired substrates and RS-unpaired substrates by the wild type and the extended recognition region (RS)-inserted DEAR1. Cleavage of paired substrates. FIG29B compares the cleavage of RS-paired and RS-unpaired substrates by wild-type and extended recognition region (RS)-inserted DEAR2. Figure 30: Comparison of the cutting effect diagrams after the modification of the DEAR1 system with the addition of a 14-nt extended recognition region (RS), Figure 30 A is the cutting gel image of the comparison diagram of the single point mutation after DEAR1 extended RS to 14nt, where the single point mutation is referred to as SM1 (the number represents the unpaired region on the DNA substrate), Figure 30 B is the cutting efficiency diagram of the single point mutation after DEAR1 extended RS to 14nt, Figure 30 C is the K value diagram of the single point mutation after DEAR1 extended RS to 14nt, and Figure 30 D is the 24-hour cutting ratio diagram of the single point mutation after DEAR1 extended RS to 14nt. FIG. 31 : Verification of RNA cleavage activity of DEAR10. FIG. 32 : Verification of ssDNA cleavage activity of DEAR10. FIG. 33 : Comparison of cleavage of paired and unpaired DNA substrates by DEAR10. FIG. 34 : Verification of ssDNA cleavage activity of DEAR10 in reprogramming TRS region. FIG. 35 : Verification of plasmid cleavage activity of DEAR1 to 6 and DEAR10. Figure 36: Toxicity testing of DEAR in E. coli. Figure 37: Verification of DEAR's cutting activity on mammalian cell genomic DNA, wherein A in Figure 37 is a schematic diagram of the DEAR cutting mammalian cell genome activity verification system, and B in Figure 37 is the survival of mammalian cells edited by DEAR under resistance screening. Figures 38A to 38C: Detection of the editing pattern of DEAR on mammalian cells, wherein Figure 38A: Detection of the editing pattern of DEAR1 at three targeting sites; Figure 38B: Detection of the editing pattern of DEAR1 on the entire targeting sequence; Figure 38C: Detection of the editing of DEAR1 on the upstream and downstream sequences of the targeting site. DETAILED DESCRIPTION In order to make the present invention more easily understood, some technical and scientific terms are specifically defined below. Unless otherwise specifically defined herein, all other technical and scientific terms used herein have the meanings commonly understood by those skilled in the art to which the present invention belongs. In this specification, the numerical range expressed using "a numerical value A to a numerical value B" means a range including the endpoints numerical values A and B. In the present specification, the use of “substantially” or “essentially” means that the standard deviation from a theoretical model or theoretical data is within a range of 5%, preferably 3%, and more preferably 1%. In this specification, the word "may" means both performing a certain process and not performing a certain process. In the present specification, "optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes cases where the event occurs and cases where it does not occur. In this specification, the references to "some specific / preferred embodiments", "other specific / preferred embodiments", "embodiments", etc., mean that the specific elements (e.g., features, structures, properties and / or characteristics) described in connection with the embodiments are included in at least one embodiment described herein, and may or may not exist in other embodiments. In addition, it should be understood that the elements may be combined in any suitable manner. In various embodiments. The terms "including" and "having" and any variations thereof of the present invention are intended to cover non-exclusive inclusions. For example, a process, method, device, product or equipment comprising a series of steps is not limited to the listed steps or modules, but may optionally include steps not listed, or may optionally include other steps inherent to these processes, methods, products or equipment. In the present invention, the term "multiple" refers to two or more than two. "And / or" describes the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B can represent the following three situations: A exists alone, A and B exist at the same time, and B exists alone. The character " / " generally indicates that the associated objects are in an "or" relationship. In this specification, the terms "polynucleotide" and "nucleic acid" used interchangeably refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, this term includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine bases and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases. In the art, "G", "C", "A", "T" and "U" generally represent the bases of guanine, cytosine, adenine, thymine and uracil, respectively, but it is also generally known in the art that "G", "C", "A", "T" and "U" each generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively, which is a common way to represent deoxyribonucleic acid sequences and / or ribonucleic acid sequences, so in the context of the present invention, the meanings represented by "G", "C", "A", "T", "U" include the above-mentioned various possible situations. However, it should be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide or an alternative replacement part. Those skilled in the art can appreciate that guanine, cytosine, adenine and uracil can be replaced by other parts without substantially changing the base pairing properties of an oligonucleotide (including a nucleotide having such a replacement part). In this specification, the term "nucleic acid manipulation" includes binding, nicking one strand, or cutting (i.e., severing) two strands of a nucleic acid, or includes modifying or editing a nucleic acid. Nucleic acid manipulation can silence, activate, or regulate (increase or decrease) the expression of an RNA or polypeptide encoded by the nucleic acid. In this specification, "hybridizable" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA, DNA) comprises a nucleotide sequence that enables the nucleic acid to non-covalently bind (i.e., form Watson-Crick base pairs and / or G / U base pairs), "anneal" or "hybridize" with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to the complementary nucleic acid) under appropriate in vitro and / or in vivo temperature and solution ionic strength conditions. Standard Watson-Crick base pairing includes: adenine (A) pairs with thymidine (T), adenine (A) pairs with uracil (U), and guanine (G) pairs with cytosine (C). In addition, for hybridization between two RNA molecules (e.g., dsRNA), and for hybridization between a DNA molecule and an RNA molecule (e.g., when a DNA or RNA target nucleic acid base pairs with the substrate recognition region of the DEAR nucleic acid manipulation system): guanine (G) can also pair with uracil (U). For example, in the case of tRNA anticodons base pairing with codons in mRNA, G / U base pairing is at least partially responsible for the degeneracy of the genetic code. Hybridization and washing conditions are well known and described in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Spring Harbor (1989), particularly Chapter 11 and Table 11.1 of that reference; and Sambrook, J. and Russell, W., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor (2001). The conditions of temperature and ionic strength determine the "stringency" of hybridization. In the present invention, "moderate stringency conditions", "moderate-high stringency conditions", "high stringency conditions" or "very high stringency conditions" describe conditions for nucleic acid hybridization and washing. Guidance for conducting hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6, which is incorporated herein by reference. Aqueous and non-aqueous methods are described in this document, and either can be used. For example, specific hybridization conditions are as follows: (1) Low stringency hybridization conditions are in 6× sodium chloride / sodium citrate (SSC) at about Then at least Wash twice in 0.2×SSC, 0.1% SDS (for low stringency conditions, the wash temperature can be increased to ); (2) medium stringency hybridization conditions at 6×SSC, at about Then in Wash once or more in 0.2×SSC, 0.1% SDS; (3) High stringency hybridization conditions at 6×SSC, about Then in Washing in 0.2×SSC, 0.1% SDS one or more times and preferably; (4) Very high stringency hybridization conditions are 0.5 M sodium phosphate, 7% SDS, Then in Wash one or more times in 0.2X SSC, 1% SDS. Hybridization requires that the two nucleic acids contain complementary sequences, but mismatches between bases are possible. Conditions suitable for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, which are variables well known in the art. In the present invention, a DNA sequence that "encodes" a specific RNA is a DNA nucleotide sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is converted into a protein (thus both DNA and mRNA encode a protein), or a DNA polynucleotide may encode an RNA that is not translated into a protein (e.g., tRNA, rRNA, microRNA (miRNA), "non-coding" RNA (ncRNA), and the DEAR nucleic acid manipulation system provided by the present invention, etc.). In the present invention, the term "naturally occurring" or "unmodified" or "wild type" as applied to nucleic acids, polypeptides, cells or organisms refers to nucleic acids, polypeptides, cells or organisms that exist in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism and can be isolated from a source in nature is naturally occurring. In the present invention, "recombination" means that a specific nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR) and / or ligation steps, which produce a construct having a structural coding sequence or non-coding sequence that can be distinguished from an endogenous nucleic acid present in a natural system. The DNA sequence encoding a polypeptide can be assembled from a cDNA fragment or from a series of synthetic oligonucleotides to provide a synthetic nucleic acid that can be expressed by a recombinant transcription unit contained in a cell or in a cell-free transcription and translation system. Genomic DNA containing related sequences can also be used in the formation of recombinant genes or transcription units. The sequence of non-translated DNA can be present at the 5' end or 3' end of the open reading frame, wherein such sequences do not interfere with the manipulation or expression of the coding region, and can actually play a role in regulating the production of the desired product through various mechanisms (see "DNA regulatory sequence"). Alternatively, a DNA sequence encoding an untranslated RNA (e.g., the DEAR nucleic acid manipulation system provided by the present invention) can also be considered to be recombinant. Therefore, for example, the term "recombinant" nucleic acid refers to a non-naturally occurring polynucleotide or nucleic acid, such as a polynucleotide or nucleic acid made by an artificial combination of two otherwise separated segments of a sequence through human intervention. This artificial combination is often accomplished by chemical synthesis or by artificial manipulation of isolated segments of nucleic acid (e.g., by genetic engineering techniques). This operation is usually performed with a nucleic acid encoding the same amino acid. In some embodiments, the codon of a nucleic acid, a conservative amino acid or a non-conservative amino acid is replaced by a codon. Alternatively, this operation is performed to connect the nucleic acid segments with the desired function together to produce the desired functional combination. This artificial combination is often completed by chemical synthesis means or by artificially manipulating the separated segments of nucleic acid (for example, by genetic engineering technology). As used in this disclosure, the term "isolated" means a substance that is in a form or environment that does not exist in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including but not limited to any enzyme, mutant, nucleic acid, protein, peptide or cofactor that is at least partially removed from one or more or all of the naturally occurring components with which it is essentially associated; (3) any substance that has been artificially modified relative to the substance found in nature; or (4) any substance that has been modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance). As used in the present disclosure, the term "nucleic acid construct" comprises a polynucleotide encoding a polypeptide or a domain or a module operatively linked to a suitable regulatory sequence, which is necessary for the expression of the polynucleotide in a selected cell or strain. In the present disclosure, the transcriptional regulatory element comprises a promoter, and on this basis, may also comprise enhancers, silencers, insulators and other elements. The term "vector" refers to a genetic element, such as a plasmid, cosmid, bacmid, phage or virus, to which another genetic sequence or element (DNA or RNA) can be attached. A vector can be a replicon, thereby causing the replication of the attached sequence or element. An "expression vector" is a vector that promotes the expression of a nucleic acid or a nucleic acid sequence encoding a polypeptide in a host cell or organism. In the present invention, the terms "recombinant expression vector" or "DNA construct" are used interchangeably herein to refer to a DNA molecule comprising a vector and an insert. Recombinant expression vectors are generally produced for the purpose of expressing and / or propagating one or more inserts, or for the purpose of constructing other recombinant nucleotide sequences. The one or more inserts may or may not be operably linked to a promoter sequence, and may or may not be operably linked to a DNA regulatory sequence. As used herein, the term "operably linked" refers to a nucleic acid sequence that is placed in a functional relationship with another nucleic acid sequence. Examples of nucleic acid sequences that can be operably linked include, but are not limited to, promoters, transcription terminators, enhancers or activators, and heterologous genes that, when transcribed and, if appropriate, translated, will produce a functional product, such as a protein, ribozyme, or RNA molecule. As used herein, the term "derived from" refers to origin or source, and may include naturally occurring, recombinant, unpurified or purified molecules. A nucleic acid derived from an original nucleic acid may partially or completely comprise the original nucleic acid, and may be a fragment or variant of the original nucleic acid. In the present invention, the term "ribozyme" refers to an RNA molecule that can catalyze a specific biochemical reaction. Common examples of such reactions include the cutting or ligation and modification of RNA and DNA. In the present invention, a "target nucleic acid" is a polynucleotide (e.g., DNA such as genomic DNA, RNA, etc.) that includes a site ("target site" or "target sequence") targeted by the DEAR nucleic acid manipulation system provided by the present invention. The target sequence is the sequence with which the substrate recognition region of the DEAR nucleic acid manipulation system will hybridize. For example, the target site (or target sequence) 5'-UGUCUU-3' or 5'-TGTCTT-3' in the target nucleic acid is targeted (or bound by, or hybridized or complementary to) the sequence 5'-AAGACA-3'. Suitable hybridization conditions include physiological conditions that normally exist in cells. In the present invention, "cleavage" means the breakage of the covalent backbone of the target nucleic acid molecule (e.g., RNA, DNA). Both single-stranded and double-stranded cleavage are possible, and double-stranded cleavage can occur due to two different single-stranded cleavage events. "Major cleavage site" refers to the DNA / RNA cleavage site corresponding to the cleavage product with obvious bands. "Secondary cleavage site" refers to the DNA / RNA cleavage site corresponding to the cleavage product with no obvious bands. The term "palindrome sequence" or "palindrome structure" refers to a specific nucleotide segment in a double-stranded DNA or RNA molecule in genetics, where the sequence read from 5' to 3' on one strand is consistent with the sequence read from 5' to 3' on its complementary strand. Single-stranded DNA or RNA with a palindromic sequence has a symmetry center, and the bases on both sides of the symmetry center are symmetrical about the symmetry center and can form complementarity. Therefore, a palindrome sequence can form a hairpin structure (stem-loop structure). In the present invention, "stem-loop", also known as "hairpin", "hairpin loop", "stem-loop structure" or "stem-loop / hairpin structure", refers to the secondary structure formed by a single-stranded oligonucleotide when a complementary base in a first portion of a linear chain hybridizes with a base in a second portion of the same chain. The term "homodimer" refers to a dimerized molecule that is formed by the same molecule and can exist stably. The term "heterodimer" refers to a stable dimerized molecule formed by different molecules. The technical solution of the present invention is described in detail below. The applicant constructed a DEAR nucleic acid manipulation system based on RNA ribozymes based on bacterial class II intron elements. Class II introns are composed of two parts: RNA ribozymes and intron-encoded proteins (IEPs). RNA ribozymes can catalyze the self-splicing maturation of the original transcript, while the protein IEP plays an auxiliary role. The RNA ribozyme part includes six domains, I to VI. Domain I is the largest of all domains and plays an important stabilizing role in the formation of the overall structure of the intron. It contains an exon binding site (EBS) for binding to exons. Domains II and III are also involved in the formation of the ribozyme structure. Domain IV contains an open reading frame (ORF), and the protein it encodes is IEP. Domain V is the catalytic center of the RNA ribozyme, and domain VI performs auxiliary catalytic functions. According to the primary sequence and secondary structure characteristics of RNA, the second class of introns can be divided into A, B and C classes, among which class C is considered to be a more ancient class of introns (DM Simon et al., Group II introns in eubacteria and archaea: ORF-less introns and new varieties. RNA 14, 1704-1713 (2008); AM Lambowitz, S. Zimmerly, Mobile group II introns. Annu Rev Genet 38, 1-35 (2004); JSRest, DPMindell, Retroids in archaea: phylogeny and lateral origins. Mol Biol Evol 20, 1134-1142 (2003).). The applicant has found that the EBS of the C-type second-class intron and its surrounding sequences can be used as the substrate recognition element of the target nucleic acid of the ribozyme (called the target recognition site (TRS)), and the programmability of the TRS has been discovered and demonstrated, and the target nucleic acid (RNA, DNA) is hydrolyzed and cut with the help of the V domain of the RNA intron ribozyme. Therefore, the applicant calls the system with programmable nucleic acid recognition and cutting ability constructed based on the presence or absence of an open reading frame encoding an intron-encoded protein in the IV domain of the C-type second-class intron derived from bacteria as the RNA ribozyme-based DEAR (Dr) nucleic acid manipulation system, or the RNA ribozyme-based HYER (Hr) nucleic acid manipulation system, which is also called the original DEAR (HYER) nucleic acid manipulation system or the original RNA ribozyme-based