Application of silkworm TUSC3 gene in prevention and treatment of silkworm nucleopolyhedrovirus infection

By targeting and interfering with or inhibiting the expression or function of the silkworm TUSC3 gene, and utilizing the small molecule inhibitor NGI-1 and siRNA interference technology, the problems of chemical residues and instability of biological agents in the prevention and control of silkworm nucleopolyhedrovirus infection in existing technologies have been solved, achieving efficient and sustainable virus control and cultivating antiviral silkworm strains.

CN122124247APending Publication Date: 2026-06-02JIANGSU UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGSU UNIV OF SCI & TECH
Filing Date
2026-03-19
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing technologies for preventing and controlling silkworm nucleopolyhedrovirus (BmNPV) infection suffer from problems such as chemical residue hazards, unstable efficacy of biological agents, and long disease-resistant breeding cycles. There is a lack of effective control strategies based on host-virus interaction mechanisms.

Method used

By targeting and interfering with or inhibiting the expression or function of the silkworm TUSC3 gene, the proliferation of BmNPV was suppressed by using the small molecule inhibitor NGI-1 and siRNA interference technology, and antiviral silkworm strains were cultivated through gene editing breeding.

Benefits of technology

This study effectively inhibits the proliferation of BmNPV, providing a green, efficient, and sustainable control method. It elucidates the molecular mechanism of the interaction between silkworm and BmNPV, and provides technical support for the development of new antiviral strategies based on host factors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122124247A_ABST
    Figure CN122124247A_ABST
Patent Text Reader

Abstract

This invention discloses the application of the silkworm TUSC3 gene in the prevention and control of silkworm nucleopolyhedrovirus (BmNPV) infection. This invention is the first to discover that the silkworm TUSC3 gene is a key host factor upon which BmNPV replication depends. Through NGI-1 inhibitor treatment, siRNA interference, and overexpression experiments, the crucial role of TUSC3 in BmNPV proliferation was systematically demonstrated at three levels: drug inhibition, gene knockdown, and gene overexpression. Targeting the TUSC3 gene or its encoded protein using RNA interference technology, small molecule inhibitors, or gene editing effectively inhibits BmNPV proliferation. Through gene editing breeding technology, transgenic antiviral silkworm lines with TUSC3 function loss or downregulated expression were cultivated. This invention not only provides a new perspective for elucidating the molecular mechanism of the interaction between silkworm and BmNPV, but also provides important technical support and germplasm resources for developing new antiviral strategies based on host factors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the interdisciplinary field of molecular biology and virus prevention and control, specifically involving the application of the silkworm tumor suppressor candidate 3 (TUSC3) in the prevention and control of silkworm nucleopolyhedrovirus (BmNPV) infection. Background Technology

[0002] Bombyx mori nucleopolyhedrovirus (BmNPV), a representative member of the Baculoviridae family, poses a persistent threat to sericulture. Infected larvae exhibit decreased appetite, white spots on the body wall, and swelling of the body segments, ultimately dying from tissue disintegration. This virus spreads rapidly, and outbreaks in sericulture areas often lead to a significant drop in cocoon production, causing severe economic losses to silkworm farmers and becoming a key factor restricting the sustainable development of the industry. Therefore, elucidating the viral pathogenesis and developing corresponding control measures has significant industrial value. Currently, BmNPV control relies heavily on chemical disinfection, biological control, and disease-resistant breeding. Chemical agents pose risks of residue hazards and drug resistance, while biological agents have unstable effects and unclear mechanisms. Disease-resistant breeding has a long cycle, and resistance is easily affected by the environment. Existing technologies have obvious limitations, necessitating the development of novel control strategies based on host-virus interaction mechanisms.

[0003] Tumor suppressor candidate gene 3 (TUSC3) was first discovered in the 8p22 region of human chromosomes. Its encoded protein serves as the catalytic subunit of an oligosaccharide transferase complex on the endoplasmic reticulum membrane, participating in the initiation of protein N-glycosylation, a process crucial for the proper folding of secretory and membrane proteins. In mammals, TUSC3 dysfunction is associated with various tumorigenesis, and its mechanism involves endoplasmic reticulum stress responses induced by glycosylation defects. Evolutionary analysis shows that TUSC3 is highly conserved in eukaryotes; from yeast and fruit flies to mammals, members of this family consistently maintain core functions of glycosylation homeostasis. The silkworm genome contains orthologs of TUSC3, and evolutionary analysis shows that it is most closely related to its fruit fly homologs, retaining conserved domains of mammalian TUSC3. Based on functional conservation, silkworm TUSC3 likely plays a role in endoplasmic reticulum N-glycosylation. N-glycosylation modification has a dual significance in viral infection: the host glycosylation system participates in viral envelope protein processing, while abnormal glycosylation can induce endoplasmic reticulum stress and activate host defense responses. However, there are no reports to date on whether BmTUSC3 can inhibit the proliferation of silkworm nucleopolyhedrovirus. Summary of the Invention

[0004] Purpose of the invention: This invention is the first to discover that the silkworm TUSC3 gene (LOC101747213) is a key host factor on which BmNPV replication depends, and that BmNPV proliferation can be effectively inhibited by targeting and interfering with the expression or function of TUSC3.