DEAR (HYER) nucleic acid manipulation system in the present invention. The original DEAR nucleic acid manipulation system still has certain limitations for gene editing due to its short substrate recognition window. In order to overcome this limitation, the present invention intends to engineer the DEAR nucleic acid manipulation system to improve its specificity and cutting activity, thereby obtaining an engineered DEAR nucleic acid manipulation system. <Method for preparing engineered DEAR nucleic acid manipulation system> The object of the present invention is to provide a method for preparing an engineered DEAR nucleic acid manipulation system, wherein the original DEAR nucleic acid manipulation system comprises an RNA molecule derived from a bacterial C-type second intron, wherein the RNA molecule comprises a substrate recognition region that hybridizes with a target sequence in a target nucleic acid, and the RNA molecule comprises domains I to VI; The preparation method comprises at least one selected from the following (a) to (d): (a) extending the substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system to a length of 7 to 14 nucleotides to obtain an extended substrate recognition region; (b) adding a recruitment sequence to the 3' end of the RNA molecule of the original DEAR nucleic acid manipulation system, and the recruitment sequence hybridizes with at least a portion of the target nucleic acid; (c) respectively setting a first dimerization motif and a second dimerization motif in the III domain of the first RNA molecule and the second RNA molecule from the original DEAR nucleic acid manipulation system, wherein the first dimerization motif and the second dimerization motif hybridize with each other, so that the first RNA molecule and the second RNA molecule form a heterodimer; (d) inserting an extended recognition region downstream of the 3′ end of the substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system, wherein the extended recognition region hybridizes with at least a portion of the target nucleic acid. In some embodiments, the engineered DEAR nucleic acid manipulation system has improved specificity and / or cleavage activity compared to the original DEAR nucleic acid manipulation system. Original DEAR Nucleic Acid Manipulation System In some embodiments of the present invention, the original RNA ribozyme-based DEAR nucleic acid manipulation system comprises an (isolated) RNA molecule derived from a bacterial C-type group II intron, wherein the RNA molecule comprises a substrate recognition region that hybridizes to a target sequence in a target nucleic acid. In some embodiments of the present invention, the original DEAR nucleic acid manipulation system comprises at least one domain of domain I, domain II, domain III, domain IV, domain V and domain VI. In some preferred embodiments, the original DEAR nucleic acid manipulation system comprises at least domain I, domain II, domain III and domain V. In some specific embodiments of the present invention, the original DEAR nucleic acid manipulation system contains 6 domains (i.e., domain I, domain II, domain III, domain IV, domain V, and domain VI; the 6 domains can also be expressed as domains I to VI, or simply referred to as D1 to D6), with a length ranging from 100-5660nt; preferably 124-3897nt. In some specific embodiments of the present invention, domain I comprises 2-6 stem-loop / hairpin structures, with a length range of 50-400 nt, and a TRS sequence responsible for substrate recognition, preferably 3-5 stem-loop / hairpin structures, with a length range of 65-384 nt; domain II comprises 1-4 stem-loop / hairpin structures, with a length range of 10-300 nt, preferably 1-3 stem-loop / hairpin structures, with a length range of 10-218 nt; domain III comprises 1-3 stem-loop / hairpin structures, with a length range of 10-200 nt, preferably 1-2 stem-loop / hairpin structures, with a length range of 10-140 nt; domain IV comprises 0-4 stem-loop / hairpin structures, and 0-4000 nt. nt region of the open reading frame encoding IEP, with a length range of 0-4500nt, preferably 0-4 stem-loop / hairpin structures, with a length range of 0-3000nt; domain V contains 1 stem-loop / hairpin structure, with a length range of 20-60nt, preferably 1 stem-loop / hairpin structure, with a length range of 29-43nt, which contains the catalytic reaction core; domain VI contains 1 stem-loop / hairpin structure, with a length range of 10-200nt, preferably 1 stem-loop / hairpin structure, with a length range of 10-112nt. The primary sequence and secondary structure characteristics of the RNA molecule of the C-type second intron are shown in Figures 1K to 1M. In some embodiments of the present invention, the C-type group II intron is a C-type group II intron in which an open reading frame encoding an IEP is not present in the IV domain. In other embodiments of the present invention, the C-type second intron is a C-type second intron in which an open reading frame encoding IEP exists in the IV domain. In some more specific embodiments, the open reading frame encoding IEP in the C-type second intron in which an open reading frame encoding IEP exists is missing. The original DEAR nucleic acid manipulation system acts as an endonuclease, which catalyzes nucleic acid fragmentation at a specific sequence in a targeted target nucleic acid (e.g., DNA, RNA). As will be described in detail later, sequence specificity is provided by a substrate recognition region in the DEAR nucleic acid manipulation system, which hybridizes with a target sequence in the target nucleic acid. Therefore, the DEAR nucleic acid manipulation system binds to the target nucleic acid through hybridization of the substrate recognition region with the target sequence in the target nucleic acid. In other words, the position where specific binding (and / or cleavage) of the target nucleic acid occurs is determined by the base pairing complementarity of the substrate recognition region and the target nucleic acid. In some specific embodiments, the primary cleavage site of the original DEAR nucleic acid manipulation system is 0-1 nt downstream of the 3' end of the target sequence in the target nucleic acid, that is, the primary cleavage site is located 0-1 nt downstream of the 3' end of the region pairing with the substrate recognition region on the target nucleic acid. In some embodiments of the present invention, the nucleotide sequence of the RNA molecule of the original DEAR nucleic acid manipulation system is selected from any one of the following: (i) comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 1 to 9 and 132; (ii) a nucleotide sequence comprising the reverse complementary sequence of the sequence shown in any one of SEQ ID NOs: 1 to 9 and 132; (iii) a reverse complementary sequence of a sequence that can hybridize to the nucleotide sequence shown in (i) or (ii) under high stringency hybridization conditions or very high stringency hybridization conditions; (iv) a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, and most preferably at least 99% sequence identity with the nucleotide sequence shown in (i) or (ii). SEQ ID NOs: 1 to 9 and 132 are shown below: Among them, "NNNNNN" is the substrate recognition region, where N is A, U, G or C. In some specific embodiments, the original DEAR nucleic acid manipulation system comprises an RNA molecule, the nucleotide sequence of which is a nucleotide sequence as shown in any one of SEQ ID NOs: 1 to 9 and 132. (Substrate recognition region) In some embodiments, the substrate recognition region of the original DEAR nucleic acid manipulation system is a nucleotide sequence that is complementary to a sequence in a target nucleic acid (target sequence). In other words, the substrate recognition region of the original DEAR nucleic acid manipulation system can interact with a target nucleic acid (e.g., DNA, RNA) in a sequence-specific manner by hybridization (i.e., base pairing). The substrate recognition region can be modified (e.g., by genetic engineering) / designed to hybridize with any desired target sequence within a target nucleic acid (e.g., a prokaryotic target nucleic acid, a eukaryotic target nucleic acid, an isolated target nucleic acid). In some embodiments, the substrate recognition region is programmable in that it can be designed or engineered to recognize and bind different target sequences. In some embodiments, the complementarity percentage between the substrate recognition region and the target sequence of the target nucleic acid is 60% or more (e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some embodiments, the complementarity percentage between the substrate recognition region and the target sequence of the target nucleic acid is 80% or more (e.g., 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some embodiments, the complementarity percentage between the substrate recognition region and the target sequence of the target nucleic acid is 90% or more (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some embodiments, the complementarity percentage between the substrate recognition region and the target sequence of the target nucleic acid is 100%. In some embodiments, the substrate recognition region has a length of 6 nucleotides (nt). In some specific embodiments, the sequence of the substrate recognition region is: N1N2N3N4N5N6; wherein N1 to N6 are A, G, C or U respectively. In some embodiments, at least any four nucleotides in the substrate recognition region of the original DEAR nucleic acid manipulation system are complementary to the target sequence of the target nucleic acid. In some preferred embodiments, at least any five nucleotides in the substrate recognition region of the original DEAR nucleic acid manipulation system are complementary to the target sequence of the target nucleic acid. In some more preferred embodiments, 6 nucleotides in the substrate recognition region of the original DEAR nucleic acid manipulation system are complementary to the target sequence of the target nucleic acid. In some specific embodiments, the sequence of the substrate recognition region is selected from, but not limited to: (a)AAGACA; (b) UAGGCA; (c) CAGACA; (d)AAUGAA; (e)AUAACA; (f) ACAUCA; (g) CACUCA; (h)AUUACA. In some specific embodiments, the original DEAR nucleic acid manipulation system comprises an RNA molecule, the nucleotide sequence of which is a nucleotide sequence as shown in any one of SEQ ID NOs: 10 to 18 and 133. (Target nucleic acid) In the present invention, the original DEAR nucleic acid manipulation system can bind and cut the target nucleic acid. In the present invention, the target nucleic acid It can be any nucleic acid (e.g., DNA, RNA), can be any type of nucleic acid (e.g., chromosomal (genomic DNA), derived from chromosomes, chromosomal DNA, plasmid, viral, extracellular, intracellular, mitochondrial, chloroplast, linear, circular, etc.) and can be from any organism (e.g., as long as the original DEAR nucleic acid manipulation system contains a nucleotide sequence that hybridizes to a target sequence in a target nucleic acid so that the target nucleic acid can be targeted). Specifically, in the present invention, the target nucleic acid can be DNA or RNA. In some exemplary embodiments, the target nucleic acid is selected from: mRNA, rRNA, tRNA, non-coding RNA (ncRNA), long non-coding RNA (lncRNA) and micro RNA (miRNA). In some exemplary embodiments, the target nucleic acid is viral DNA, plasmid DNA. The target nucleic acid can be located anywhere, for example, outside of in vitro cells, inside of in vitro cells, inside of in vivo cells, inside of ex vivo cells. Extended substrate recognition region In some embodiments of the present invention, the substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system is extended to a length of 7 to 14 nucleotides to obtain an extended substrate recognition region, thereby obtaining an engineered DEAR nucleic acid manipulation system having an extended substrate recognition region. Similarly, the extended substrate recognition region is a nucleotide sequence complementary to a sequence in the target nucleic acid (target sequence). In some specific embodiments, the sequence N1N2N3N4N5N6 of the substrate recognition region can be extended to N1N2N3N4N5N6N7, that is, NNNNNN in any one of SEQ ID NOs: 1 to 9 and 132 is replaced with NNNNNNN. In some specific embodiments, the sequence N1N2N3N4N5N6 of the substrate recognition region can be extended to N1N2N3N4N5N6N7N8, that is, NNNNNN in any one of SEQ ID NOs: 1 to 9 and 132 is replaced with NNNNNNNN. In some specific embodiments, the sequence N1N2N3N4N5N6 of the substrate recognition region can be extended to N1N2N3N4N5N6N7N8N9, that is, NNNNNN in any one of SEQ ID NOs: 1 to 9 and 132 is replaced with NNNNNNNNN. In some specific embodiments, the sequence of the substrate recognition region N1N2N3N4N5N6 can be extended to N1N2N3N4N5N6N7N8N9N 10 That is, NNNNNN in any one of SEQ ID NOs: 1 to 9 and 132 is replaced with NNNNNNNNNN. In some specific embodiments, the sequence of the substrate recognition region N1N2N3N4N5N6 can be extended to N1N2N3N4N5N6N7N8N9N 10 N 11 That is, NNNNNN in any one of SEQ ID NOs: 1 to 9 and 132 is replaced with NNNNNNNNNNN. In some specific embodiments, the sequence of the substrate recognition region N1N2N3N4N5N6 can be extended to N1N2N3N4N5N6N7N8N9N 10 N 12 That is, NNNNNN in any one of SEQ ID NOs: 1 to 9 and 132 is replaced with NNNNNNNNNNNN. In some specific embodiments, the sequence of the substrate recognition region N1N2N3N4N5N6 can be extended to N1N2N3N4N5N6N7N8N9N 10 N 12 N 13 That is, NNNNNN in any one of SEQ ID NOs: 1 to 9 and 132 is replaced with NNNNNNNNNNNNN. In some specific embodiments, the sequence N1N2N3N4N5N6 of the substrate recognition region can be extended to N1N2N3N4N5N6N7N8N9N 10 N 12 N 13 N 14 That is, NNNNNN in any one of SEQ ID NOs: 1 to 9 and 132 is replaced with NNNNNNNNNNNNNN. In the above embodiment, N1~N 14 Any one of them is A, G, C or U. In some embodiments, the extended substrate recognition region is identical in design to the substrate recognition region of the original DEAR nucleic acid manipulation system except for its length. In some preferred embodiments, the substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system is extended to have a length of 7 to 12 nucleotides, preferably 7 to 10 nucleotides, such as 7, 8, 9 or 10 nucleotides. Added recruitment sequence In some embodiments of the present invention, a recruitment sequence is added to the 3' end of the RNA molecule of the original DEAR nucleic acid manipulation system, and the recruitment sequence hybridizes to at least a portion of the target nucleic acid. In some embodiments, the recruitment sequence is 10 to 40 nucleotides in length. In some preferred embodiments, the recruitment sequence is 14 to 26 nucleotides in length. In some exemplary embodiments, the recruitment sequence is 14, 20 or 26 nucleotides in length. In some more preferred embodiments, the recruitment sequence is 20 nucleotides in length. In some embodiments, the portion of the target nucleic acid that hybridizes to the recruitment sequence is different from the target sequence in the target nucleic acid that hybridizes to the substrate recognition region. In some preferred embodiments, the portion of the target nucleic acid that hybridizes to the recruitment sequence is separated from the target sequence in the target nucleic acid that hybridizes to the substrate recognition region by 10 to 60 nucleotides (i.e., the length of the connecting sequence), preferably 20 to 50 nucleotides. In some embodiments, the portion of the target nucleic acid that binds to the recruitment sequence is called a recruitment sequence binding sequence. In some embodiments, in the target nucleic acid, there is a gap between the substrate binding sequence recognized by the substrate recognition sequence TRS of the DEAR nucleic acid manipulation system and the recruitment sequence binding sequence, which is called a linker sequence. In some embodiments, the length of the linker sequence is 10 to 60 nucleotides, preferably 20 to 50 nucleotides. In some embodiments, while adding the recruitment sequence to the 3' end of the RNA molecule of the original DEAR nucleic acid manipulation system, the VI domain of the RNA molecule of the original DEAR nucleic acid manipulation system is also deleted. That is, after deleting the VI domain of the RNA molecule of the original DEAR nucleic acid manipulation system, the recruitment sequence is connected to the 3' end of the RNA molecule of the original DEAR nucleic acid manipulation system. Deletion of the VI domain of the RNA molecule of the original DEAR nucleic acid manipulation system: For DEAR1, nucleotides 597-633 in SEQ ID NO:1 were deleted; For DEAR2, nucleotides 590-621 in SEQ ID NO:2 were deleted; For DEAR3, nucleotides 607-647 in SEQ ID NO:3 were deleted; For DEAR4, nucleotides 608-650 in SEQ ID NO:4 were deleted; For DEAR5, nucleotides 604-640 in SEQ ID NO:5 were deleted; For DEAR6, nucleotides 551-595 in SEQ ID NO:6 were deleted; For DEAR7, nucleotides 597-644 in SEQ ID NO:7 were deleted; For DEAR8, nucleotides 595-636 in SEQ ID NO:8 were deleted; For DEAR9, nucleotides 416-451 in SEQ ID NO:9 were deleted; For DEAR10, nucleotides 443 to 479 in SEQ ID NO: 132 were deleted. Setting the dimerization motif In some embodiments of the present invention, a first dimerization motif and a second dimerization motif are respectively set in the III domain of the first RNA molecule and the second RNA molecule from the original DEAR nucleic acid manipulation system, and the first dimerization motif and the second dimerization motif hybridize with each other so that the first RNA molecule and the second RNA molecule form a heterodimer. In some embodiments, the length of the first dimerization motif and the second dimerization motif is the same. In some embodiments, the length of the first dimerization motif and the second dimerization motif is 4 to 10 nucleotides, preferably 5 to 9 nucleotides, for example, 5, 6, 7, 8, 9 or 10 nucleotides, more preferably 6 nucleotides. In some embodiments, the sequence of the first substrate recognition region (TRS1) of the first RNA molecule and the second substrate recognition region (TRS2) of the second RNA molecule may be the same or different. In some specific embodiments, the first substrate recognition region and the second substrate recognition region can respectively recognize two strands of a double-stranded target nucleic acid. In other specific embodiments, the first substrate recognition region and the second substrate recognition region can recognize one strand of a double-stranded target nucleic acid, or recognize a single-stranded target nucleic acid. In some specific embodiments, the first substrate recognition region and the second substrate recognition region can respectively recognize different parts of the target nucleic acid. In some specific embodiments, the first substrate recognition region and the second substrate recognition region can recognize the same part of the target nucleic acid. The present invention found that DEAR1 of the original DEAR nucleic acid manipulation system can form homodimers under natural conditions through the dimerization motif of the III domain in its RNA molecule (nucleotides 361-366 of SEQ ID NO:1 / SEQ ID NO:10, which is a palindromic sequence UCUAGA). Based on this, in some specific embodiments of the present invention, the dimerization motifs of the III domain in the RNA molecules of the two monomers (i.e., the first RNA molecule and the second RNA