[0005] The purpose of this invention is to provide the application of inhibiting, interfering with, or downregulating the expression of the silkworm TUSC3 protein with an amino acid sequence as shown in SEQ ID NO.3 in the preparation of a drug for preventing and treating silkworm nucleopolyhedrovirus infection.

[0006] Another object of the present invention is to provide the use of the inhibition, knockdown or knockout of the silkworm TUSC3 gene with nucleotide sequences such as SEQ ID NO.1 or SEQ ID NO.2 in the preparation of a drug for preventing and treating silkworm nucleopolyhedrovirus infection.

[0007] Another objective of this invention is to provide a method for cultivating transgenic antiviral silkworm strains.

[0008] Technical solution: This invention provides the application of inhibiting, interfering with, or downregulating the expression of the silkworm TUSC3 protein with an amino acid sequence as shown in SEQ ID NO.3 in the preparation of a drug for preventing and treating silkworm nucleopolyhedrovirus infection.

[0009] The present invention also provides the application of the inhibition, knockdown or knockout of the silkworm TUSC3 gene with nucleotide sequences such as SEQ ID NO.1 or SEQ ID NO.2 in the preparation of drugs for preventing and treating silkworm nucleopolyhedrovirus infection.

[0010] The inhibition includes inhibitors that suppress viral genome replication, transcription, and / or protein expression.

[0011] The inhibitor is NGI-1.

[0012] The knockdown is performed using siRNA interference. Preferably, the siRNA interference is performed by transfecting silkworm cells with the siRNA.

[0013] The siRNA has the following positive strand: GCAUGUUAACGAUGAAUAUUU and the antisense strand: AUAUUCAUCGUUAACAUGCUG.

[0014] The present invention also provides a method for cultivating a transgenic antiviral silkworm strain, the method comprising inhibiting, interfering with or downregulating the expression or activity of the silkworm TUSC3 protein with an amino acid sequence as shown in SEQ ID NO.3.

[0015] The inhibition, interference, or downregulation of the expression or activity of the silkworm TUSC3 protein includes inhibiting, knocking down, or eliminating the expression of the silkworm TUSC3 gene. Preferably, the inhibition, knocking down, or elimination is achieved by adding an inhibitor, siRNA interference, or gene editing.

[0016] The inhibitor is NGI-1, and the sense strand of the siRNA is GCAUGUUAACGAUGAAUAUUU and the antisense strand is AUAUUCAUCGUUAACAUGCUG.

[0017] To investigate the expression changes of TUSC3 during BmNPV infection, as one embodiment of this invention, the expression of the TUSC3 gene in silkworm BmN cells after BmNPV infection was first quantitatively detected. The results showed that the transcriptional level of TUSC3 exhibited a dynamic trend after BmNPV infection: TUSC3 expression gradually increased in the early stage of infection (12-24 hours), reaching a peak at 24 hours; subsequently, the expression level began to decline, remaining at a low level in the later stage of infection (48-72 hours). This expression pattern suggests that TUSC3 may be induced by the virus in the early stage of BmNPV infection to support viral replication.

[0018] Given that TUSC3 is one of the core subunits of the oligosaccharide transferase complex (OST complex), to investigate the role of the OST complex in the proliferation of BmNPV, as one embodiment of this invention, the silkworm BmN cells were first treated with the OST complex-specific small molecule inhibitor NGI-1. The effect of different concentrations of NGI-1 on BmN cell viability was determined using the CCK-8 assay, and three safe concentrations (1 μM, 2 μM, and 5 μM) with no significant effect on cell viability (cell survival rate >90%) were selected for subsequent antiviral experiments. The results showed that NGI-1 treatment could inhibit BmNPV proliferation in a dose-dependent manner. Specifically, with increasing inhibitor concentration, the viral titer (TCID50) showed a gradient decreasing trend. The half-maximal inhibitory concentration (LogIC50) of the DMSO control group was -5.130, while the 1 μM, 2 μM, and 5 μM treatment groups were -5.053, -4.122, and -3.492, respectively, indicating that the higher the inhibitor concentration, the more significant the decrease in viral titer. Meanwhile, absolute quantitative PCR targeting the ie-1 gene showed that the viral genome copy number decreased by approximately 2.5 orders of magnitude in the 5 μM NGI-1 treatment group compared to the control group; the transcriptional level of the viral envelope glycoprotein GP64 decreased significantly with increasing inhibitor concentration; and Western blotting results showed a significant decrease in the band intensity of the viral late structural protein VP39 in the 5 μM NGI-1 treatment group. These results indicate that the glycosylation function of the OST complex plays an important role in BmNPV replication. Combined with the upregulation of TUSC3 expression in the early stages of infection, this further suggests that TUSC3, as a key subunit of the OST complex, may play an important role in BmNPV replication.