molecule) in the dimer formed by DEAR1 of the original DEAR nucleic acid manipulation system (i.e., nucleotides 361-366) are replaced with different sequences of 6 nucleotides that can hybridize with each other, and the RNA molecules of the two different DEAR nucleic acid manipulation systems after the dimerization motifs are replaced can form heterodimers. Specifically, the structure of the first RNA molecule (monomer 1) is: GUGCGCUCGGCAUGGGUGCAAUCUCUAGGGUGAAAGUCCCGAACUGCGAAGGCAGAAGUAGCAGUUAGCUUAACGCAAGGGUGUCCGUGGUGACGCGGAAUCUGAAGGAAGCGGGCGGCAAACUUCCGGUCUGAGGAACACGAACUUCAUAUAAGGCUAGGUAUCAUUGGAUGAGUUUGC-[TRS1]-AAACAAAGUCCUUUCUGCCGAAGGUGAUACAGAGUAAAUGAAGCAGAUAGAUGGAAGGAAAGAUUGUACUCUUACCCGAGGAGGUCUGAUGGAUACGUGAAGUGCGCUUCAUAACCUACUUAGUGAUAAGUAACUGAACCAUCAGAAGUCAGCAGAGGUCAUAGUACGAAUCGG-[First dimerization motif]-ACGAUUCGGAAGGACUGAACAAUCAAGAGAAAAUAGCCCUUGGCAUUCAGUACGUCAUGAUGAACACAGAAAACAUGGUACCUCCCAAGAGAAAGGAAACGGUGAAUCCCGUGGGAAUCUUUUGGAGGGUGGAGUGACGACUGGCAUAAGAAGAUCAGC UAUUUACGGAAGGAAGCUUGCGUCAUUAUCUUGAUUGAACCGCCGUAUACGGAACCGUACGUACGGUGGUGUGAGAGGACGGAGGUUAAUCACCUCCUCCUACUCGAU; The structure of the second monomer of the second RNA molecule is: GUGCGCUCGGCAUGGGUGCAAUCUCUAGGGUGAAAGUCCCGAACUGCGAAGGCAGAAGUAGCAGUUAGCUUAACGCAAGGGUGUCCGUGGUGACGCGGAAUCUGAAGGAAGCGGGCGGCAAACUUCCGGUCUGAGGAACACGAACUUCAUAUAAGGCUAG GUAUCAUUGGAUGAGUUUGC-[TRS2]-AAACAAAGUCCUUUCUGCCGAAGGUGAUACAGAGUAAAUGAAGCAGAUAGAUGGAAGGAAAGAUUGUACUCUUACCCGAGGAGGUCUGAUGGAUACGUGAAGUGCGCUUCAUAACCUACUUAGUGAUAAGUA ACUGAACCAUCAGAAGUCAGCAGAGGUCAUAGUACGAAUCGG-[Second dimerization motif]-ACGAUUCGGAAGGACUGAACAAUCAAGAGAAAAUAGCCCUUGGCAUUCAGUACGUCAUGAUGAACACAGAAAACAUGGUACCUCCCAAGAGAAAGGAAACGGUGAAU CCCGUGGGAAUCUUUUGGAGGGUGGAGUGACGACUGGCAUAAGAAGAUCAGCUAUUUACGGAAGGAAGCUUGCGUCAUUAUCUUGAUUGAACCGCCGUAUACGGAACCGUACGUACGGUGGUGAGAGGACGGAGGUUAAUCACCUCCUCCUACUCGAU In other specific embodiments of the present invention, the dimerization motifs of the III domain (i.e., nucleotides 361-366) in the RNA molecules of the two monomers (i.e., the first RNA molecule and the second RNA molecule) in the dimer formed by DEAR5 of the original DEAR nucleic acid manipulation system are replaced with different sequences of 6 nucleotides that can hybridize with each other, and the two different RNA molecules of the DEAR nucleic acid manipulation system after the dimerization motifs are replaced can form a heterodimer. In other specific embodiments of the present invention, the dimerization motifs (i.e., nucleotides at positions 361-366) of the III domain in the two monomers (i.e., the first RNA molecule and the second RNA molecule) of the dimer formed by DEAR1 or DEAR5 can be replaced with different sequences of 6 nucleotides that can hybridize with each other, and the III domains (e.g., nucleotides at positions 340-385 of DEAR1) in the two monomers (i.e., the first RNA molecule and the second RNA molecule) of the RNA molecule after the dimerization motif is replaced can be replaced with the III domains in two RNA molecules of other original DEAR nucleic acid manipulation systems (e.g., any one of DEAR1-10), so that the RNA molecules of two different DEAR nucleic acid manipulation systems after the III domain (including the dimerization motif replacement) is replaced can form heterodimers. In some embodiments, when cutting double-stranded DNA, the two TRS of the heterodimer can respectively recognize and cut the two strands of the double-stranded DNA to form a double-stranded DNA break. Only when there are substrate binding sequences (Target) that can be recognized by the two TRS of the heterodimer on the two strands of the double-stranded DNA, can it be cut to form a double-stranded DNA break, which broadens the range of DNA recognition by the DEAR nucleic acid manipulation system and extends the original 6nt recognition to 12nt. And as shown in Figure 25. According to the design differences of the recognition site, three different products can be produced, namely 3' protruding end (interval length 0-45nt), blunt end (interval length 0nt), 5' protruding end (interval length 0-45nt). Insert extended identification area In some embodiments of the present invention, an extended recognition region is inserted downstream of the 3' end (primary structure, i.e., nucleotide sequence) of the substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system, and the extended recognition region hybridizes with at least a portion of the target nucleic acid. In some embodiments of the present invention, with respect to the tertiary structure, an extended recognition region is inserted into a region spatially close to the 5' end of the substrate recognition region TRS in the RNA molecule of the original DEAR nucleic acid manipulation system (in the tertiary structure, the region adjacent to the 5' end of the substrate recognition region TRS), and the extended recognition region hybridizes with at least a portion of the target nucleic acid. The present invention finds that inserting a sequence at a position close to the substrate recognition region TRS in space (tertiary structure) (i.e., the region close to the 5' end of the substrate recognition region TRS in space, or referred to as the spatial position) (the spatial position is the region adjacent to the first nucleotide of TRS in the tertiary structure. Moreover, in the primary structure, in different DEARs, the spatial position is in a conserved region, and the conserved region is located in a region that can be aligned with the 223rd nucleotide of DEAR1, for example, by using the Clustal Omega (1.2.4) method (F. Sievers et al., Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7, (2011). doi: ARTN 539), the sequences of DEAR1-10 are aligned, for example, by the above-mentioned method, the 223rd nucleotide of DEAR1 corresponds to the 226th nucleotide of DEAR2), can effectively improve the specificity and cutting efficiency of DEAR for substrate cutting, as shown in Figure 27. The examples show that the cleavage activity and specificity of the original DEAR nucleic acid manipulation system can be improved by extending the region (recognition region) in the RNA molecule of the original DEAR nucleic acid manipulation system that hybridizes with the target nucleic acid. For example, for DEAR1-10, the length of the inserted extended recognition region ranges from 0 to 24 nt, so that the DEAR system, which originally only had 6 bases involved in complementary pairing, increases to 20 base sequences or more, thereby greatly improving the specificity. In some embodiments, the extended recognition region is inserted into the original DEAR nucleic acid manipulation system by replacing any nucleotide from 20 to 60, preferably any nucleotide from 30 to 50, downstream of the 3' end (primary structure, i.e., nucleotide sequence) of the substrate recognition region. In some more specific embodiments, for DEAR1, the extended recognition region replaces the 223rd nucleotide in SEQ ID NO:1, that is, the 223rd nucleotide of SEQ ID NO:1 is deleted, and the extended recognition region is inserted between the 222nd and 224th nucleotides of SEQ ID NO:1. In some more specific embodiments, for DEAR2, the extended recognition region replaces the 226th nucleotide in SEQ ID NO:2, i.e., the 226th nucleotide of SEQ ID NO:2 is deleted, and the extended recognition region is inserted between the 225th nucleotide and the 227th nucleotide of SEQ ID NO:2. In some more specific embodiments, for DEAR3, the extended recognition region replaces the 222nd nucleotide in SEQ ID NO:3, that is, the 222nd nucleotide of SEQ ID NO:3 is deleted, and the extended recognition region is inserted between the 221st nucleotide and the 223rd nucleotide of SEQ ID NO:3. In some more specific embodiments, for DEAR4, the extended recognition region replaces the 221st nucleotide in SEQ ID NO:4, i.e., the 221st nucleotide of SEQ ID NO:4 is deleted, and the extended recognition region is inserted between the 220th nucleotide and the 222nd nucleotide of SEQ ID NO:4. In some more specific embodiments, for DEAR5, the extended recognition region replaces the 223rd nucleotide in SEQ ID NO:5, i.e., the 223rd nucleotide of SEQ ID NO:5 is deleted, and the extended recognition region is inserted between the 222nd and 224th nucleotides of SEQ ID NO:5. In some more specific embodiments, for DEAR6, the extended recognition region replaces the 258th nucleotide in SEQ ID NO:6, that is, the 258th nucleotide of SEQ ID NO:6 is deleted, and the extended recognition region is inserted between the 257th nucleotide and the 259th nucleotide of SEQ ID NO:6. In some more specific embodiments, for DEAR7, the extended recognition region replaces the 249th nucleotide in SEQ ID NO:7, i.e., the 249th nucleotide of SEQ ID NO:7 is deleted, and the extended recognition region is inserted between the 248th nucleotide and the 250th nucleotide of SEQ ID NO:7. In some more specific embodiments, for DEAR8, the extended recognition region replaces the 224th nucleotide in SEQ ID NO:8, i.e., the 224th nucleotide of SEQ ID NO:8 is deleted, and the extended recognition region is inserted between the 223rd nucleotide and the 225th nucleotide of SEQ ID NO:8. In some more specific embodiments, for DEAR9, the extended recognition region replaces the 223rd nucleotide in SEQ ID NO:9, i.e., the 223rd nucleotide of SEQ ID NO:9 is deleted, and the extended recognition region is inserted between the 222nd and 224th nucleotides of SEQ ID NO:9. In some more specific embodiments, for DEAR10, the extended recognition region replaces the 223rd nucleotide in SEQ ID NO:132, i.e., the 223rd nucleotide of SEQ ID NO:132 is deleted, and the extended recognition region is inserted between the 222nd and 224th nucleotides of SEQ ID NO:132. In some embodiments, the target sequence in the target nucleic acid that hybridizes to the substrate recognition region and the sequence in the target nucleic acid that hybridizes to the extended recognition region are continuous nucleotide sequences in the target nucleic acid. As shown in FIG27 , the target sequence in the target nucleic acid hybridized with the substrate recognition region (TRS) (TRS targeting region in FIG27 , 6 nt) and the sequence in the target nucleic acid hybridized with the extended recognition region (RS) (TRS targeting region in FIG27 , 14 nt) are continuous nucleotide sequences in the target nucleic acid, i.e., continuous 20 nt nucleotide sequences in the target nucleic acid, and these continuous 20 nt nucleotide sequences together constitute the target DNA sequence of the modified DEAR nucleic acid manipulation system. Thus, as demonstrated in the examples, by extending the length of the region (recognition region) where DEAR hybridizes with the target nucleic acid (e.g., from 6 nt to 20 nt), the specificity and cutting efficiency of DEAR for substrate cutting are improved. In some specific embodiments, the target sequence in the target nucleic acid that hybridizes to the substrate recognition region is located at the 5' end of the sequence in the target nucleic acid that hybridizes to the extended recognition region, that is, in the target nucleic acid, the first nucleotide downstream of the 3' end of the nucleotide at the 3' end of the target sequence in the target nucleic acid that hybridizes to the substrate recognition region is the 5' end of the sequence in the target nucleic acid that hybridizes to the extended recognition region. In some specific embodiments, the length of the extended recognition region is 1 to 24 nt, preferably 1 to 14 nt, for example, 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, but not limited thereto. In some embodiments, the percentage of complementarity between the extended recognition region and the sequence of the target nucleic acid it recognizes is 60% or more (e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some embodiments, the complementarity percentage between the extended recognition region and the sequence of the target nucleic acid it identifies is 80% or higher (e.g., 85% or higher, 90% or higher, 95% or higher, 97% or higher, 98% or higher, 99% or higher, or 100%). In some embodiments, the complementarity percentage between the extended recognition region and the sequence of the target nucleic acid it identifies is 90% or higher (e.g., 95% or higher, 97% or higher, 98% or higher, 99% or higher, or 100%). In some embodiments, the complementarity percentage between the substrate recognition region and the target sequence of the target nucleic acid is 100%. <Engineered DEAR Nucleic Acid Manipulation System> Some aspects of the present invention provide an engineered DEAR nucleic acid manipulation system, which is prepared by the method for preparing the engineered DEAR nucleic acid manipulation system described in the present invention. <Biological Materials> (Isolated Polynucleotide) In some embodiments of the present invention, an isolated polynucleotide is provided, wherein the polynucleotide comprises a nucleotide sequence encoding the engineered DEAR nucleic acid manipulation system of the present invention. (Nucleic acid construct) In some embodiments of the present invention, a nucleic acid construct is provided, wherein the nucleic acid construct comprises the isolated polynucleotide of the present invention. In some optional embodiments, the polynucleotide is operably linked to one or more regulatory sequences, which are nucleotide sequences comprising a promoter and / or a ribosome binding site, and the regulatory sequences direct the expression of the genes of the engineered DEAR nucleic acid manipulation system in the host cell. (Carrier) In some embodiments of the present invention, a vector is provided, wherein the vector comprises the isolated polynucleotide of the present invention, or the nucleic acid construct of the present invention. In some specific embodiments, the vector is a recombinant expression vector. Suitable recombinant expression vectors include viral expression vectors (e.g., viral vectors based on the following viruses, vaccinia virus, polio virus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus), etc. (cell) In some embodiments of the present invention, the present invention provides a cell comprising the engineered DEAR nucleic acid manipulation system of the present invention, the isolated polynucleotide of the present invention, the nucleic acid construct of the present invention, or the vector of the present invention. The cell can be any of a variety of cells, including, for example, in vitro cells, in vivo cells, ex vivo cells, primary cells, cancer cells, animal cells, plant cells, algae cells, fungal cells, and the like. In some embodiments, the cell is a recipient of the engineered DEAR nucleic acid manipulation system, isolated polynucleotide, nucleic acid construct or vector provided by the invention, which may also be referred to as a "host cell" or a "target cell." Host cells or target cells can be recipients of the engineered DEAR nucleic acid manipulation systems, isolated polynucleotides, nucleic acid constructs or vectors provided by the present invention. In some specific embodiments, non-limiting examples of cells include: prokaryotic cells, eukaryotic cells, bacterial cells, archaeal cells, cells of unicellular eukaryotic organisms, protozoan cells, cells from plants, algal cells, fungal cells, animal cells, cells from invertebrates, cells from vertebrates, cells from mammals (e.g., ungulates; rodents; non-human primates; humans; cats; dogs, etc.), etc. In some cases, the cell is a cell that is not derived from a natural organism (e.g., the cell can be a synthetic cell; also known as an artificial cell). Depending on the host / vector system utilized, any of a number of suitable transcription and / or translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, and the like may be used in the recombinant expression vector. Methods for introducing nucleic acids into host cells are known in the art, and any convenient method can be used to introduce nucleic acids (e.g., recombinant expression vectors, isolated polynucleotides, nucleic acid constructs, engineered DEAR nucleic acid manipulation systems provided by the present invention) into cells. Suitable methods include, for example, viral infection, transfection, liposome transfection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, direct microinjection, nanoparticle-mediated nucleic acid delivery, etc. <Reagents, Kits, Pharmaceutical Compositions> In some embodiments of the present invention, the present invention provides a reagent or kit comprising the engineered DEAR nucleic acid manipulation system described in the present invention, the isolated polynucleotide described in the present invention, the nucleic acid construct described in the present invention, the vector described in the present invention, or the cell described in the present invention. In some embodiments of the present invention, the present invention provides a pharmaceutical composition comprising the engineered DEAR nucleic acid manipulation system described in the present invention, the isolated polynucleotide described in the present invention, the nucleic acid construct described in the present invention, the vector described in the present invention, or the cell described in the present invention, and optionally, a pharmaceutically acceptable carrier. <Method and use of modifying target nucleic acid> The present invention provides a method for modifying a target nucleic acid, the method comprising the step of contacting the target nucleic acid with the engineered DEAR nucleic acid manipulation system of the present invention, the isolated polynucleotide of the present invention, the nucleic acid construct of the present invention, the vector of the present invention, the cell of the present invention, the reagent or the kit of the present invention. In some embodiments, the contacting results in modification of the target nucleic acid by the engineered DEAR nucleic acid manipulation system. The present invention provides uses of the engineered DEAR nucleic acid manipulation system, the isolated polynucleotide, the nucleic acid construct, the vector, and the cell of the present invention in modifying target nucleic acids or preparing reagents or kits for modifying target nucleic acids. In some specific embodiments, the modification is cleavage of the target nucleic acid.In some specific embodiments, the target nucleic acid is selected from the group consisting of: DNA, RNA, genomic DNA and extrachromosomal DNA. In some specific embodiments, the contacting occurs in vitro or in vivo. In some specific embodiments, the contacting occurs inside a cell or outside a cell. In some specific embodiments, the cell is a eukaryotic cell or a prokaryotic cell. In some more specific embodiments, the cell is selected from the group consisting of: plant cells, fungal cells, mammalian cells, reptile cells, insect cells, avian cells, fish cells, parasite cells, arthropod cells, invertebrate cells, vertebrate cells, rodent cells, mouse cells, rat cells, primate cells, non-human primate cells and human cells. In some more specific embodiments, said contacting results in genome editing. In some embodiments, the contacting comprises introducing the engineered DEAR nucleic acid manipulation system into a cell. Example The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. In Examples 1 to 7, the construction and effects of the original DEAR nucleic acid manipulation system are described. Example 1. Screening of RNA sequences for C-type second introns In order to screen C-type second-class introns, this embodiment uses 92 C-type second-class introns in public databases, and constructs sequence and structure covariance models for the RNA sequences of the conserved I-III domain and V-VI domain, respectively. And for the potential protein IEP, a hidden Markov model of its amino acid sequence characteristics is also constructed. Usually, the length of the C-type second-class intron will not exceed 4000nt, so a 4000bp recognition window is set in this embodiment. Potential C-type second-class introns need to meet the high-confidence I-III domain and V-VI domain within the range of 4000bp. If the IEP protein cannot be identified in the IV domain, it is regarded as a C-type second-class intron without ORF. Based on the above multiple covariance model, this example identified 5,684 C-type second-class introns in the Earth metagenome dataset. Active C-type second-class introns should have multiple highly similar copies in the same strain genome. Therefore, this example clustered highly similar candidate C-type second-class introns in the metagenome of the same genus, and identified a total of 469 potentially active C-type second-class introns with multiple copies. In order to screen stable ORF-free ribozymes, this example ranked candidate C-type second-class introns (GII-C introns) according to the predicted secondary structure thermal stability. At the same time, this example also used RNA secondary structure prediction to further screen candidate C-type second-class introns with conservative secondary structures in the substrate recognition region (TRS). At the same time, based on the literature (N. Toor, KSKeating, SDTaylor, AMPyle, Crystal structure of a self-spliced group II intron. Science 320, 77-82 (2008).), the C-type second intron Oceanobacillus iheyensis (Oi) intron with ORF was obtained, and its ORF region was deleted to obtain DEAR10 as shown in the following SEQ ID NO: 133. Finally, DEAR1 to 10 were selected as the DEAR nucleic acid manipulation system, and the substrate cleavage activity was verified. The secondary structure predictions of the selected DEAR1-10 (using RNAfold WebServer to predict RNA secondary structure: http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi) and their domain annotations are shown in Figures 1A to 1J. It can be seen that the secondary structures of DEAR1-10 are relatively similar, all consisting of domains I to VI, each domain exists in the form of a stem-loop structure and is naturally separated, and the programmable TRS regions are all located in the top ring region of domain I for recognizing nucleic acid substrates. The sequences of DEAR1-10 are shown in Table 1 below, where the underlined and bold parts are TRS. Table 1: Referring to Figures 1A to 1J, the secondary structures of DEAR1 to 10 are as follows: DEAR1 contains 6 domains (domains I to VI). Domain I contains 4 stem-loop / hairpin structures and the TRS sequence responsible for substrate recognition; domain II contains 2 stem-loop / hairpin structures; domain III contains 1 stem-loop / hairpin structure; domain IV contains 2 stem-loop / hairpin structures; domain V contains 1 stem-loop / hairpin structure, which contains the catalytic reaction core; domain VI contains 1 stem-loop / hairpin structure. DEAR2 contains 6 domains (domains I to VI). Domain I contains 3 stem-loop / hairpin structures and the TRS sequence responsible for substrate recognition; domain II contains 1 stem-loop / hairpin structure; domain III contains 1 stem-loop / hairpin structure; domain IV contains 4 stem-loop / hairpin structures; domain V contains 1 stem-loop / hairpin structure, which contains the catalytic reaction core; domain VI contains 1 stem-loop / hairpin structure. DEAR3 contains 6 domains (domains I to VI). Domain I contains 4 stem-loop / hairpin structures and the TRS sequence responsible for substrate recognition; domain II contains 2 stem-loop / hairpin structures; domain III contains 1 stem-loop / hairpin structure; domain IV contains 4 stem-loop / hairpin structures; domain V contains 1 stem-loop / hairpin structure, which contains the catalytic reaction core; domain VI contains 1 stem-loop / hairpin structure. DEAR4 contains 6 domains (domains I to VI). Domain I contains 6 stem-loop / hairpin structures and the TRS sequence responsible for substrate recognition; domain II contains 3 stem-loop / hairpin structures; domain III contains 1 stem-loop / hairpin structure; domain IV contains 3 stem-loop / hairpin structures; domain V contains 1 stem-loop / hairpin structure, which contains the catalytic reaction core; domain VI contains 1 stem-loop / hairpin structure. DEAR5 contains 6 domains (domains I to VI). Domain I contains 4 stem-loop / hairpin structures and the TRS sequence responsible for substrate recognition; domain II contains 2 stem-loop / hairpin structures; domain III contains 1 stem-loop / hairpin structure; domain IV contains 2 stem-loop / hairpin structures; domain V contains 1 stem-loop / hairpin structure, which contains the catalytic reaction core; domain VI contains 1 stem-loop / hairpin structure. DEAR6 contains 6 domains (domains I to VI). Domain I contains 6 stem-loop / hairpin structures and the TRS sequence responsible for substrate recognition; domain II contains 1 stem-loop / hairpin structure; domain III contains 1 stem-loop / Hairpin structure; domain IV contains 3 stem-loop / hairpin structures; domain V contains 1 stem-loop / hairpin structure, which contains the catalytic reaction core; domain VI contains 1 stem-loop / hairpin structure. DEAR7 contains 6 domains (domains I to VI). Domain I contains 4 stem-loop / hairpin structures and the TRS sequence responsible for substrate recognition; domain II contains 2 stem-loop / hairpin structures; domain III contains 1 stem-loop / hairpin structure; domain IV contains 2 stem-loop / hairpin structures; domain V contains 1 stem-loop / hairpin structure, which contains the catalytic reaction core; domain VI contains 1 stem-loop / hairpin structure. DEAR8 contains 6 domains (domains I to VI). Domain I contains 5 stem-loop / hairpin structures and the TRS sequence responsible for substrate recognition; domain II contains 2 stem-loop / hairpin structures; domain III contains 1 stem-loop / hairpin structure; domain IV contains 3 stem-loop / hairpin structures; domain V contains 1 stem-loop / hairpin structure, which contains the catalytic reaction core; domain VI contains 1 stem-loop / hairpin structure. DEAR9 contains 6 domains (domains I to VI). Domain I contains 4 stem-loop / hairpin structures and the TRS sequence responsible for substrate recognition; domain II contains 2 stem-loop / hairpin structures; domain III contains 1 stem-loop / hairpin structure; domain IV contains 1 stem-loop / hairpin structure; domain V contains 1 stem-loop / hairpin structure, which contains the catalytic reaction core; domain VI contains 1 stem-loop / hairpin structure. DEAR10 contains 6 domains (domains I to VI). Domain I contains 4 stem-loop / hairpin structures and TRS sequences responsible for substrate recognition; domain II contains 2 stem-loop / hairpin structures; domain III contains 1 stem-loop / hairpin structure; domain IV contains 1 stem-loop / hairpin structure and 1260nt ORF region (deleted in DEAR10); domain V contains 1 stem-loop / hairpin structure, which contains the catalytic reaction core; domain VI contains 1 stem-loop / hairpin structure. Example 2. RNA preparation method First, the DNA sequences corresponding to DEAR1 to 10 screened in Example 1 were synthesized, and T7 promoter (TAATACGACTCACTATA; SEQ ID NO: 19) was added upstream of each DEAR by PCR. The PCR amplification products were purified using DNA purification magnetic beads (VAHTS DNA Clean Beads, Vazyme, catalog number N411-01), and the products were used as templates for in vitro transcription (IVT). The in vitro transcription reaction was carried out in 30mM Tris pH 8.1, 25mM MgCl2, 0.01% Triton X-100, 2mM spermidine, 5mM DTT, and NTP was added, 5mM each. RNase inhibitor (Promega, catalog number N2111) and T7 RNA polymerase (NEB, catalog number M0251S) were added according to the instructions of the reagent supplier. After 4 hours of reaction at 37°C, DNase I (Promega, Catalog No. M6101) digestion and proteinase K (Biyuntian, Catalog No. ST533) digestion were performed in sequence to remove the DNA template and protein, and then the transcription product was washed and concentrated using a concentrator tube with a molecular weight cutoff range of 100 kDa. 8% Urea-PAGE was used for electrophoresis to detect the quality of RNA. The specific results are shown in Figures 2A and 2B, and it can be seen that 10 ribozyme RNAs were successfully prepared. Compared with RNAs of known length, it was found that the size of each RNA ribozyme was consistent with its theoretical length. Example 3. Cleavage of single-stranded RNA, DNA and plasmids in vitro using the DEAR nucleic acid manipulation system 1. DEAR Nucleic Acid Manipulation System for Single-Stranded RNA Cleavage in Vitro According to the sequence shown in Table 2 below, a single-stranded RNA (ssRNA) substrate with a DEAR target sequence was synthesized (the underlined and bold parts are the target sequences recognized by DEAR), and the 3' end of each single-stranded RNA substrate was labeled with -Cy5. Each DEAR (1.5 μM) was incubated with a single-stranded RNA (100 nM) substrate for 1 hour under the conditions of 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, and 50°C for reaction. After terminating the reaction, Urea-PAGE electrophoresis was used, and the gel fluorescence signal was scanned on a fluorescence imager. The results are shown in Figure 3. As shown in Figure 3, the products obtained by cutting ssRNA are at the bottom, and it can be seen that DEAR1 to DEAR9 can all cause cutting of single-stranded RNA. In Figure 3, I represents the input ssRNA and C represents the cutting product. Table 2: 2. Verification of ssRNA targeting region of DEAR nucleic acid manipulation system DEAR1-6 (1.5 μM each) were incubated with a single-stranded RNA (100 nM) substrate that cannot pair with the TRS region (the substrate used by DEAR1 is the sequence shown in SEQ ID NO: 21; the substrate used by DEAR2 is the sequence shown in SEQ ID NO: 23; the substrate used by DEAR3 is the sequence shown in SEQ ID NO: 23; the substrate used by DEAR4 is the sequence shown in SEQ ID NO: 22; the substrate used by DEAR5 is the sequence shown in SEQ ID NO: 21; the substrate used by DEAR6 is the sequence shown in SEQ ID NO: 23) in the presence of 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, The reaction was incubated under the conditions of , and samples were taken at different time points (0min, 5min, 10min, 30min, 60min, 120min). After the reaction was terminated, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned on a fluorescence imager. The gel image result is shown in Figure 4. As shown in Figure 4, the product obtained by cutting ssRNA is below the substrate, and cannot be cut when the substrate cannot be paired with the TRS region. 3. DEAR Nucleic Acid Manipulation System for In Vitro Single-Stranded DNA Cleavage According to the sequences shown in Table 3, single-stranded DNA (ssDNA) substrates with target sequences corresponding to DEAR1 to 6 were synthesized (the underlined and bold parts are target sequences recognized by DEAR), and their 3' ends were labeled with -Cy5. Then, each DEAR (1.5 μM) and the corresponding single-stranded DNA (100 nM) substrate were mixed in 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, The reaction was incubated under the conditions of , and samples were taken at different time points (0min, 5min, 10min, 20min, 40min, 60min, 120min, 0-2h in the figure). After the reaction was terminated, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned on a fluorescence imager. The gel image and efficiency curve results are shown in Figure 5. As shown in Figure 5, the product obtained by cutting ssDNA is below the substrate, and it can be seen that DEAR1~DEAR6 can all cut single-stranded DNA. Table 3: 4. Verification of ssDNA targeting region of DEAR nucleic acid manipulation system Each of DEAR1 to 6 (1.5 μM) was respectively mixed with single-stranded DNA (100 nM) substrates that can and cannot pair with the TRS region (the substrates used by DEAR1 are sequences shown in SEQ ID NO:29 and SEQ ID NO:30, respectively; the substrates used by DEAR2 are sequences shown in SEQ ID NO:30 and SEQ ID NO:32, respectively; the substrates used by DEAR3 are sequences shown in SEQ ID NO:31 and SEQ ID NO:32, respectively; the substrates used by DEAR4 are sequences shown in SEQ ID NO:32 and SEQ ID NO:31, respectively; the substrates used by DEAR5 are sequences shown in SEQ ID NO:33 and SEQ ID NO:30, respectively; the substrates used by DEAR6 are sequences shown in SEQ ID NO:34 and SEQ ID NO:32, respectively) in 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, The reaction was incubated for 1 hour under the conditions of . After the reaction was terminated, Urea-PAGE electrophoresis was performed and the gel fluorescence signal was scanned on a fluorescence imager. The gel image results are shown in Figure 6. As shown in Figure 6, T represents a paired substrate, T* represents a cleavage product of a paired substrate, N represents an unpaired substrate, N* represents a cleavage product of an unpaired substrate, and M represents a marker. The product obtained by cleaving ssDNA is below the substrate. It can be seen that DEAR1 to DEAR6 can all cause cleavage of single-stranded DNA, and the substrate cannot be cleaved when it cannot be paired with the TRS region. 5. Verification of ssDNA cleavage sites in the DEAR nucleic acid manipulation system According to the sequences shown in Table 4, single-stranded DNA (ssDNA) substrates with target sequences corresponding to DEAR1 to 6 were synthesized (the underlined and bold parts are target sequences recognized by DEAR), and the 3' end of each DEAR (1.5 μM) and the corresponding single-stranded DNA (100 nM) substrate were then mixed in 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, The reaction was incubated for 24 hours under the conditions of . After the reaction was terminated, Urea-PAGE electrophoresis was performed and the gel fluorescence signal was scanned on a fluorescence imager. The gel image is shown in Figure 7. As shown in Figure 7, the larger triangle indicates the main cleavage site, the smaller triangle indicates the secondary cleavage site, I indicates the input substrate, Dr1~6 indicates the cleavage product of DEAR1~6, L is the ladder generated by random digestion of ssDNA using DNase I (Promega, Catalog No. M6101), which is used to indicate the product length, M indicates a marker, and the product obtained by cutting ssDNA is below the substrate. It can be seen that the main cleavage site is located 0-1nt downstream of the 3' end of the TRS pairing region. Table 4: 6. Optimization of DNA cleavage conditions for DEAR1 DEAR1 (1.5 μM) and single-stranded DNA 1X-DEAR1 (SEQ ID NO: 35; 100 nM) substrate were incubated under different concentrations of monovalent and divalent ions and temperatures for reaction, and samples were taken at different time points (0 min, 5 min, 10 min, 20 min, 40 min, 1 h, 2 h, 4 h, 8 h, 12 h, 24 h). After terminating the reaction, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned on a fluorescence imager. The gel image and efficiency curve results are shown in Figures 8 and 9. As shown in Figures 8 and 9, the product obtained by cutting DNA is below the substrate, and it can be seen that DEAR1 prefers K +, and the lower the concentration, the stronger the activity, which is different from the previously reported second-class introns (N.Toor, KSKeating, SDTaylor, AMPyle, Crystal structure of a self-spliced group II intron. Science 320, 77-82 (2008); C.Quiroga, PHRoy, D.Centron, The S.ma.I2 class C group II intron inserts at integron attC sites. Microbiology (Reading) 154, 1341-1353 (2008).). In addition, DEAR1 is active at higher Mg 2+ The stronger the activity under the conditions. It is active under the conditions of The specific reaction conditions are as follows: A in Figure 8, 150mM KCl, 10 / 50 / 125mM MgCl2, 40mM MOPS 7.5, Figure 8B, 10 / 150 / 500 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, 37°C; Figure 8C, 10 / 150 / 500 mM NH4Cl, 50 mM MgCl2, 40 mM MOPS 7.5, D in Figure 8, 10 / 150 / 500 mM NaCl, 50 mM MgCl2, 40 mM MOPS 7.5, E in Figure 8, 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, 7. Comparison of DNA cleavage efficiency between DEAR1 and RNA-guided proteases DEAR1 (1.5 μM) and single-stranded DNA 1X-DEAR1 (SEQ ID NO: 35; 100 nM) substrate were mixed in 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, The reaction was incubated under the conditions and samples were taken at different time points (0min, 10min, 30min, 1h, 2h, 4h, 8h, 16h). For the CRISPR-Cas nuclease system used, the reaction system was configured with a ratio of RNP:DNA=15:1 according to the methods described in A.Sun et al., The compact Caspi(Cas12l)'bracelet'provides a unique structural platform for DNA manipulation. Cell Res 33, 229-244(2023), CATsuchida et al., Chimeric CRISPR-CasX enzymes and guide RNAs for improved genome editing activity. Mol Cell 82, 1199-1209 e1196(2022) and M.Jinek et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821(2012)., and samples were taken at different time points (0min, 10min, 30min, 1h, 2h, 4h, 8h, 16h). After the reaction was terminated, Urea-PAGE electrophoresis was performed and the gel fluorescence signal was scanned on a fluorescence imager. The gel image and efficiency curve results are shown in Figure 10. As shown in Figure 10, the product obtained by cutting DNA is below the substrate, and it can be seen that the cutting efficiency of DEAR1 is close to SpyCas9 and AbCasπ1, and higher than PlmCasX. 8. In vitro plasmid cleavage using the DEAR nucleic acid manipulation system A plasmid with a target sequence corresponding to DEAR1 (TGTCTTAAGACA; SEQ ID NO: 41) was designed and synthesized (the backbone was the commercially available pUC19 plasmid from addgene, Plasmid #50005). DEAR1 (1.5 μM) and plasmid substrate (0.03 μM) were mixed in 150 mM KCl, 10 mM MgCl2, 40 mM MOPS 7.5, The reaction was incubated under the conditions of , and samples were taken at different time points (0h, 3h, 8h, 24h). After the reaction was terminated, agarose gel electrophoresis was used, and the gel image was obtained by shooting on a UV imager. The results are shown in Figure 11, where L indicates that the plasmid treated with EcoRI (NEB, Catalog No. R0101V) is in a linear double-stranded state; OC indicates that the plasmid treated with Nt.BspQI (NEB, Catalog No. R0644S) is in an open ring state; SC indicates that the untreated plasmid is in a supercoiled state; 0, 3, 8, and 24 represent the time (in hours) for DEAR1 to cut the plasmid. Referring to Figure 11, the substrate plasmid is in a supercoiled state, and the product obtained by the cutting reaction is in an open ring state. Above the substrate, it can be seen that DEAR1 can cut the plasmid. 