[0019] To further clarify the specific function of TUSC3, as one embodiment of this invention, multiple siRNA interference primers targeting the silkworm TUSC3 gene were designed and synthesized. TUSC3-1 (interference efficiency of 78%) was selected by qRT-PCR for subsequent experiments, achieving the best interference efficiency. After transfecting BmN cells with TUSC3-specific siRNA to knock down endogenous expression, BmNPV virus was inoculated, and viral proliferation indicators were detected 48 hours post-infection. Results showed that interference with TUSC3 expression significantly inhibited BmNPV proliferation. Specifically, the viral genome copy number (targeting the ie-1 gene) was significantly lower than the control group at 48 hpi; the transcription level of the viral GP64 gene was significantly downregulated; TCID50 viral titer assays showed that the yield of infectious viral particles in the supernatant of the interference group decreased by approximately 1.8 orders of magnitude compared to the control group at 48 hpi; and Western blotting results showed that the expression level of viral VP39 protein was significantly weakened in the interference group, with grayscale analysis showing it was only 0.25 times that of the control group. The above results indicate that the expression of endogenous TUSC3 is essential for the efficient replication of BmNPV.

[0020] To further verify the functional specificity of TUSC3, as one embodiment of this invention, a pIZT-Mcherry-TUSC3 overexpression vector was constructed, transfected into BmN cells, and then infected with BmNPV after verification by qRT-PCR. The results showed that TUSC3 overexpression significantly promoted viral replication: contrary to the interference experiment, the overexpression group showed significantly increased viral ie-1 genome copy number, GP64 transcription level, TCID50 viral titer, and VP39 protein expression. The overexpression and interference experiments corroborated each other, jointly demonstrating that TUSC3 is a key host factor upon which BmNPV replication depends.

[0021] Based on the above experimental results, this invention proposes the following mechanism of action: During host cell infection, BmNPV may hijack the host cell's TUSC3 and its mediated glycosylation function for the processing and maturation of its own viral proteins. These viral proteins play important roles in key stages such as viral adsorption, invasion, assembly, and release, and their proper glycosylation modification is crucial for correct protein folding, intracellular transport, and the performance of biological functions. When TUSC3 expression is interfered with or its function is inhibited, the glycosylation catalytic activity of the OST complex is impaired, leading to abnormal viral protein processing, thereby affecting viral particle assembly and infectivity, and ultimately inhibiting viral proliferation.

[0022] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: This invention is the first to discover that the silkworm TUSC3 gene is a key host factor on which BmNPV replication depends. Through NGI-1 inhibitor treatment, siRNA interference, and overexpression experiments, this invention systematically confirmed the crucial role of TUSC3 in BmNPV proliferation from three levels: drug inhibition, gene knockdown, and gene overexpression. The experimental evidence is sufficient and the conclusions are reliable. Based on this discovery, this invention can effectively inhibit BmNPV proliferation by targeting the TUSC3 gene or its encoded protein using RNA interference technology, small molecule inhibitors, or gene editing. Furthermore, gene editing breeding technology can be used to cultivate transgenic antiviral silkworm lines with TUSC3 function loss or downregulated expression, thereby achieving green, efficient, and sustainable control of BmNPV. This invention not only provides a new perspective for elucidating the molecular mechanism of interaction between silkworm and BmNPV, but also provides important technical support and germplasm resources for developing new antiviral strategies based on host factors. Attached Figure Description

[0023] Figure 1 This study investigated the changes in TUSC3 transcription levels in the BmN cell line after BmNPV infection.