9. DEAR10 in vitro single-stranded RNA cleavage The RNA substrate sequence used in this experiment (RNA-DEAR10) is: ACCCACUGUUAUCCGACGACGAGC (same as RNA-DEAR5SEQ ID NO:24) DEAR10 RNA (1.5 μM) and single-stranded RNA substrate (100 nM, SEQ ID NO: 24) were mixed in 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, The reaction was incubated for 1 hour under the conditions of . After the reaction was terminated, Urea-PAGE electrophoresis was performed and the gel fluorescence signal was scanned on a fluorescence imager. The results are shown in FIG31 . As shown in FIG31 , the product obtained by cutting ssRNA is at the bottom, and it can be seen that DEAR10 can cut single-stranded RNA. 10. DEAR10 in vitro single-stranded DNA cleavage The DNA substrate sequence used in this experiment (5X-DEAR10) is: (Same as 5X-DEAR5 SEQ ID NO: 33) DEAR10 RNA (1.5 μM) and the corresponding single-stranded DNA substrate (100 nM, SEQ ID NO: 33) were mixed in 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, The reaction was incubated under the conditions of , and samples were taken at different time points (0min, 5min, 10min, 20min, 40min, 60min, 120min, shown as 0-2h in the figure). After the reaction was terminated, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned on a fluorescent imager. The gel image result is shown in Figure 32. As shown in Figure 32, the product obtained by cutting ssDNA is below the substrate, which shows that DEAR10 can cut single-stranded DNA. 11. Verification of ssDNA targeting region by DEAR10 DEAR10 (1.5 μM) was incubated with single-stranded DNA (100 nM) substrates that could and could not pair with its TRS region (sequences shown in SEQ ID NO:33 and SEQ ID NO:30, respectively) in 500 mM NH4Cl, 125 mM MgCl2, 40 mM MOPS 7.5, The reaction was incubated for 1 hour under the conditions of . After the reaction was terminated, Urea-PAGE electrophoresis was performed and the gel fluorescence signal was scanned on a fluorescence imager. The gel image results are shown in Figure 33. The product obtained by cutting ssDNA is below the substrate. It can be seen that DEAR10 can cut single-stranded DNA, and the substrate cannot be cut when it cannot pair with the TRS region. Example 4. Plasmid interference in E. coli cells 1. Construction of targeting plasmid The ccdB toxic gene inducible expression plasmid with the corresponding target sequences of DEAR1-3 at the plasmid replication origin (ori) was used as the targeting plasmid (addgene sequence number: 69056). 2. Construction of DEAR expression plasmid In the DEAR expression plasmid, the J23119 promoter (its specific sequence is (SEQ ID NO: 42): TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT) is used to promote the expression of each DEAR sequence. The construction method is as follows: the J23119 promoter is connected to DEAR1 to 3 respectively, and then the entire sequence of DEAR1 to 3 connected to the J23119 promoter is inserted into the pCDFDuet1 plasmid vector (Novagen catalog number: 71340-3) by homologous recombination, respectively, replacing the entire sequence of the plasmid 410 to 3765 interval. 3. Construction of CRISPR-Cas nuclease system In the CRISPR-Cas nuclease expression plasmid, the Trc promoter (its specific sequence is (SEQ ID NO: 43): TTGACAATTAATCATCCGGCTCGTATAATG) is used to start the expression of the Cas9 nuclease, and the J23119 promoter (its specific sequence is the same as above) is used to start the expression of its corresponding guide nucleic acid (sgRNA) sequence. Among them, the sgRNA expressed by the positive control group (marked as PC in Figure 12, i.e., PC group) contains a 20-base target sequence (its specific sequence is (SEQ ID NO: 44): GCGATAAGTCGTGTCTTACC), and cuts the targeted plasmid under the guidance of sgRNA; the sgRNA expressed by the negative control group (marked as NC in Figure 12, i.e., NC group) does not contain a 20-base target sequence and cannot cut the targeted plasmid. The construction method is as follows: after the Trc promoter is connected to the Cas9 sequence, the J23119 promoter is connected to the sgRNA, and then the Trc-Cas9-J23119-sgRNA sequence is inserted into the pCDFDuet1 plasmid vector (Novagen catalog number: 71340-3) by homologous recombination, replacing the entire sequence in the 410-3765 interval of the plasmid. 4. Plasmid interference detection in E. coli cells The targeting plasmid in step 1 and the different expression plasmids constructed in steps 2 and 3 (DEAR1-3 expression plasmids, CRISPR-Cas nuclease system expression plasmids) were combined and introduced into Escherichia coli BW25141 strain (CGSC strain preservation number: 7635). After a certain period of culture, the bacterial solution samples were cultured on plates containing ccdB inducer (10mM arabinose, Biotechnology Product Number: A610071) and targeting plasmid resistance plates (ampicillin). Referring to A in Figure 12, when the bacteria only contain the targeting plasmid, they can survive and show plaques on the ampicillin plate, but cannot grow on the ccdB induced expression plate (BC group); the death and live conditions of the plaques are basically consistent with those of the expression plasmid that does not cut the targeting plasmid (NC group, expressing Cas9 without cutting ccdB). When the expression plasmid cuts the targeted plasmid (PC group, expressing Cas9 to cut ccdB; DEAR1~DEAR3 groups: expressing the corresponding intron RNA sequences respectively), the ccdB toxic gene cannot be expressed normally, so that the bacteria can survive on the ccdB induction expression plate; at the same time, the bacteria lose the ampicillin resistance due to the cutting of the targeted plasmid and die on the ampicillin plate. The results of bacterial plate coating and the analysis of ccdB gene expression levels showed that DEAR1~DEAR3 can all cut the plasmid in E. coli cells. 5. Further verification of plasmid interference in DEAR1 E. coli cells The DEAR1 expression plasmid was subjected to PCR using primers GGATGAGTTTGCAAACAAAGTCCTTTCTGCCG (SEQ ID NO: 45) and AGGACTTTGTTTGCAAACTCATCCAATGATACCTAGC (SEQ ID NO: 46) and the ΔTRS mutant expression plasmid was constructed by homologous recombination, denoted as Dr1_ΔTRS (DEAR1 expression plasmid constructed by deleting 6 nucleotides of TRS sequence), as one of the expression plasmids; Use primers for the plasmid used for the NC group in step 3: AGTACAGCATCGGCCTGGCCATCGGCACCAACTCTGTGG (SEQ ID NO: 47); and GGCCAGGCCGATGCTGTACTTCTTGTCAGAACCGTGGTGA (SEQ ID NO: 48) were used for PCR. The PCR products were further PCR-polymerized with primers: CCGACTACGATGTGGACGCCATCGTGCCTCAGAGCTTTC (SEQ ID NO: 49) and GGCGTCCACATCGTAGTCGGACAGCCGGTTGATGTCC (SEQ ID NO: 50) were subjected to PCR and constructed by homologous recombination with a dCas9 expression plasmid (all 2 enzyme cleavage active centers of Cas9 were mutated and inactivated), denoted as dCas9, as one of the expression plasmids; Use primers for the plasmid used in the PC group in step 3: CCGACTACGATGTGGACGCCATCGTGCCTCAGAGCTTTC (SEQ ID NO: 49) and GGCGTCCACATCGTAGTCGGACAGCCGGTTGATGTCC (SEQ ID NO: 50) were subjected to PCR, and the nCas9 expression plasmid (one enzyme cleavage active center H840 of Cas9 was mutated and inactivated) was constructed by homologous recombination, denoted as nCas9, as one of the expression plasmids; The plasmid used in the PC group in step 3 was used as the wtCas9 expression plasmid without modification. The targeting plasmid constructed in step 1 and the above-mentioned different expression plasmids (dCas9, nCas9, wtCas9, Dr1_ΔTRS, and the DEAR1 expression plasmid used in step 2) were combined and introduced into the Escherichia coli BW25141 strain (CGSC strain preservation number: 7635). After a certain period of culture, the bacterial solution sample was cultured on the targeting plasmid resistance plate (ampicillin). Referring to Figure 13, when the bacteria only contain the targeting plasmid, they can survive and show plaques on the ampicillin plate (Blank group); the death and life of the plaques expressing dCas9 and the DEAR expression plasmid Dr1_ΔTRS without TRS are basically the same. The DEAR1 expression plasmid cuts the targeting plasmid, which is basically consistent with the results of expressing nCas9 and wtCas9. The bacteria die on the ampicillin plate because the targeting plasmid is cut and the ampicillin resistance is lost. The results of bacterial plate spreading and analysis of AmpR gene expression levels showed that DEAR1 can cut the plasmid in Escherichia coli cells through the TRS region. Example 5. Plasmid interference detection of DEAR4-9 in E. coli cells 1. Construction of targeting plasmid A ccdB toxic gene inducible expression plasmid with the corresponding intron RNA targeting sequences of DEAR1 and DEAR4-9 at the plasmid replication origin site (ori) was used as the targeting plasmid (addgene sequence number: 69056). 2. Construction of other DEAR expression plasmids Basically the same method as in Example 4, in the DEAR expression plasmid, the J23119 promoter (its specific sequence is (SEQ ID NO: 42): TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT) is used to promote the expression of each DEAR sequence. The construction method is as follows: the J23119 promoter is connected to Dr1_ΔTRS, DEAR1, DEAR4-9 (wherein, Dr1_ΔTRS and DEAR1 are the same as in Example 4), and then the sequences of Dr1_ΔTRS, DEAR1, and DEAR4-9 connected to the J23119 promoter are inserted into the pCDFDuet1 plasmid vector (Novagen catalog number: 71340-3) by homologous recombination, respectively, and the sequences of the plasmid 410-3765 interval are replaced as a whole. 3. Plasmid interference detection in E. coli cells Basically the same method as in Example 4, the targeting plasmid in step 1 and the different expression plasmids constructed in step 2 (Dr1_ΔTRS, DEAR1, DEAR4-9 expression plasmids) were combined and introduced into Escherichia coli BW25141 strain (CGSC strain deposit number: 7635), and after a certain period of culture, the bacterial solution samples were cultured on the plates containing the targeting plasmid resistance (ampicillin). Referring to Figure 14, when the expression plasmids transferred did not cut the targeting plasmids (Dr1_ΔTRS, DEAR4, DEAR6, DEAR7, DEAR8 and DEAR9 groups: respectively expressing the corresponding intron RNA sequences), the plaques survived; when the expression plasmids cut the targeting plasmids (DEAR1, DEAR5 groups: respectively expressing the corresponding intron RNA sequences), the bacteria died on the ampicillin plate because the targeting plasmids were cut and lost the ampicillin resistance. The results of bacterial plate spreading and analysis of Amp gene expression levels showed that DEAR1 and DEAR5 could cut plasmids in E. coli cells, while DEAR4, 6, 7, 8 and 9 had no plasmid cutting activity in E. coli cells. Example 5-1. In vitro cleavage of plasmids by the DEAR nucleic acid manipulation system The ccdB toxic gene inducible expression plasmid (addgene sequence number: 69056) with the corresponding target sequences of DEAR1-6 and DEAR10 was used as the plasmid substrate for in vitro cleavage experiments. DEAR1-6 and DEAR10 (1.5 μM) and plasmid substrate (0.03 μM) were respectively added to 150 mM KCl, 10 mM MgCl2, 40 mM MOPS 7.5, The reaction was incubated under the conditions of , and samples were taken at different time points (0h, 3h, 8h, 24h). After the reaction was terminated, agarose gel electrophoresis was used, and the gel image was obtained by photographing on a UV imager. The results are shown in Figure 35, where L indicates that the plasmid treated with EcoRI (NEB, Catalog No. R0101V) is in a linear double-stranded state; OC indicates that the plasmid treated with Nt.BspQI (NEB, Catalog No. R0644S) is in an open ring state; SC indicates that the untreated plasmid is in a supercoiled state; 0, 3, 8, and 24 represent the time (in hours) for using DEAR to cut the plasmid. Referring to Figure 35, the substrate plasmid is in a supercoiled state, and the product obtained by the cutting reaction is in an open ring state. Above the substrate, it can be seen that DEAR1~6 and DEAR10 can both cut the plasmid. Example 5-2. Toxicity test of the DEAR nucleic acid manipulation system in Escherichia coli In order to exclude the influence of the DEAR nucleic acid manipulation system itself on the growth rate of E. coli, this example uses turbidimetry to determine the growth curve of E. coli. Take 50 ng of Blank, dCas9, Cas9, Dr1_△TRS and DEAR1 expression plasmids (same as Example 4) respectively, and chemically transform E. coli BW25141 competent cells. Add plasmids to competent cell suspension and mix well, incubate on ice for 30 minutes; incubate in 42℃ water bath for 60 seconds, and ice bath for 2 minutes; add 1 mL of liquid LB medium, The cells were cultured and revived in a constant temperature shaker at 220 rpm for 1 h. After recovery, the cells were coated with LB plates containing streptomycin (50 ng / mL) and placed in a constant temperature incubator. Invert and culture for 16 hours. Pick a single clone from the plate, transfer to 1 mL of liquid LB medium, and place in a constant temperature shaker. Culture at 220 rpm for about 3 to 6 hours. Take 2 μL of bacterial solution each time and measure the OD600 value with Nanodrop one micro-spectrophotometer to reach 0.5 to 0.6. Take 1 OD (OD600 = 0.6) of bacterial solution and transfer it into 100 mL of liquid LB medium and shake it in a constant temperature incubator. The cells were cultured at 220 rpm. At 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 h of culture, 2 μL of bacterial solution was taken and the OD600 value was measured using a Nanodrop one micro-spectrophotometer. The bacterial growth curve was drawn using Graphpad 6.0 with the time point as the horizontal axis and the OD600 value as the vertical axis. As shown in Figure 36, the expression of Dr1_△TRS and DEAR1 had almost no effect on the growth of E. coli. Example 6. Reprogramming TRS DEAR to cleave new DNA sites According to the sequence shown in Table 5, a single-stranded DNA substrate with a new DEAR target sequence was synthesized (the underlined and bold parts are the target sequences recognized by DEAR), and its 3' end was labeled with -Cy5. DEAR1-6 (1.5 μM) with the TRS sequence changed to CGAUAG were all mixed with this single-stranded DNA (100 nM) substrate in 50 mM MgCl2, 10 mM KCl, 40 mM MOPS 7.5, The reaction was incubated for 8 hours under the conditions of . After terminating the reaction, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned on a fluorescence imager. The results are shown in Figure 15. As shown in Figure 15, the products obtained by cutting ssDNA are below the substrate, and it can be seen that DEAR1~DEAR6 can cut the new single-stranded DNA. In Figure 15, I represents the input ssDNA substrate, and Dr1*-Dr6* represent the cutting products of DEAR1~6 on ssDNA after changing TRS. Table 5: DEAR10 (1.5 μM) with a reprogrammed TRS in which the TRS sequence of DEAR10 was changed to CGAUAG was incubated with a single-stranded DNA substrate (100 nM, SEQ ID NO: 51) with a corresponding new target sequence at 50 mM MgCl2, 10 mM KCl, 40 mM MOPS 7.5, and 37°C for 8 h for reaction. After terminating the reaction, Urea-PAGE electrophoresis was performed, and the gel fluorescence signal was scanned on a fluorescent imager. The results are shown in Figure 34. As shown in Figure 34, the product obtained by cutting ssDNA is below the substrate, and it can be seen that DEAR10 with a reprogrammed TRS can cut the new single-stranded DNA. In Figure 34, I represents the input ssDNA substrate, and Dr10* represents the cutting product of ssDNA by DEAR10 after changing TRS. Example 7. Genomic DNA cleavage in mammalian cells-1 1. Construction of stable transfection plasmid Using PiggyBac TM Transposon Vector System (from System Biosciences) constructs DEAR1 targeting sequence stable transfection plasmid and DEAR stable transfection plasmid: (1) Construction of a stable transfection plasmid containing the DEAR1 targeting sequence: The sequence of the puromycin resistance (PuroR) gene with a frameshift containing the DEAR1 targeting sequence at the N-terminus: (SEQ ID NO:52, wherein capital letters are DEAR1 targeting sequences, and letters in bold and underlined are The site that DEAR1 can specifically recognize and cut, DEAR1 can cut the sense and antisense strands of the site to cause double-strand breaks, the lowercase letters are PuroR genes), and the XbaI restriction site in the multi-cloning site of the PiggyBac Dual promoter PB513B-1 plasmid is inserted by homologous recombination, and the blasticidin resistance (Blasticidine S-deaminase) gene is inserted by homologous recombination: atggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcg cagctctctctagcgacggccgcatcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgct gcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccctgcggacggtgccgacaggtgcttctcgatctgca tcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgtggggagggctaa(SEQ ID NO:53) is inserted between the NcoI and SalI restriction sites. (2) Construction of DEAR stable transfection plasmid: The DEAR1 sequence initiated by U6 promoter and terminated by TTTTTTTT signal was respectively: (SEQ ID NO:54, the uppercase, bold and underlined letters are the U6 promoter sequence, the uppercase, non-bold and underlined letters are the DNA sequence corresponding to DEAR1, and the lowercase letters are the transcription termination signal and part of the vector backbone sequence), or, the DEAR-NT sequence initiated by U6 promoter and terminated by TTTTTTTT signal: (SEQ ID NO:55, the letters in uppercase, bold and underlined are U6 promoter sequence, the letters in uppercase, not in bold and underlined are DEAR-NT (DNA sequence corresponding to DEAR2) sequence, and the lowercase letters are transcription termination signal and part of vector backbone sequence) were inserted between SfiI and MluI restriction sites in PiggyBac Dual promoter PB513B-1 plasmid by homologous recombination, and the hygromycin resistance (HygBR) gene was respectively inserted by homologous recombination: 2. Stable transfection and resistance screening and enrichment of DEAR targeting sequence and DEAR exist HEK-293T (ATCC CRL-11268) cells were cultured in DMEM high glucose medium containing 10% fetal bovine serum to the logarithmic phase under 5% CO2 conditions, digested with 0.25% trypsin, washed twice with PBS (pH 7.0-7.2), and resuspended in Opti-MEM TM (Gibco, Catalog No.: 31985070) culture medium, and adjust the cell density to 5×10 4 / μL, add 2μg Integration PB transposase plasmid (System Biosciences) and 2μg DEAR1 targeting sequence stable plasmid to 20μL cell suspension, electroporate the cell suspension at 450V (Celetrix biotechnologies, model: LE+), add the electroporated cells to DMEM high-glucose medium containing 10% fetal bovine serum, replace the medium with 10μg / mL Blasticidin medium 24h after electroporation, screen for one week, pass the cells according to the cell growth status, and obtain the stable cell line containing DEAR1 targeting sequence after the cell state is stable. Use the same method to electroporate 2μg Integration PB into the stable cell line containing DEAR1 targeting sequence. Transposase plasmid (System Biosciences) and 2 μg DEAR stable plasmid (DEAR1 stable plasmid or DEAR-NT stable plasmid), after electroporation for 24 hours, the culture medium was replaced with a culture medium containing 50 μg / mL Hygromycin B, and drug selection was performed for one week, during which the cells were passaged according to their growth status. After the cells were stable, the culture medium was replaced with a culture medium containing 10 μg / mL Puromycin, and drug selection was performed for one week. For the stable cell lines containing the DEAR1 targeting sequence, the PuroR gene integrated in the cells is in a frameshift state and cannot express the correct protein, thus not having resistance to Puromycin. DEAR1 (DEAR1 stable plasmid) can cut the DEAR1 targeting sequence to cause DNA double-strand breaks, and the insertion or deletion mutation introduced by the break repair can restore the frameshifted PuroR gene to normal expression, resulting in cell survival under Puromycin screening; while DEAR-NT (DEAR-NT stable plasmid) cannot cut the DEAR1 targeting sequence, and the cells cannot express the correct PuroR gene, resulting in cell death under Puromycin screening. As shown in Figure 16, cells stably transfected with DEAR1 (DEAR1 stable plasmid) survived while cells stably transfected with DEAR-NT (DEAR-NT stable plasmid) died. 3. Next-generation sequencing verifies DEAR1 cleavage of genomic DNA in mammalian cells For the surviving cells in Figure 16 (stable transfection of DEAR1, i.e., stable transfection of DEAR1 stable transfection plasmid), the genome was extracted and the DEAR1 targeted sequence was subjected to second-generation sequencing library construction using TIANSeq Fast DNA Library Kit (Illumina), and the second-generation sequencing was performed by Novogene. The second-generation sequencing data was analyzed online using the CRISPResso2 website, and the results are shown in Figure 17A. 47.14% of the Reads had mutations, and Figure 17B is a sequence alignment of the Reads near the first and second cleavage sites in the DEAR1 targeted sequence. Both insertion and deletion mutations occurred near the DEAR1 cleavage site (dashed line position in the figure). The sequencing data show that DEAR1 has the activity of specifically cutting genomic double-stranded DNA in mammalian cells. Example 7-1. Genomic DNA cleavage in mammalian cells-2 1. Construction of stable transfection plasmid Using PiggyBac TM Transposon Vector System (from System Biosciences) constructs DEAR1 targeting sequence stable transfection plasmid and DEAR stable transfection plasmid: (1) Construction of a stable transfection plasmid containing the DEAR1 targeting sequence: The sequence of the puromycin resistance (PuroR) gene with a frameshift containing the DEAR1 targeting sequence at the N-terminus: (SEQ ID NO:52, wherein the capital letters are DEAR1 targeting sequences, wherein the letters in bold and underline are targeting sites that DEAR1 can specifically recognize and cut, DEAR1 can cut the sense and antisense strands of these three sites (Target 1-3) to cause double-strand breaks, the lowercase letters are PuroR genes, and in this sequence, PuroR is 148 bp away from the translation start site ATG, so it is in a frameshift state), the XbaI restriction site in the multiple cloning site of the PiggyBac Dual promoter PB513B-1 plasmid was inserted by homologous recombination, and the blasticidin resistance (Blasticidine S-deaminase) gene was inserted by homologous recombination: atggccaagcctttgtctcaagaagaatccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactacagcgtcgccagcg cagctctctctagcgacggccgcatcttcactggtgtcaatgtatatcattttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgct gcggcagctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccctgcggacggtgccgacaggtgcttctcgatctgca tcctgggatcaaagccatagtgaaggacagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgtggggagggctaa(SEQ ID NO:53) is inserted between the NcoI and SalI restriction sites. (2) Construction of DEAR stable transfection plasmid: The DEAR1 sequence initiated by U6 promoter and terminated by TTTTTTTT signal was respectively: (SEQ ID NO:54, the uppercase, bold and underlined letters are the U6 promoter sequence, the uppercase, non-bold and underlined letters are the DNA sequence corresponding to DEAR1, and the lowercase letters are the transcription termination signal and part of the vector backbone sequence), or, the DEAR1-NT sequence initiated by U6 promoter and terminated by TTTTTTTT signal: (SEQ ID NO: 134, the letters in uppercase, bold and underlined are U6 promoter sequence, the letters in uppercase, not in bold and underlined are DEAR1-NT (non-targeting control, i.e., the TRS sequence of DEAR1 is changed to TAAGGT shown in italics, so that it cannot target and cut the original DEAR1 targeting sequence) sequence, and the lowercase letters are transcription termination signals and part of the vector backbone sequence) were inserted between the SfiI and MluI restriction sites in the PiggyBac Dual promoter PB513B-1 plasmid by homologous recombination, and the hygromycin resistance (HygBR) gene was respectively inserted by homologous recombination: 2. Stable transfection and resistance screening and enrichment of DEAR targeting sequence and DEAR HEK-293T (ATCC CRL-11268) cells were cultured in DMEM high glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2 until the logarithmic phase, digested with 0.25% trypsin, washed twice with PBS (pH 7.0-7.2), and resuspended in Opti-MEM TM (Gibco, Catalog No.: 31985070) culture medium, and adjust the cell density to 5×10 4 / μL, add 2μg Integration PB transposase plasmid (System Biosciences) and 2μg DEAR1 targeting sequence stable transfection plasmid to 20μL cell suspension, electroporate the cell suspension at 450V (Celetrix biotechnologies, model: LE+), add DMEM high-density 4% calf serum to the electroporated cells. In the sugar medium, after 24 hours of electroporation, the medium was replaced with a medium containing 10μg / mL Blasticidin, and the cells were screened for one week. During this period, the cells were subcultured according to the growth conditions. After the cells were stable, the stable cell line containing the DEAR1 targeting sequence was obtained. The same method was used to electroporate 2μg Integration PB transposase plasmid (System Biosciences) and 2μg DEAR stable plasmid (DEAR1 stable plasmid or DEAR1-NT stable plasmid) into the stable cell line containing the DEAR1 targeting sequence. After 24 hours of electroporation, the medium was replaced with a medium containing 50μg / mL Hygromycin B, and the cells were screened for one week. During this period, the cells were subcultured according to the growth conditions. After the cells were stable, the medium was replaced with a medium containing 10μg / mL Puromycin, and the cells were screened for one week. For the stable cell lines containing the DEAR1 targeting sequence, the PuroR gene integrated in the cells is in a frameshift state and cannot express the correct protein, thus not having resistance to Puromycin. DEAR1 (DEAR1 stable plasmid) can cut the DEAR1 targeting sequence to cause DNA double-strand breaks, and the insertion or deletion mutation (INDEL) introduced by the break repair can restore the frameshifted PuroR gene to normal expression, resulting in cell survival under Puromycin screening, as shown in A in Figure 37; while DEAR1-NT (DEAR1-NT stable plasmid) cannot cut the DEAR1 targeting sequence, and the cells cannot express the correct PuroR gene, resulting in cell death under Puromycin screening. As shown in B in Figure 37, cells stably transfected with DEAR1 (DEAR1 stable plasmid) survive, while cells stably transfected with DEAR1-NT (DEAR1-NT stable plasmid) die (scale bar: 500μm). 3. Next-generation sequencing verifies DEAR1 cleavage of genomic DNA in mammalian cells For the surviving cells in B in Figure 37 (stable transfection of DEAR1, i.e., stable transfection of DEAR1 stable transfection plasmid), the genome was extracted and the DEAR1 targeting sequence was subjected to second-generation sequencing using the TIANSeq Fast DNA Library Kit (Illumina) to build a library. The second-generation sequencing was performed by Novogene, and the second-generation sequencing data was analyzed online using the CRISPResso2 website. The mutations of the three targeting sites (Target 1 to 3) in the DEAR1 targeting sequence were analyzed separately, and the results are shown in Figure 38A. The arrow indicates the cleavage site of DEAR1, the short horizontal bar indicates the deletion mutation, the box indicates the insertion mutation, Target 1 detected 9.18% of the insertion or deletion mutation, Target 2 detected 7.35% of the insertion or deletion mutation, and Target 3 detected 0.01% of the insertion or deletion mutation. Specifically, this embodiment detected insertion mutations with a length of between 1 and 2nt near the three targeting sites and deletion mutations with a length of between 1 and 25nt. In addition, by analyzing the full-length DEAR1 targeting sequence as a whole, as shown in FIG38B , this example also observed deletion mutations with a maximum length of 85 nt spanning Target 1 and Target 2. Analysis of the upstream and downstream sequences of the DEAR1 targeting sequence showed that no insertion or deletion mutations were detected upstream or downstream of the DEAR1 targeting sequence, as shown in FIG38C , indicating that the cleavage of genomic DNA in mammalian cells by DEAR 1 is specifically guided by TRS. Example 8. Improving the cleavage activity and specificity of the DEAR nucleic acid manipulation system by extending the TRS region The DEAR nucleic acid manipulation system is a ribonucleic acid biomacromolecule that uses DNA and RNA as substrates for site-specific cleavage, in which the TRS region is the specific region responsible for substrate recognition, as shown in Figure 18. Biochemical experiments show that the wild-type DEAR system only relies on the 6-nt sequence of its TRS when cleaving the substrate. As shown in Table 6 below, extending the TRS will reduce the frequency of the corresponding substrate binding sequence in the genome, thereby improving the specificity. For example, when the 6-nt substrate is extended to more than 10-nt, its frequency of occurrence in E. coli is about 250 times less than the original 6-nt sequence. Therefore, increasing the sequence of TRS can greatly improve the specificity of substrate recognition. Table 6: Therefore, in this embodiment, the structure of DEAR1-10 was analyzed by cryo-electron microscopy, as shown in Figure 19, DEAR1-10 has 6 domains, domains I to VI, also referred to as D1-D6, of which D1 is the largest domain, the TRS substrate recognition sequence is located on D1, D1-D4 and D6 are its structural scaffolds, used to stabilize the overall configuration, and D5 is the catalytic active structural center, which forms the catalytic active center by binding to 2 magnesium ions. From the secondary structure and tertiary structure, it was found that DEARs all have conserved catalytic active centers and substrate recognition regions (see Figure 20), so in this embodiment, one of the DEARs (DEAR1) is used as an example for explanation. The nucleotides corresponding to D1-D6 in DEAR1-10 are as follows: DEAR1 D1:1-266, D2:267-339, D3:340-385, D4:386-562, D5:563-596, D6:597-633, TRS:181-186 DEAR2 D1:1-267, D2:268-318, D3:319-375, D4:376-562, D5:563-596, D6:590-621, TRS:181-186 or, DEAR2 D1:1-267, D2:268-321, D3:322-375, D4:376-555, D5:556-589, D6:590-621, TRS:181-186 DEAR3 D1: 1 - 266, D2: 267 - 350, D3: 351 - 390, D4: 391 - 572, D5: 573 - 606, D6: 607 - 647, TRS: 181 - 186 Or, DEAR3 D1: 1 - 266, D2: 267 - 353, D3: 354 - 388, D4: 389 - 572, D5: 573 - 606, D6: 607 - 647, TRS: 181 - 186 DEAR4 D1: 1 - 262, D2: 263 - 318, D3: 319 - 379, D4: 380 - 573, D5: 574 - 607, D6: 608 - 650, TRS: 179 - 184 DEAR5 D1: 1 - 266, D2: 267 - 342, D3: 343 - 385, D4: 386 - 569, D5: 570 - 603, D6: 604 - 640, TRS: 181 - 186 Or, DEAR5 D1: 1 - 266, D2: 267 - 339, D3: 340 - 385, D4: 386 - 569, D5: 570 - 603, D6: 604 - 640, TRS: 181 - 186 DEAR6 D1: 1 - 299, D2: 300 - 342, D3: 343 - 411, D4: 412 - 515, D5: 516 - 550, D6: 551 - 595, TRS: 214 - 219 Or, DEAR6 D1: 1 - 299, D2: 300 - 339, D3: 340 - 411, D4: 412 - 515, D5: 516 - 550, D6: 551 - 595, TRS: 214 - 219 DEAR7 D1: 1 - 290, D2: 291 - 380, D3: 381 - 448, D4: 449 - 561, D5: 562 - 596, D6: 597 - 644, TRS: 206 - 211 Or, DEAR7 D1:1-290, D2:291-377, D3:378-449, D4:450-561, D5:562-596, D6:597-644, TRS:206-211 DEAR8 D1:1-267, D2:268-338, D3:339-375, D4:376-613, D5:614-594, D6:595-636, TRS:180-185 or, DEAR8 D1:1-267, D2:268-335, D3:336-375, D4:376-559, D5:560-593, D6:594-636, TRS:180-185 DEAR9 (without D4 domain, indicated by "---") D1:1-266, D2:267-342, D3:343-380, D4: ---, D5:381-415, D6:416-451, TRS:181-186 or, DEAR9 (without D4 domain, indicated by "---") D1:1-266, D2:267-339, D3:340-380, D4: ---, D5:381-414, D6:415-451, TRS:181-186 DEAR10 D1:1-266, D2:267-339, D3:340-388, D4:389-408, D5:409-442, D6:443-479, TRS:181-186 Exemplarily, the I domain (D1) in DEAR1 corresponds to nucleotide 1 to nucleotide 266 of the nucleotide sequence of DEAR1 (SEQ ID NO: 1). It should be noted that for the domain division of the above primary sequences, for DEAR1, 2, 3, 5, and 6, the position of each domain was determined by the three-dimensional structure, and for the remaining DEARs (DEAR4, 7 to 10), the Clustal (F. Sievers et al., Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7, 539 (2011). doi: 10.1038 / msb.2011.75) and DEAR1, 2, 3, 5, 6 were used for sequence comparison and confirmation. Due to the plasticity of RNA structure, there is a certain degree of deviation in the sequence boundaries of each domain (for example, about -20 to +20nt). In addition, the boundary division of the secondary structure domain is the same as that of the primary structure. The secondary structure is predicted by the method of RNAfold (R. Lorenz et al., Vienna RNA Package 2.0. Algorithms Mol Biol 6, 26 (2011). doi: 10.1186 / 1748-7188-6-26). Due to the dynamic nature of RNA structure, each domain of RNA may have a deviation of 0-5 domains. Therefore, there may be different ways to divide the positions of the nucleotides corresponding to D1-D6 in the above DEAR1-10. Moreover, for example, the secondary structure of DEAR9 predicts that domain IV contains a stem-loop / hairpin structure, and it is reasonable that there is no corresponding primary sequence in the primary structure confirmed by sequence alignment with Clustal and DEAR1, 2, 3, 5, 6. Through structural analysis, it was found that there is a large room for modification in the TRS region of DEARs, so this embodiment intends to extend and modify its TRS region. First, this example tests the adaptability of the TRS region by replacing the TRS region (nucleotides 181-186 of exemplary DEAR1) with different sequences. The sequences of different TRSs and the corresponding substrates (the substrate binding sequences of the corresponding TRSs are shown in bold) are listed in Table 7 below: Table 7: According to the method in Example 2, the corresponding DNA sequence of DEAR1 with TRS replaced by different sequences was synthesized and RNA was prepared. According to the experimental method in Examples 3-6, 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, The cleavage activity of the corresponding RNA was detected under the same conditions. It was found that different sequences could produce cleavage effects with slightly different cleavage activities. The cleavage activity of DEAR1 with TRS of UGUCCC and CGAUAG was weaker than that of the original version, while the cleavage activity of DEAR1 with TRS of GGAGUG was stronger than that of the original version, indicating that the sequence of the TRS region can be replaced, as shown in B in Figure 21. Second, by replacing the TRS sequence with sequences of different lengths, this example demonstrates the potential of extending the TRS region to improve the specificity of the DEAR nucleic acid manipulation system. According to the method in Example 2, 0-nt TRS (i.e., TRS in the full-length sequence of DEAR was deleted), 2-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with GA), 4-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with AGAC), 6-nt TRS (i.e., the original version of the full-length sequence of DEAR), 8-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with CUAAGACA), 10-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with CGCUAAGACA (SEQ ID NO: 89)), 12-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with UCCGCUAAGACA (SEQ ID NO: 90)), and 14-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with GAUCCGCUAAGACA (SEQ ID NO: 91)) The corresponding DNA sequences of DEAR1 were synthesized and RNA was prepared according to the experimental methods in Examples 3-6. KCl, 50mM MgCl2, 40mM MOPS 7.5, The cleavage activity of the corresponding RNA was detected under the conditions, and the substrates used were all ssDNA substrates with a sequence of SEQ ID NO:35 and a -Cy5 label at the 3' end. By extending the TRS region of DEAR1, it can be seen that it still has DNA cleavage activity when extended to 12nt as shown in C in Figure 21. Among them, the cleavage activity of the 6nt TRS is the highest in the most original version. This shows that the TRS region is highly modifiable. Moreover, plasmid cleavage experiments in bacteria also demonstrated that DEAR1 with extended TRS still has cleavage activity. According to the experimental method in step 2 of Example 4, 0-nt TRS (i.e., TRS in the full-length sequence of DEAR was deleted), 2-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with GA), 4-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with AGAC), 6-nt TRS (i.e., the original version of the full-length sequence of DEAR), 8-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with GUAAGACA), 10-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with CGGUAAGACA (SEQ ID NO: 92)), 12-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with CCCGGUAAGACA (SEQ ID NO: 93)), 14-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with AACCCGGUAAGACA (SEQ ID NO: 94)), 16-nt TRS (i.e., TRS in the full-length sequence of DEAR was replaced with CCAACCCGGUAAGACA (SEQ ID NO: 95) NO:95)) and constructed into the DEAR expression plasmid in E. coli cells. According to the experimental method in step 4 of Example 4, the plasmid interference ability of DEAR1 molecules with different TRS lengths was detected. The targeting plasmids were all the ccdB toxic gene inducible expression plasmids described in step 1 of Example 4 (addgene sequence number: 69056, DEAR1 molecules with different TRS lengths can target the ori of this plasmid). It can be observed in D of Figure 21 that DEAR1 with extended TRS still has cutting activity in bacteria at 4-10nt. These experiments show that TRS can be preferably extended to 7-10 nt in vivo and in vitro, and has basic cleavage activity against DNA in vitro and plasmids in bacteria with improved specificity. Of course, as confirmed above, extension to 12 nt, 14 nt, etc. also has cleavage activity and improved specificity. Example 9: Improving the cleavage activity and specificity of the DEAR nucleic acid manipulation system by adding a recruitment sequence at the 3' end For the DEAR nucleic acid manipulation system, its 3' end is near the catalytic activity pocket of DEAR. Therefore, this embodiment designs a modification method to improve its substrate (target nucleic acid) recognition specificity and thus improve the cleavage activity by designing a DNA sequence that can be specifically complementary to the substrate (target nucleic acid). As shown in Figures 22-24, this embodiment tested two schemes: 1) by deleting the VI domain (D6) in DEAR and adding a recruiter sequence; or, 2) directly adding a recruiter sequence after D6, thereby increasing the substrate recognition specificity and improving the cleavage activity. (1) Deletion of DEAR6 domain VI and addition of recruitment sequence enhance cleavage activity First, in this example, the above transformation was performed on DEAR6, and the following DNA sequences (V1) were synthesized: 1) the corresponding DNA sequence of DEAR6 with the VI domain (551-595) deleted; 2) the corresponding DNA sequence of DEAR6 with the VI domain (551-595) deleted and the recruitment sequence CCTACGCACTACCCAGTAAA (SEQ ID NO: 58) added to the 3' end (V2). A in FIG. 22 is a schematic diagram of the two transformations