[0024] Figure 2 The effect of NGI-1, an inhibitor of the OST complex, on the proliferation of BmNPV in silkworm cells. A: Cytotoxicity CCK8 assay; B: Changes in viral ie-1 gene copy number after treatment with different concentrations of NGI-1; C: Changes in viral GP64 transcription level after treatment with different concentrations of NGI-1; D: Changes in viral titer (TCID50) after treatment with different concentrations of NGI-1; E: Changes in viral VP39 protein expression level after treatment with different concentrations of NGI-1.

[0025] Figure 3 The effect of TUSC3 overexpression on BmNPV proliferation in silkworm cells. A: TUSC3 overexpression efficiency; B: Change in viral ie-1 gene copy number after TUSC3 overexpression; C: Change in viral GP64 transcription level after TUSC3 overexpression; D: Change in viral titer (TCID50) after TUSC3 overexpression; E: Change in viral VP39 protein expression level after TUSC3 overexpression.

[0026] Figure 4 The effect of TUSC3 knockdown on BmNPV proliferation in silkworm cells. A: TUSC3 knockdown efficiency; B: Change in viral ie-1 gene copy number after TUSC3 knockdown; C: Change in viral GP64 transcription level after TUSC3 knockdown; D: Change in viral titer level (TCID50) after TUSC3 knockdown; E: Change in viral VP39 protein expression level after TUSC3 knockdown. Detailed Implementation

[0027] The technical solution of the present invention will be further described in detail below through specific embodiments. It should be understood that these embodiments are only descriptions of preferred embodiments of the present invention and are not intended to limit the scope of protection claimed by the present invention. The primers and interference sequences used in the embodiments are shown in Table 1. All primers used were synthesized by Sangon Biotech (Shanghai) Co., Ltd. For the interference sequence of the target gene, the company was first commissioned to synthesize a single strand of DNA encoding siRNA. Then, a double-stranded template was formed by annealing, and transcription was performed using the Vazyme® T7 RNAi Transcription Kit in vitro transcription kit. After purification, siRNA for subsequent experiments was obtained.

[0028] Table 1 Primer sequences

[0029]

[0030] Example 1: Cloning and identification of the silkworm TUSC3 gene and the dynamic effect of BmNPV infection on its transcriptional level

[0031] BmN cells (bombyx ovarian cells, BmN) in the logarithmic growth phase were inoculated with BmNPV virus solution at an MOI of 0.5. Cell samples were collected at 0, 12, 24, 48, and 72 hours post-infection, with three biological replicates for each group. Both BmN cells and BmNPV virus solution were provided by the Silkworm Pathology Group of the College of Biotechnology, Jiangsu University of Science and Technology, and are derived from the doctoral dissertation "Molecular Mechanism of Lnc557 Regulating BmNPV Proliferation" [D]. Lin Su. Jiangsu University of Science and Technology, 2024.

[0032] Total RNA was extracted from each sample using the Trizol method, and the RNA was reverse transcribed into cDNA using the Vazyme® HisyGo RT Red SuperMix for qPCR (+gDNA Wiper) Reverse Transcription Kit (catalog number: RT101-01). Real-time quantitative PCR (qRT-PCR) was performed using the Vazyme® ChamQSYBR qPCR Master Mix (Low ROX Premixed) Quantitative Kit (catalog number: Q331-02) with TUSC3-specific primers qPCR-BmTUSC3 (sequence shown in Table 1). Data normalization was performed using the silkworm BmGAPDH gene as an internal control. The qPCR reaction system is shown in Table 2 below.

[0033] Table 2

[0034]

[0035] The amplification procedure was as follows: pre-denaturation at 95°C for 30 seconds; followed by 35 cycles, each cycle consisting of denaturation at 95°C for 10 seconds, annealing at 60°C, and extension for 30 seconds. The relative expression level of the TUSC3 gene was calculated using the 2⁻ΔΔCT method. Experimental results are expressed as mean ± standard deviation (SD), and differences between groups were statistically analyzed using t-tests. The significance level was set as follows: p < 0.05 indicated significant difference (marked with *), and p < 0.01 indicated highly significant difference (marked with **).

[0036] The results are as follows Figure 1 As shown, the transcriptional level of TUSC3 in silkworm BmN exhibits a dynamic trend after BmNPV infection: TUSC3 expression gradually increases in the early stage of infection (12-24 hours), reaching a peak at 24 hours; subsequently, the expression level begins to decline, remaining at a low level in the later stage of infection (48-72 hours). This expression pattern suggests that TUSC3 may be induced by the virus in the early stage of BmNPV infection to support viral replication.