and the original DEAR nucleic acid manipulation system, B in Figure 22 is a schematic diagram of the recruitment sequence helping to identify the substrate sequence, wherein the recruitment sequence is located at the 3' end of DEAR and can hybridize with the recruitment sequence binding sequence in the substrate, TRS (substrate recognition sequence, for DEAR6, TRS is ACAUCA) can hybridize with the substrate binding sequence in the substrate, and there is a gap between the substrate binding sequence and the recruitment sequence binding sequence, which is called the linker sequence. The corresponding RNA was prepared according to the method in Example 2. The substrate ssDNA with a Cy5-labeled 3' end and a linker sequence of different lengths was cut separately (the sequence is shown in Table 8 below, the substrate binding sequence is bold, the linker sequence is italicized, and the recruitment sequence binding sequence is underlined) according to the experimental method in Examples 3-6, in 10mM KCl, 50mM MgCl2, 40mM MOPS 7.5, The cleavage activity of the modified DEAR6 molecule on substrates with different lengths of linker sequences was detected under different conditions. Table 8: As shown in C and D in Figure 22, compared with the original DEAR6 (DEAR6WT), DEAR6 with the VI domain deleted (DEAR6_ΔDVI), and DEAR6 with the VI domain deleted and the recruitment sequence added (DEAR6_ΔDVI-recruitment sequence), their substrate cleavage activities showed significant improvements (the figure shows the cleavage gel image and cleavage efficiency diagram for the 20nt linker sequence substrate at different times, time points: 0h, 0.5h, 1h, 2h, 4h, 8h, 12h, 24h). Further, this embodiment explores the effect of different linker sequence lengths on the cutting efficiency, as shown in Figure 23, A in Figure 23 is a schematic diagram of the substrate ssDNA, B in Figure 23 is a schematic diagram of the cutting efficiency of DEAR6WT, DEAR6_ΔDVI, and DEAR6_ΔDVI-recruitment sequence for substrates with different linker sequence lengths at 24h, C, D, and E in Figure 23 are schematic diagrams of the cutting efficiency of DEAR6WT, DEAR6_ΔDVI, and DEAR6_ΔDVI-recruitment sequence for substrates with different linker sequence lengths at different time points, respectively, and F in Figure 23 is a statistical table of the cutting efficiency of the above experimental groups. The results show that the appropriate linker sequence length ranges from 20nt to 50nt, and a length of 30-nt is preferred. (2) Recruitment sequence length test Furthermore, this example tested the same modification strategy on DEAR1. The synthetic VI domain (597-633) was deleted and the recruitment sequence ATGAGCATGATTAGGCCTAG (SEQ ID NO: 66) was added to the 3' end. The corresponding DNA sequence of DEAR1 was prepared according to the method in Example 2. The original DEAR1 RNA was used as a control and the experimental methods in Examples 3-6 were used to generate the corresponding RNA in 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, Under the conditions, the substrate ssDNA (sequence is) with a 3' end labeled with -Cy5 and a connection sequence length of 12 nt was cut. (SEQ ID NO:67), the substrate binding sequence is shown in bold + underline, the junction sequence is shown in italics, and the recruitment sequence binding sequence is shown underlined). The results showed that deleting domain VI and adding the recruitment sequence also enhanced the cleavage of substrate ssDNA by DEAR1, as shown in A of Figure 24. In order to explore the appropriate recruitment sequence length, the corresponding DNA sequences of DEAR1 with 14nt recruitment sequence (sequence ATGAGCATGATTAG (SEQ ID NO: 68)), 20nt recruitment sequence (sequence ATGAGCATGATTAGGCCTAG (SEQ ID NO: 66)) and 26nt recruitment sequence (sequence ATGAGCATGATTAGGCCTAGCTCTTC (SEQ ID NO: 96)) added to the 3' end were synthesized in this example. The corresponding RNA was prepared according to the method in Example 2. In 10mM KCl, 50mM MgCl2, 40mM MOPS 7.5, Under the conditions, the above substrate ssDNA (sequence: (SEQ ID NO:67), wherein the substrate binding sequence is bold + underlined, the recruitment sequence binding sequence is italicized, the 14nt recruitment sequence can recognize the portion shown by the dotted underline, the 20nt recruitment sequence can recognize the portion shown by the double underline and the dotted underline, and the 26nt recruitment sequence can recognize the portion shown by the single underline, double underline and dotted underline). As shown in B in Figure 24, DEAR1 with 14nt, 20nt and 26nt recruitment sequences at the 3' end showed similar cutting efficiency, so the recruitment sequence length of 14nt-26nt is optional, and the length of 20nt is preferred (the 6nt TRS combined with the 20nt recruitment sequence, a total of 26nt recognition sequences, has met the requirements of most of the recognition of specific genomic sites, referring to the commonly used SpyCas9 and AsCas12a gRNA spacer length of about 20nt). By performing modification tests on DEAR1 and DEAR6, this example found that directly adding a recruitment sequence and deleting D6 before adding a recruitment sequence can both improve their cleavage activity for DNA substrates. Since the DEARs system has similar D6, this modification is applicable to all DEARs. Therefore, the recruitment sequence binding sequence is at the 3' end of the substrate binding sequence, and the length selection range of the connecting sequence separated in the middle is preferably 20-50nt (Figure 23), wherein the highest cleavage rate is achieved at about 30nt: the length range of the recruitment sequence is preferably 14-26nt. In addition, in general, it is preferred that there is no sequence in the recruitment sequence that can be recognized by TRS and cut by DEAR. And, in some preferred schemes, the Gibbs free energy of its secondary structure is less than 7 when the recruitment sequence is designed. Example 10: Improving substrate recognition specificity by transforming originally homodimeric DEARs into heterodimeric DEARs From the results of cryo-electron microscopy analysis (Figure 19), DEAR1 can form homodimers in natural conditions (Figure 21 A is a schematic diagram of DEAR1 homodimers). Moreover, this dimerization depends on the dimerization motif of its III domain (D3) (position 361-366, sequence UCUAGA). Therefore, this embodiment is designed Its dimerization motif was transformed into two different sequences that can hybridize with each other, thereby mediating the formation of heterodimers by DEAR1 molecules with two different dimerization motifs and two different TRSs (referred to as monomer 1 and monomer 2, and their TRSs are called TRS1 and TRS2, respectively) (as shown in A in Figure 25), thereby improving its substrate recognition specificity from the original DNA sequence that can only recognize 6nt to a 12nt sequence. The sequences of the DEAR1 heterodimers constructed in this example are: Monomer 1 (SEQ ID NO: 69): Monomer 2 (SEQ ID NO: 70): TRS1 and TRS2 in monomer 1 and monomer 2 are both bolded and underlined, and the dimerization motifs in the two monomers are both italicized and underlined. The corresponding DNA sequences were synthesized respectively, and the corresponding RNA was prepared according to the method in Example 2. A. Monomer 1 (1 mM); B. Monomer 2 (1 mM); C. Equal amounts of monomer 1 (500 nM) and monomer 2 (500 nM) were respectively mixed in 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, Incubate for 30 min under the conditions of Under the same conditions, the samples were passed through micro Superose 6 molecular sieves, and the loading volume was 50 μL. As shown in B of FIG25 , it can be observed that monomer 1 and monomer 2 after the dimerization motif was changed can still form heterodimers. In the schematic diagram of the two-dimensional clustering results of cryo-electron microscopy, it can be seen that monomer 1 and monomer 2 do form monomers when they exist alone, but they can indeed form dimers after incubating the two together. According to its structural analysis, it can be seen that DEAR has three possible recognition modes for double-stranded DNA substrates (such as plasmids, bubble DNA, etc.), forming 5' protruding ends, blunt ends and 3' protruding ends respectively. The cleavage products generated in these three cases are different, as shown in C in Figure 25, where the DEAR1 heterodimer is represented by a butterfly-shaped cartoon, TRS1, TRS2 and the corresponding substrate binding sequences are shown in the figure respectively, and the cleavage site is represented by a triangle. Using this heterodimer, this embodiment cuts different types of DNA substrates, including the cutting conditions of substrates with 5' protruding ends, blunt ends and 3' protruding ends at different cutting distances. The sequences of the two chains of different substrates are shown in Table 9 below. The substrates used are all double-stranded DNA with bubbles, wherein the 3' end of the sense chain is labeled with -Cy5 and has a Target of TRS1 (shown in bold in the table below); the 3' end of the antisense chain is labeled with FAM and has a Target of TRS2 (shown underlined in the table below); the corresponding region where the sense chain and the antisense chain can be complementary is shown in italics. Table 9: The sense strand and antisense strand were mixed in equal amounts and denatured and annealed to form double-stranded DNA with bubbles. 1.5 μM equimolar concentration of DEAR1 monomer was incubated at room temperature for 30 minutes to form heterodimers, and then incubated with 100 nM double-stranded DNA substrate in 50 mM MgCl2, 10 mM KCl, 40 mM MOPS 7.5, The cleavage reaction was carried out under the conditions. Time points: 0, 3, 6, 18h. The fluorescence images obtained by scanning the corresponding fluorescence channels of Cy5 and FAM were merged using ImageJ software. As shown in D in Figure 25, it can be seen that this heterodimer has effective cleavage of both chains of different types of double-stranded DNA substrates. This shows that the modification of the heterodimer is biochemically active. The use of this heterodimer DEAR for cutting in bacteria shows that it still has a cutting effect. Two J23119 promoters in series (whose specific sequence is (SEQ ID NO: 42): TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT) are used to start the expression of monomer 1 and monomer 2 in the DEAR1 heterodimer (TRS of both monomers are AAGACA, and the dimerization motif is consistent with the biochemical experiment part above in this embodiment, that is, monomer 1 is UCUCCU and monomer 2 is AGGAGA). The construction method is as follows: The J23119 promoter is connected to DEAR1 monomer 1 and DEAR1 monomer 2 respectively, and then the two coding frames are connected in sequence, and then the whole is inserted into the pCDFDuet1 plasmid vector (Novagen item number: 71340-3) by homologous recombination, and the sequence of the plasmid 410-3765 interval is replaced as a whole. According to the method in Example 4, the cutting activity of the heterodimer DEAR in bacteria was tested. As shown in Figure 26, this indicates that this design also has plasmid interference activity in bacteria. In addition, it is understandable that since DEAR has editing effects in eukaryotic cells and bacteria (Figures 12-17), these modification methods for improving specificity and activity are also applicable to editing in eukaryotic cells and bacteria. Example 11. Improving the cleavage activity and specificity of the DEAR nucleic acid manipulation system by inserting an extended recognition region In this example, a modified DEAR nucleic acid manipulation system was obtained by inserting extended recognition regions of different lengths into DEAR1 and DEAR2, and then tested. (1) For DEAR1, this example tested the following modified DEAR1 nucleic acid manipulation system: RS+1: the extended recognition region replaces the 223rd nucleotide in SEQ ID NO: 10, i.e., the 223rd nucleotide is deleted and the extended recognition region is inserted between the 222nd nucleotide and the 224th nucleotide, and the sequence of the extended recognition region is: u; RS+2: the extended recognition region replaces the 223rd nucleotide in SEQ ID NO: 10, i.e., the 223rd nucleotide is deleted and the extended recognition region is inserted between the 222nd nucleotide and the 224th nucleotide, and the sequence of the extended recognition region is: gu; RS+3: the extended recognition region replaces the 223rd nucleotide in SEQ ID NO: 10, i.e., the 223rd nucleotide is deleted and the extended recognition region is inserted between the 222nd nucleotide and the 224th nucleotide, and the sequence of the extended recognition region is: ggu; RS+4: the extended recognition region replaces the 223rd nucleotide in SEQ ID NO: 10, i.e., the 223rd nucleotide is deleted and the extended recognition region is inserted between the 222nd nucleotide and the 224th nucleotide, and the sequence of the extended recognition region is: cggu; RS+6: the extended recognition region replaces the 223rd nucleotide in SEQ ID NO: 10, i.e., the 223rd nucleotide is deleted and the extended recognition region is inserted between the 222nd nucleotide and the 224th nucleotide, and the sequence of the extended recognition region is: cccggu; RS+8: the extended recognition region replaces the 223rd nucleotide in SEQ ID NO: 10, i.e., the 223rd nucleotide is deleted and the extended recognition region is inserted between the 222nd nucleotide and the 224th nucleotide, and the sequence of the extended recognition region is: aacccggu; RS+10: the extended recognition region replaces the 223rd nucleotide in SEQ ID NO: 10, i.e., the 223rd nucleotide is deleted and the extended recognition region is inserted between the 222nd nucleotide and the 224th nucleotide, and the sequence of the extended recognition region is: ccaacccggu (SEQ ID NO: 97); RS+12: the extended recognition region replaces the 223rd nucleotide in SEQ ID NO: 10, i.e., the 223rd nucleotide is deleted and the extended recognition region is inserted between the 222nd nucleotide and the 224th nucleotide, and the sequence of the extended recognition region is: guccaacccggu (SEQ ID NO: 98); RS+14: the extended recognition region replaces the 223rd nucleotide in SEQ ID NO: 10, i.e., the 223rd nucleotide is deleted and the extended recognition region is inserted between the 222nd nucleotide and the 224th nucleotide, and the sequence of the extended recognition region is: gaguccaacccggu (SEQ ID NO: 99); Exemplarily, the nucleotide sequence of DEAR1 RS+14 is as follows (SEQ ID NO: 100; wherein the single underlined region is the TRS region, and the double underlined region is the RS region): In this example, for the test of DEAR1 or modified DEAR1, the substrate sequence used is (SEQ ID NO: 101): Among them, the single underlined part is the region (target sequence) that hybridizes with the substrate recognition region; the double underlined part (or some of the nucleotides therein) is the region that hybridizes with different extended recognition regions. For example, for RS+1, its extended recognition region u hybridizes with the first nucleotide a at the 5' end of the double underlined part; for RS+3, its extended recognition region ggu hybridizes with the first three nucleotides acc at the 5' end of the double underlined part; for RS+14, its extended recognition region hybridizes with the double underlined part. Therefore, the target sequence in the target nucleic acid that hybridizes with the substrate recognition region (for example, TGTCTT) and the sequence in the target nucleic acid that hybridizes with the extended recognition region (for example, accgggttggactc recognized by RS+14; SEQ ID NO: 102) are continuous nucleotide sequences in the target nucleic acid. The corresponding RNAs with different RS extensions, namely DEAR1 RS+1-14, were prepared according to the method in Example 2. Wild-type DEAR1 and DEAR1 RS+1-14 were used to cut the substrate ssDNA (sequences shown above) with Cy5 labeling at the 3' end, respectively. According to the experimental method in Examples 3-6, 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, The cleavage activity of DEAR1 molecules before and after modification on substrates was detected under the same conditions. The cleavage time points were selected as 0, 1, 6, and 24 h. The K value was calculated using the One-Phase-Association model using the formula E=E0+(Plateau-E0)×(1-e -k×t ) in GraphPad Prism 7 software (E refers to the cleavage ratio (%); E0 refers to the cleavage ratio at 0 h time point (%); Plateau refers to the maximum cleavage ratio (%); k refers to the rate constant (h -1 ); t refers to the cleavage time (h). The cleavage ratio of 24 hours is taken from the last time point in the cleavage curve. Each group was repeated 3 times. In the schematic diagram of cleavage (A in Figure 28), the TRS region and RS region are shown in the figure, and the DNA substrate and TRS and RS sequences of different lengths match each other. The experimental results are shown in AD in Figure 28. The cutting rate reached the maximum at RS+14, and it was active when the length of the inserted extended recognition region was 1-14 nt. (2) For DEAR2, this example tested the following modified DEAR2 nucleic acid manipulation system: RS+1: the extended recognition region replaces the 226th nucleotide in SEQ ID NO: 11, i.e., the 226th nucleotide is deleted and the extended recognition region is inserted between the 225th nucleotide and the 227th nucleotide, and the sequence of the extended recognition region is: a; RS+2: the extended recognition region replaces the 226th nucleotide in SEQ ID NO: 11, i.e., the 226th nucleotide is deleted and the extended recognition region is inserted between the 225th nucleotide and the 227th nucleotide, and the sequence of the extended recognition region is: ga; RS+3: Extended recognition region replaces the 226th nucleotide in SEQ ID NO: 11, i.e., deletes the 226th nucleotide and inserts the extended recognition region between the 225th nucleotide and the 227th nucleotide. The sequence of the extended recognition region is: cga; RS+4: the extended recognition region replaces the 226th nucleotide in SEQ ID NO: 11, i.e., the 226th nucleotide is deleted and the extended recognition region is inserted between the 225th nucleotide and the 227th nucleotide, and the sequence of the extended recognition region is: gcga; RS+6: the extended recognition region replaces the 226th nucleotide in SEQ ID NO: 11, i.e., the 226th nucleotide is deleted and the extended recognition region is inserted between the 225th nucleotide and the 227th nucleotide, and the sequence of the extended recognition region is: uggcga; RS+8: the extended recognition region replaces the 226th nucleotide in SEQ ID NO: 11, i.e., the 226th nucleotide is deleted and the extended recognition region is inserted between the 225th nucleotide and the 227th nucleotide, and the sequence of the extended recognition region is: gguggcga; RS+10: the extended recognition region replaces the 226th nucleotide in SEQ ID NO: 11, i.e., the 226th nucleotide is deleted and the extended recognition region is inserted between the 225th nucleotide and the 227th nucleotide, and the sequence of the extended recognition region is: acgguggcga (SEQ ID NO: 103); RS+12: the extended recognition region replaces the 226th nucleotide in SEQ ID NO: 11, i.e., the 226th nucleotide is deleted and the extended recognition region is inserted between the 225th nucleotide