[0037] Example 2: Effect of OST inhibitor NGI-1 on BmNPV proliferation

[0038] 1. Cytotoxicity test

[0039] BmN cell suspension was seeded into 96-well plates at a volume of 100 μL per well, with a cell density of approximately 2–3 × 10⁻⁶ cells / well. 5 Cells were cultured at 27°C for 24 hours at a concentration of 1 / mL. After the cells adhered and grew stably, different concentrations of NGI-1 solution were added to each well. The inhibitor NGI-1 (catalog number: HY-117383) was purchased from MedChemExpress (Monmouth Junction, NJ, USA). NGI-1 was dissolved in DMSO to prepare a stock solution. Final concentrations of 1 μM, 2 μM, 5 μM, 10 μM, 20 μM, and 50 μM were set, with 6 replicates for each concentration gradient. A blank control (containing only culture medium, no cells) and a negative control (containing an equal volume of DMSO) were also set up. After culturing for another 12 hours, 10 μL of CCK-8 reagent (purchased from Xinsaimei Biotechnology Co., Ltd., Cell Counting Kit-8, catalog number: C6005) was added to each well, and the cells were incubated at 27°C in the dark for 4 hours. The absorbance (OD) value at 450 nm was then measured using a microplate reader. Cell viability is calculated using the following formula: Viability (%) = (OD value of experimental group - OD value of blank group) / (OD value of control group - OD value of blank group) × 100%.

[0040] Experimental results ( Figure 2A) indicates that when the NGI-1 concentration is ≤5 μM, cell viability remains above 90%, with no significant difference compared to the negative control group, indicating that NGI-1 has no significant toxic effect on BmN cells within this concentration range. However, when the NGI-1 concentration reaches 10 μM or higher, cell viability decreases significantly, suggesting enhanced cytotoxicity. Based on these results, 1 μM, 2 μM, and 5 μM were selected as safe working concentrations for subsequent antiviral experiments.

[0041] 2. Antiviral experiment

[0042] BmN cell suspension was seeded at 1 mL per well in 12-well plates, with a cell density of approximately 2-3 × 10⁶ cells / well. 5 Cells were divided into a control group (DMSO treatment) and an NGI-1 treatment group (final concentrations of 1 μM, 2 μM, and 5 μM, respectively). After 12 hours of treatment, BmNPV virus solution was inoculated at an MOI of 0.5. Twelve hours post-infection, NGI-1 inhibitor was added by replacing half the medium to maintain final concentrations of 1 μM, 2 μM, and 5 μM. Forty-eight hours post-infection, cells and supernatant were collected for the following assays:

[0043] (1) Viral genome copy number detection: Cell samples were collected, and total DNA was extracted using the Sangon® Ezup Column Animal Genomic DNA Extraction Kit (catalog number: B518251-0100). The extracted DNA was uniformly diluted to approximately 50 ng / μL for later use. The recombinant plasmid containing the BmNPV very early gene ie-1-1457 fragment was used as a standard (corresponding to the reference plasmid for the ie-1-1457 gene fragment in the following article, Zhang N, Zhou XM, Jiao XH, et al. Field-deployable CRISPR-Dx for BmNPV and Nosema bombycis: DNA-extraction-free one-pot RPA-Cas12a and Cas12a / Cas13a dual-gene assays with handheld devices. InsectBiochem Mol Biol, 2026, 186: 104449.), and was serially diluted 10-fold to obtain concentrations ranging from 10 to 10. 2 ~10 8 7 gradients per copies / μL (10 2 10 3 10 4 10 5 10 6 10 7 10 8Using [a specific sample] as a template, absolute quantitative PCR was performed using the Vazyme® ChamQ SYBRqPCR Master Mix (Low ROX Premixed) quantitative kit (catalog number: Q331-02) (reaction system shown in Table 2). The test sample and the standard were amplified simultaneously. Based on the standard curve established using the standard, the copy number of the ie-1 gene in the test sample was calculated to assess the replication level of the BmNPV genome. Results are as follows: Figure 2 As shown in Figure B, NGI-1 treatment significantly reduced the intracellular viral genome replication level. Compared with the DMSO control group, the viral genome copy number in the 1 μM and 2 μM NGI-1 treatment groups decreased to approximately 1 / 3 and 1 / 10 of the control group, respectively, while the 5 μM treatment group showed the most significant decrease in viral genome copy number, which was reduced by approximately 2.5 orders of magnitude compared with the control group. This indicates that inhibiting the function of the OST complex can effectively interfere with the viral genome replication process.

[0044] (2) Detection of viral gene transcription level: Total RNA was extracted from cells using the Trizol method and analyzed using Vazyme. ® The HisyGo RTRed SuperMix for qPCR (+gDNA Wiper) Reverse Transcription Kit (catalog number: RT101-01) reverse transcribes RNA into cDNA. Real-time quantitative PCR is then performed targeting the viral envelope protein gene GP64. Results are as follows: Figure 2 As shown in Figure C, the transcriptional level of the GP64 gene decreased in a gradient with increasing NGI-1 concentration. Compared with the DMSO control group, the GP64 mRNA levels in the 1 μM, 2 μM, and 5 μM treatment groups decreased to 0.65-fold, 0.32-fold, and 0.18-fold, respectively, with statistically significant differences (p < 0.05 or p < 0.01). This result indicates that inhibition of the OST complex can affect the transcriptional expression of viral genes.

[0045] (3) Viral protein expression detection: Total protein was extracted from BmN cells infected with BmNPV using RIPA lysis buffer (Beyotime, China, catalog number P0013B) and quantified using BCA protein concentration assay kit (Beyotime, China, catalog number P0010). Equal amounts of protein were separated by SDS-PAGE and transferred to a PVDF membrane (Millipore catalog number ISEQ00010). After blocking with 5% skim milk, the membrane was incubated overnight at 4°C with VP39 rabbit polyclonal antibody (1:2000; VP39 protein synthesized based on the full-length amino acid sequence of VP39 protein with GenBank accession number NP_047489.1, and used by Shanghai Youke Biotechnology Co., Ltd. to prepare VP39 rabbit polyclonal antibody) and β-tubulin mouse monoclonal antibody (1:10000; Protech, USA, catalog number 66240-1-lg). Subsequently, the membrane was incubated at room temperature with the corresponding HRP-labeled secondary antibody (1:4000; Beyotime Biotech, China, catalog number A0208 / A0216). Chemiluminescence detection was performed using the EasySee immunoblotting kit (TransGold, China, catalog number DW101-02). The results are as follows: Figure 2 As shown in Figure E, the VP39 protein band was clear in the DMSO control group. The intensity of the VP39 band decreased in a dose-dependent manner with increasing NGI-1 treatment concentration. Specifically, the expression level of VP39 gradually decreased in the 1 μM and 2 μM treatment groups, and the band in the 5 μM treatment group was almost undetectable. Quantitative analysis of grayscale values ​​showed that its expression level was only 0.08 times that of the control group.

[0046] (4) Virus titer determination (TCID50): Collect cells, briefly centrifuge, and take the supernatant. Perform 10-fold serial dilutions (10... -2 10 -3 10 -4 10 -5 10 -6 10 -7 BmN cells were then seeded into 96-well plates, with eight replicates for each dilution. After incubation at 27°C for 3-5 days, the number of infected wells displaying green fluorescence (eGFP positive) was observed and counted under a fluorescence microscope. The TCID50 value was calculated using the Reed-Muench method. The specific calculation formula is as follows:

[0047] Distance ratio = (infection rate of dilutions with an infection rate higher than 50% - 50%) / (infection rate of dilutions with an infection rate higher than 50% - infection rate of dilutions with an infection rate lower than 50%)

[0048] lgTCID50 = logarithm of dilution (above 50% infection rate) + distance ratio × logarithm of dilution factor

[0049] TCID50 / mL = 10^(lgTCID50) / inoculum volume per well (mL)

[0050] The results are as follows Figure 2 As shown in D, NGI-1 treatment dose-dependently reduced the viral titer of BmNPV. The TCID50 of the DMSO control group was 10. 6.8 / mL, while the TCID50 of the 1μM, 2μM and 5μM NGI-1 treatment groups were 10, respectively. 6.5 / mL, 10 5.2 / mL and 10 4.3 / mL, showing a gradient decreasing trend, indicating that the viral titer decreases more significantly as the inhibitor concentration increases.

[0051] In summary, the assays, including viral titer, genome copy number, gene transcription, and protein expression, consistently demonstrated that NGI-1 treatment dose-dependently inhibited BmNPV proliferation. Given that TUSC3 is one of the core catalytic subunits of the OST complex, these results suggest that the OST complex and its subunit TUSC3 may play a crucial role in BmNPV replication.