and the 227th nucleotide, and the sequence of the extended recognition region is: cgacgguggcga (SEQ ID NO: 104); RS+14: The extended recognition region replaces the 226th nucleotide in SEQ ID NO: 11, that is, the 226th nucleotide is deleted and the extended recognition region is inserted between the 225th nucleotide and the 227th nucleotide. The sequence of the extended recognition region is: accgacgguggcga (SEQ ID NO: 105). Exemplarily, the nucleotide sequence of DEAR2RS+14 is as follows (SEQ ID NO: 106; wherein the single underlined region is the TRS region, and the double underlined region is the RS region): In this example, the substrate sequence used for the test of DEAR2 and modified DEAR2 is (SEQ ID NO: 107): Among them, the single underlined part is the region (target sequence) that hybridizes with the substrate recognition region; the double underlined part (or some nucleotides therein) is the region that hybridizes with different extended recognition regions. For example, for RS+1, its extended recognition region a hybridizes with the first nucleotide t at the 5' end of the double underlined part; for RS+3, its extended recognition region cga hybridizes with the first three nucleotides tcg at the 5' end of the double underlined part; for RS+14, its extended recognition region hybridizes with the double underlined part. Therefore, the target sequence (for example, TGCCTA) in the target nucleic acid that hybridizes with the substrate recognition region and the target sequence (for example, TGCCTA) that hybridizes with the extended recognition region The sequence in the target nucleic acid (eg, tcgccaccgtcggt recognized by RS+14; SEQ ID NO: 108) is a continuous nucleotide sequence in the target nucleic acid. The corresponding RNAs with different RS extensions, i.e., DEAR2RS+1-14, were prepared according to the method in Example 2. Wild-type DEAR2 and DEAR2RS+1-14 were used to cut the substrate ssDNA (sequences shown above) with Cy5 labeling at the 3' end, and the ssDNA was lysed according to the experimental method in Examples 3-6 in 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, The cleavage activity of DEAR2 molecules before and after modification on the substrate was detected under the same conditions. The cleavage time points were selected as 0, 1, 6, and 24 h. The statistical K value was calculated using the One-Phase-Association model using the formula E=E0+(Plateau-E0)×(1-e -k×t ) in GraphPad Prism 7 software (E refers to the cleavage ratio (%); E0 refers to the cleavage ratio at 0 h time point (%); Plateau refers to the maximum cleavage ratio (%); k refers to the rate constant (h -1 ); t refers to the cutting time (h). The 24-hour cutting ratio is taken from the last time point in the cutting curve. Each group was repeated 3 times. The experimental results are shown in AH in Figure 28. The cutting rate is improved when the RS is extended (i.e., the extended recognition region is inserted), and the inserted extended recognition region is active when the length is 1-14 nt. For DEAR1, the cutting efficiency is the highest when the RS length is 14 nt (i.e., RS+14), and the cutting ratio is relatively the highest at RS+2 and RS+3. For DEAR2, the cutting rate is the highest at RS+6, and the relative cutting ratio is the highest at RS+8. (3) The corresponding RNAs with different RS extensions (i.e., DEAR1 RS+14 and DEAR2RS+14 in (1) and (2) above) were prepared according to the method in Example 2. Wild-type DEAR1, DEAR1 RS+14, wild-type DEAR2, and DEAR2RS+14 were used to cut the substrate ssDNA with Cy5 labeling at the 3' end (i.e., the substrates in (1) and (2) above and the following DEAR1-58-1-new-ssDNA-NT and DEAR2-58-1-new-ssDNA-NT), respectively. According to the experimental method in Examples 3-6, the ssDNA was purified by PCR in 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, The cleavage activity of the above substrates of DEAR1 and DEAR2 molecules before and after modification was detected under the same conditions. The cleavage time points were selected as 0, 1, 6, and 24 hours. The statistical K values were as described in (1) and (2) above. Each group was repeated 3 times. The non-specific substrate sequence used is as follows: DEAR1-58-1-new-ssDNA-NT (SEQ ID NO: 109; DEAR1 and the extended recognition region do not match the substrate, and the unmatched region is underlined): DEAR2-58-1-new-ssDNA-NT (SEQ ID NO: 110; DEAR2 and the extended recognition region do not match the substrate, and the unmatched region is underlined): The experimental results are shown in FIG29 . For the case where the length of the inserted extended recognition region is 14 nt, both the modified DEAR1 and the modified DEAR2 have a significant improvement in the cleavage of specific substrates compared to the cleavage of non-specific substrates. In the wild-type DEAR1, both RS-paired and non-paired substrates have cleavage efficiency, but the modified DEAR1 (RS inserted) has a high cleavage efficiency for paired substrates, but has no cleavage effect on non-paired substrates. In the wild-type DEAR2, both RS-paired and non-paired substrates have cleavage efficiency, and the modified DEAR2 (RS inserted) has a high cleavage efficiency for paired substrates, but has a weaker cleavage effect on non-paired substrates. The above results show that the modified DEAR has good specificity. (4) Prepare the corresponding RNAs with different RS extensions according to the method in Example 2 (i.e., the RNAs in (1) above) DEAR1 RS+14). The ssDNA substrates with Cy5 labeling at the 3' end (the following SM1-20 substrates, the substrates in (1) above, and the DEAR1-58-1-new-ssDNA-NT in (3) above (i.e., as RS unpaired substrates), and the following DEAR1-58-1-new-ssDNA-TSR-NT substrate (i.e., TRS unpaired substrates)) were cleaved according to the experimental method in Example 3-6 in 10 mM KCl, 50 mM MgCl2, 40 mM MOPS 7.5, The substrate cleavage activity of DEAR1 before and after modification was detected under the same conditions. The cleavage time points were 0, 1, 6, and 24 h. The statistical K values were as described in (1) and (2) above. Each group was repeated twice. The substrate sequence for single base mutation is shown below, with the single mutation position underlined: Dr1-58-ms1-ssDNA-TRS3 (SEQ ID NO: 111; SM1 substrate): TACCCGGGGATCCTGCAACCATAAGTCTTaccgggttggactcAGGCCTAATCATGCT Dr1-58-ms2-ssDNA-TRS3 (SEQ ID NO: 112; SM2 substrate): TACCCGGGGATCCTGCAACCATATCTCTTaccgggttggactcAGGCCTAATCATGCT Dr1-58-ms3-ssDNA-TRS3 (SEQ ID NO: 113; SM3 substrate): TACCCGGGGATCCTGCAACCATATGACTTaccgggttggactcAGGCCTAATCATGCT Dr1-58-ms4-ssDNA-TRS3 (SEQ ID NO: 114; SM4 substrate): TACCCGGGGATCCTGCAACCATATGTGTTaccgggttggactcAGGCCTAATCATGCT Dr1-58-ms5-ssDNA-TRS3 (SEQ ID NO: 115; SM5 substrate): TACCCGGGGATCCTGCAACCATATGTCATaccgggttggactcAGGCCTAATCATGCT Dr1-58-ms6-ssDNA-TRS3(SEQ ID NO:116;SM6 gene): TACCCGGGGATCCTGCAACCATATGTCTAaccggggttggactcAGGCCTAATCATGCT Dr1-58-ms7-ssDNA-TRS3(SEQ ID NO:117;SM7 SYSTEM): TACCCGGGGATCCTGCAACCATATGTCTTtccggggttggactcAGGCCTAATCATGCT Dr1-58-ms8-ssDNA-TRS3(SEQ ID NO:118;SM8 sequence): TACCCGGGGATCCTGCAACCATATGTCTTagcggggttggactcAGGCCTAATCATGCT Dr1-58-ms9-ssDNA-TRS3(SEQ ID NO:119;SM9 product): TACCCGGGGATCCTGCAACCATATGTCTTacggggttggactcAGGCCTAATCATGCT Dr1-58-ms10-ssDNA-TRS3(SEQ ID NO:120;SM10 marker): TACCCGGGGATCCTGCAACCATATGTCTTacccggttggactcAGGCCTAATCATGCT Dr1-58-ms11-ssDNA-TRS3(SEQ ID NO:121;SM11 gene): TACCCGGGGATCCTGCAACCATATGTCTTaccgcgttggactcAGGCCTAATCATGCT Dr1-58-ms12-ssDNA-TRS3(SEQ ID NO:122;SM15 product): TACCCGGGGATCCTGCAACCATATGTCTTaccggcttggactcAGGCCTAATCATGCT Dr1-58-ms13-ssDNA-TRS3(SEQ ID NO:123;SM13 gene): TACCCGGGGATCCTGCAACCATATGTCTTaccgggatggactcAGGCCTAATCATGCT Dr1-58-ms14-ssDNA-TRS3(SEQ ID NO:124;SM14 gene): TACCCGGGGATCCTGCAACCATATGTCTTaccgggtaggactcAGGCCTAATCATGCT Dr1-58-ms15-ssDNA-TRS3(SEQ ID NO:125;SM15 kit): TACCCGGGGATCCTGCAACCATATGTCTTaccggggttcgactcAGGCCTAATCATGCT Dr1-58-ms16-ssDNA-TRS3(SEQ ID NO:126;SM16 gene): TACCCGGGGATCCTGCAACCATATGTCTTaccggggttgcactcAGGCCTAATCATGCT Dr1-58-ms17-ssDNA-TRS3(SEQ ID NO:127;SM17 product): TACCCGGGGATCCTGCAACCATATGTCTTaccggggttggtctcAGGCCTAATCATGCT Dr1-58-ms18-ssDNA-TRS3(SEQ ID NO:128;SM18 gene): TACCCGGGGATCCTGCAACCATATGTCTTaccggggttggagtcAGGCCTAATCATGCT Dr1-58-ms19-ssDNA-TRS3(SEQ ID NO:129;SM19 FRAME): TACCCGGGGATCCTGCAACCATATGTCTTaccggggttggacacAGGCCTAATCATGCT Dr1-58-ms20-ssDNA-TRS3(SEQ ID NO:130;SM20 motif): TACCCGGGGATCCTGCAACCATATGTCTTaccggggttggactgAGGCCTAATCATGCT DEAR1-58-1-new-ssDNA-TRS-NT (SEQ ID NO: 131; i.e., TRS unpaired substrate): TACCCGGGGATCCTGCAACCATAACAGAAaccgggttggactcAGGCCTAATCATGCT The experimental results are shown in Figure 30. By comparing the tolerance of single base mutations of DEAR1-RS-14, for the case of DEAR1 RS+14, the single base mutations 1-7 on the substrate sequence (corresponding to SM1-7 substrates) have the greatest impact on its activity, and there is no cutting effect when TRS is not paired and RS is not paired. Single base mutations in subsequent sequences (corresponding to SM8-20 substrates) have little effect on the overall activity. It should be noted that, although the technical solution of the present invention is introduced with specific examples, those skilled in the art will appreciate that the present invention should not be limited thereto. The embodiments of the present invention have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or technical improvements in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.
Claims
1. A method for preparing an engineered DEAR nucleic acid manipulation system, wherein: The original DEAR nucleic acid manipulation system comprises an RNA molecule derived from a bacterial C-type second intron, wherein the RNA molecule comprises a substrate recognition region that hybridizes with a target sequence in a target nucleic acid, and the RNA molecule comprises at least one of domains I to VI; The preparation method comprises at least one selected from the following (a) to (d): (a) extending the substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system to a length of 7 to 14 nucleotides to obtain an extended substrate recognition region; (b) adding a recruitment sequence to the 3' end of the RNA molecule of the original DEAR nucleic acid manipulation system, and the recruitment sequence hybridizes with at least a portion of the target nucleic acid; (c) respectively setting a first dimerization motif and a second dimerization motif in the III domain of the first RNA molecule and the second RNA molecule from the original DEAR nucleic acid manipulation system, wherein the first dimerization motif and the second dimerization motif hybridize with each other, so that the first RNA molecule and the second RNA molecule form a heterodimer; (d) inserting an extended recognition region downstream of the 3′ end of the substrate recognition region in the RNA molecule of the original DEAR nucleic acid manipulation system, wherein the extended recognition region hybridizes with at least a portion of the target nucleic acid.
2. The preparation method according to claim 1, wherein In (a), the substrate recognition region in the RNA molecule is extended to an extended substrate recognition region having a length of 7 to 12 nucleotides; Preferably, the substrate recognition region in the RNA molecule is extended to an extended substrate recognition region having a length of 7 to 10 nucleotides.
3. The preparation method according to claim 1 or 2, wherein In (b), the recruitment sequence has a length of 10 to 40 nucleotides; Preferably, the recruitment sequence is 14 to 26 nucleotides in length.
4. The preparation method according to any one of claims 1 to 3, wherein In (b), the portion of the target nucleic acid hybridized to the recruitment sequence and the target sequence in the target nucleic acid hybridized to the substrate recognition region are located at different positions of the target nucleic acid; Preferably, the portion of the target nucleic acid that hybridizes to the recruitment sequence and the target sequence in the target nucleic acid that hybridizes to the substrate recognition region are separated by 10 to 60 nucleotides, preferably 20 to 50 nucleotides.
5. The preparation method according to any one of claims 1 to 4, wherein In (b), the VI domain of the RNA molecule of the original DEAR nucleic acid manipulation system is also deleted.
6. The preparation method according to any one of claims 1 to 5, wherein In (c), the length of the first dimerization motif and the second dimerization motif are the same, optionally, the length of the first dimerization motif and the second dimerization motif is 4 to 10 nucleotides, preferably 5 to 9 nucleotides, more preferably 6 nucleotides, and / or, The first substrate recognition region of the first RNA molecule and the second substrate recognition region of the second RNA molecule recognize the same portion of the target nucleic acid, or respectively recognize different portions of the target nucleic acid.
7. The preparation method according to any one of claims 1 to 6, wherein In (d), the extended recognition region is inserted into the original DEAR nucleic acid manipulation system by replacing any nucleotide from nucleotides 20 to 60, preferably any nucleotide from nucleotides 30 to 50, downstream of the 3' end of the substrate recognition region.
8. The preparation method according to any one of claims 1 to 7, wherein In (d), the target sequence in the target nucleic acid that hybridizes with the substrate recognition region and the sequence in the target nucleic acid that hybridizes with the extended recognition region are continuous nucleotide sequences in the target nucleic acid.
9. The preparation method according to any one of claims 1 to 8, wherein In (d), the length of the extended recognition region is 1 to 24 nt, preferably 1 to 14 nt.
10. The preparation method according to any one of claims 1 to 9, wherein The engineered DEAR nucleic acid manipulation system has improved specificity and / or cleavage activity compared to the original DEAR nucleic acid manipulation system.
11. The preparation method according to any one of claims 1 to 10, wherein The original DEAR nucleic acid manipulation system comprises at least domain I, domain II, domain III and domain V; Optionally, the length of the original DEAR nucleic acid manipulation system ranges from 100 to 5660 nt, preferably from 124 to 3897 nt; Optionally, the I domain comprises 2-6 stem-loop / hairpin structures, with a length ranging from 50-400 nt; preferably, the I domain comprises 3-5 stem-loop / hairpin structures, with a length ranging from 65-384 nt; and / or, The II domain comprises 1-4 stem-loop / hairpin structures, with a length ranging from 10-300 nt; preferably, the II domain comprises 1-3 stem-loop / hairpin structures, with a length ranging from 10-218 nt; and / or, The III domain comprises 1-3 stem-loop / hairpin structures, with a length ranging from 10-200 nt; preferably, the III domain comprises 1-2 stem-loop / hairpin structures, with a length ranging from 10-140 nt; and / or, The IV domain comprises 0-4 stem-loop / hairpin structures, with a length ranging from 0-4500 nt; preferably, the IV domain comprises 0-4 stem-loop / hairpin structures, with a length ranging from 0-3000 nt; and / or, The V domain comprises one stem-loop / hairpin structure with a length ranging from 20 to 60 nt, preferably, the V domain comprises one stem-loop / hairpin structure with a length ranging from 29 to 43 nt; and / or, The VI domain comprises one stem-loop / hairpin structure with a length ranging from 10 to 200 nt. Preferably, the VI domain comprises one stem-loop / hairpin structure with a length ranging from 10 to 112 nt.
12. The preparation method according to any one of claims 1 to 11, wherein The C-type second class intron is a C-type second class intron with or without an open reading frame encoding an intron-encoded protein in the IV domain; optionally, the length of the open reading frame encoding the intron-encoded protein is 0-4000 nt; and / or, The substrate recognition region is located in the I domain.
13. The preparation method according to any one of claims 1 to 12, wherein The nucleotide sequence of the RNA molecule of the original DEAR nucleic acid manipulation system is selected from any one of the following: (i) comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 1 to 9 and 132; (ii) a nucleotide sequence comprising the reverse complementary sequence of the sequence shown in any one of SEQ ID NOs: 1 to 9 and 132; (iii) a reverse complementary sequence of a sequence that can hybridize to the nucleotide sequence shown in (i) or (ii) under high stringency hybridization conditions or very high stringency hybridization conditions; (iv) a sequence having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, and most preferably at least 99% sequence identity with the nucleotide sequence shown in (i) or (ii).
14. The preparation method according to any one of claims 1 to 13, wherein The substrate recognition region of the RNA molecule of the original DEAR nucleic acid manipulation system has a length of 6 nucleotides; Preferably, the substrate recognition region is programmable to hybridize to different target sequences.
15. The preparation method according to any one of claims 1 to 14, wherein The target nucleic acid is DNA or RNA.
16. The preparation method according to any one of claims 1 to 15, wherein The primary cleavage site of the original DEAR Nucleic Acid Manipulation System is 0-1 nucleotides downstream of the 3' end of the target sequence in the target nucleic acid.
17. An engineered DEAR nucleic acid manipulation system, prepared by the preparation method according to any one of claims 1 to 16.
18. An isolated polynucleotide, wherein: The polynucleotide comprises a nucleotide sequence encoding the engineered DEAR nucleic acid manipulation system of claim 17.
19. A nucleic acid construct, wherein: The nucleic acid construct comprises the isolated polynucleotide of claim 18.
20. A carrier, wherein The vector comprises the isolated polynucleotide of claim 18, or the nucleic acid construct of claim 19.
21. A cell, wherein: The cell comprises the engineered DEAR nucleic acid manipulation system of claim 17, the isolated polynucleotide of claim 18, the nucleic acid construct of claim 19, or the vector of claim 20.
22. A reagent or a kit, wherein: The reagent or kit comprises the engineered DEAR nucleic acid manipulation system of claim 17, the isolated polynucleotide of claim 18, the nucleic acid construct of claim 19, the vector of claim 20, or the cell of claim 21.
23. A pharmaceutical composition, wherein: The pharmaceutical composition comprises the engineered DEAR nucleic acid manipulation system of claim 17, the isolated polynucleotide of claim 18, the nucleic acid construct of claim 19, the vector of claim 20 or the cell of claim 21; and, optionally, a pharmaceutically acceptable carrier.
24. A method for modifying a target nucleic acid, the method comprising the step of contacting the target nucleic acid with the DEAR nucleic acid manipulation system of claim 17, the isolated polynucleotide of claim 18, the nucleic acid construct of claim 19, the vector of claim 20, the cell of claim 21, or the reagent or kit of claim 22.
25. Use of the DEAR nucleic acid manipulation system as described in claim 17, the isolated polynucleotide as described in claim 18, the nucleic acid construct as described in claim 19, the vector as described in claim 20, and the cell as described in claim 21 in modifying target nucleic acids or preparing reagents or kits for modifying target nucleic acids.