[0052] Example 3: Effects of TUSC3 overexpression / knockdown on BmNPV proliferation in cells

[0053] 1. Construction of overexpression vectors

[0054] The pIZT / V5-His-mCherry expression vector was linearized by double digestion with EcoRI and XbaI restriction endonucleases (Takara, Japan, catalog number 1611 / 1634). This expression vector was provided by the Pathology Group of the School of Biotechnology, Jiangsu University of Science and Technology (the pIZT / V5-His-mCherry expression vector is consistent with that in the article, Wang XY, Wu KH, Pang HL, et al. Study on the Role of Cytc in Response to BmNPV Infection in Silkworm[J]. International Journal of Molecular Sciences, 2019, 20(18): Using cDNA from the midgut tissue of silkworms (4325.), the complete CDS sequence of TUSC3 was amplified by PCR using specific primers containing restriction enzyme sites (primers designed to contain EcoRI / XbaI restriction sites; the sequence of primer pIZT-TUSC3 is shown in Table 1). After PCR purification, the target gene insert was ligated with the linearized vector at an optimized molar ratio of 1:5 using T4 ligase (Takara, Japan, catalog number 2011A) (incubated overnight at 16°C). The ligation product was transformed into DH5α competent cells (Coolaber, China, catalog number CC501) and plated on low-sodium LB plates supplemented with Zeocin (bleomycin, purchased from Thermo Fisher Scientific, catalog number R25001) to screen for positive clones. Colony PCR and sequencing confirmed the recombinant overexpression vector pIZT-TUSC3-Mcherry-V5-His.

[0055] 2. Synthesis of siRNA

[0056] siRNA was synthesized via in vitro transcription using the Vazyme® T7 RNAi Transcription Kit (catalog number: TR102-01). Three pairs of specific interference primers were designed and synthesized based on the TUSC3 gene sequence (sequences of the three siRNA primer pairs are shown in Table 1). After annealing, three double-stranded DNA templates were obtained. The annealing program was as follows: heating at 95°C for 2 min, followed by slow cooling to 22°C at a rate of 0.1°C / sec, and holding for 10 min. The three annealed products were mixed with NTP Mix, transcription buffer, and T7 enzyme, and transcribed in vitro at 37°C for 4 h to obtain three initial transcription products. After transcription, a two-enzyme digestion system was prepared according to Table 3, adding DNase I and diluted RNase T1 (10 U / μL), and digesting at 37°C for 30 min to remove the DNA template and cleave the long RNA. The digestion products were then purified using the Vazyme® RNA Clean Beads purification kit (catalog number: TR102-01). After incubation at room temperature and washing, the purified siRNA-1, siRNA-2, and siRNA-3 were obtained by elution with RNase-free water. After concentration determination, they were stored at -80°C for later use.

[0057] Table 3

[0058]

[0059] 3. Verification of cell transfection and overexpression / knockdown efficiency

[0060] BmN cells of silkworms in logarithmic growth phase with a density of 80% were seeded in 12-well plates for overexpression and interference experiments. The overexpression experiment consisted of an overexpression group (transfected with the TUSC3 overexpression vector: pIZT / V5-His-mCherry-TUSC3) and a control group (transfected with the vector pIZT / V5-His-mCherry as an empty vector). The knockdown experiment consisted of a knockdown group (transfected with three specific TUSC3-targeting siRNAs: siRNA-1, siRNA-2, and siRNA-3) and a negative control group (transfected with si-NC, and annealing the sense and antisense strands of NC to obtain si-NC). Each group had three biological replicates. Overexpression plasmid transfection was performed according to the Lipo8000™ (Beyotime, China, catalog number: C0533) manufacturer's instructions: 1 μg of plasmid pIZT / V5-His-mCherry-TUSC3 was mixed with 1.6 μL of transfection reagent, and serum-free TC-100 medium (powder, purchased from Gibco, Thermo Fisher Scientific, USA, catalog number 11300-043) was added to a final volume of 50 μL. Cells were then added to 12-well plates and cultured at 27°C. For siRNA transfection, 40 pmol of siRNA and 1.6 μL of transfection reagent were added to 50 μL of serum-free medium and incubated at room temperature for 20 min before adding cells. 48 h after transfection, mCherry red fluorescence was observed under a fluorescence microscope to assess overexpression transfection efficiency. Cells were collected, and total RNA was extracted using the Trizol method. cDNA was synthesized via reverse transcription, and BmGAPDH was used as an internal control gene. The transcription level of TUSC3 was detected by qPCR. The qPCR reaction system is shown in Table 2. A 2⁻¹² qPCR reaction mixture was used. ΔΔCT The relative expression level of TUSC3 was calculated using this method. The results showed that ( Figure 3 In the A group, the TUSC3 mRNA level in the OE-TUSC3 overexpression group was 8.7 times that of the control group, with a highly significant difference (p<0.01); the TUSC3-siRNA-1 with the best interference efficiency was obtained from the knockdown group. Figure 4 In the A group, the TUSC3 mRNA level was reduced by 78% compared with the negative control group, which was highly significant (p<0.01). TUSC3-siRNA-1 will be used for subsequent experiments. These results demonstrate that TUSC3 overexpression and knockdown were successfully achieved and can be used for further functional studies.

[0061] 4. Viral infection and detection

[0062] After transfecting the overexpression and knockdown cell groups from step 3 for 48 hours, they were inoculated with BmNPV virus solution at MOI=0.5. Both BmN cells and BmNPV virus solution were provided by the Silkworm Pathology Group of the College of Biotechnology, Jiangsu University of Science and Technology, and were derived from the doctoral dissertation "Molecular Mechanism of Lnc557 Regulating BmNPV Proliferation" [D]. Lin Su. Jiangsu University of Science and Technology, 2024. Cells and supernatant were collected 48 hours post-infection, and virus proliferation-related indicators were detected. After overexpression of TUSC3, virus proliferation showed a significant upward trend: absolute quantitative PCR results are as follows... Figure 3 As shown in B, the copy number of the ie-1 genome in the overexpression group was significantly higher than that in the control group, approximately 3.2 times that of the control group; qPCR results are as follows. Figure 3 The C-value in the data showed that the transcriptional level of the viral envelope protein GP64 was upregulated to 2.8 times that of the control group; the TCID50 viral titer assay results were as follows: Figure 3 The D-values ​​in the study showed that the yield of infectious viral particles in the supernatant of the overexpression group increased by approximately 1.5 orders of magnitude compared to the control group; Western blotting results were as follows. Figure 3 As shown in E, the expression level of the viral late structural protein VP39 was significantly enhanced in the overexpression group, with grayscale analysis showing it to be approximately 3.6 times that of the control group. In the interference experiment, knockdown of TUSC3 expression significantly inhibited BmNPV proliferation and reduced viral genome copy number ( Figure 4 B), GP64 transcription level ( Figure 4 C) Viral titer ( Figure 4 D) and VP39 protein expression ( Figure 4 The levels of E in the viral genome were significantly reduced. Methods for detecting viral genome copy number, viral gene transcription level, viral titer (TCID50), and viral protein expression were all performed as described in Example 2.

[0063] Overexpression and knockdown experiments corroborated each other, confirming that TUSC3 is a key host factor upon which BmNPV replication depends, rather than a host defense mechanism against viral infection. During infection, the virus may hijack TUSC3 and its mediated glycosylation function in host cells for the processing and maturation of its own viral proteins, thereby completing its replication cycle. Therefore, targeting and interfering with TUSC3 function can inhibit viral proliferation by disrupting the normal modification of viral proteins.

Claims

1. Application of inhibiting, interfering with, or downregulating the expression of the silkworm TUSC3 protein with an amino acid sequence as shown in SEQ ID NO.3 in the preparation of drugs for preventing and treating silkworm nucleopolyhedrovirus infection.

2. The application of inhibition, knockdown, or knockout of the silkworm TUSC3 gene with nucleotide sequences as shown in SEQ ID NO.1 or SEQ ID NO.2 in the preparation of drugs for preventing and treating silkworm nucleopolyhedrovirus infection.

3. The application according to claim 1 or 2, characterized in that, The inhibition includes inhibitors that suppress the replication level, transcription level, and / or protein expression level of the viral genome.

4. The application according to claim 3, characterized in that, The inhibitor is NGI-1.

5. The application according to claim 2, characterized in that, The knockdown is performed using siRNA interference. Preferably, the siRNA interference is performed by transfecting silkworm cells with the siRNA.

6. The application according to claim 5, characterized in that, The sense strand of the siRNA is GCAUGUUAACGAUGAAUAUUU and the antisense strand is AUAUUCAUCGUUAACAUGCUG.

7. A method for cultivating a transgenic virus-resistant silkworm strain, characterized in that, The method includes inhibiting, interfering with, or downregulating the expression or activity of the silkworm TUSC3 protein with an amino acid sequence as shown in SEQ ID NO.

3.

8. The method for cultivating transgenic antiviral silkworm strains according to claim 7, characterized in that, The inhibition, interference, or downregulation of the expression or activity of the silkworm TUSC3 protein includes inhibiting, knocking down, or eliminating the expression of the silkworm TUSC3 gene.

9. The method for cultivating transgenic antiviral silkworm strains according to claim 8, characterized in that, The inhibition, knockdown, or elimination methods include adding inhibitors, siRNA interference, or gene editing.

10. The method for cultivating transgenic antiviral silkworm strains according to claim 9, characterized in that, The inhibitor is NGI-1, and the sense strand of the siRNA is GCAUGUUAACGAUGAAUAUUU and the antisense strand is AUAUUCAUCGUUAACAUGCUG.