Acetolactate synthase mutant, valine-producing strain, and construction method and application thereof
By mutating specific amino acid sequences of acetolactate synthase, a valine-producing strain was constructed, solving the problem of feedback inhibition of acetolactate synthase and achieving efficient and stable valine production.
Patent Information
- Application Number
- CN202610602792.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-06
- Publication Date
- 2026-06-02
AI Technical Summary
The existing acetyllactate synthase (AlsS) suffers from severe feedback inhibition at high concentrations of end products, resulting in insufficient catalytic efficiency and making it difficult to meet the needs of high-intensity industrial fermentation production.
By mutating specific amino acid sequences of acetolactate synthase, a mutant acetolactate synthase with feedback resistance and excellent catalytic properties was prepared. A valine-producing strain was constructed and its genes were edited and integrated.
The fermentation yield and genetic stability of the valine-producing strain were improved, achieving efficient and stable valine production with a significant increase in yield.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to the fields of metabolic engineering and genetic engineering, and in particular to an acetyllactate synthase mutant, a valine-producing strain, and their construction methods and applications. Background Technology
[0002] Valine, chemically known as 2-amino-3-methylbutyric acid, belongs to the branched-chain amino acids (BCAAs). It is an essential amino acid that cannot be synthesized autonomously by humans and animals, and has wide and important applications in feed additives, pharmaceutical intermediates, food fortifiers, and cosmetic raw materials. With the expansion of global livestock farming and the development of the health industry, the market demand for valine and other branched-chain amino acids continues to grow. Currently, industrial production of branched-chain amino acids mainly relies on microbial fermentation, utilizing genetically modified high-yield strains of Corynebacterium or Escherichia coli for large-scale preparation. In microorganisms, the biosynthesis of branched-chain amino acids is completed through a common precursor metabolic pathway. Acetolactate synthase (ALS, also known as acetylhydroxy acid synthase) catalyzes the condensation of two molecules of pyruvate to acetolactate (a precursor to the valine-leucine pathway), or catalyzes the condensation of pyruvate and α-ketobutyrate to acetylhydroxybutyrate (a precursor to the isoleucine pathway), and is the first key rate-limiting enzyme in this synthetic pathway. Therefore, the catalytic activity, substrate selectivity, and sensitivity to feedback inhibition of end products of acetolactate synthase directly determine the overall metabolic flux and production efficiency of microbial synthesis of branched-chain amino acids.
[0003] Among numerous acetolactate synthases derived from various microorganisms, the acetolactate synthase derived from Bacillus subtilis (encoded by the alsS gene, abbreviated as AlsS) has attracted considerable attention due to its unique enzymatic properties related to branched-chain amino acid synthesis. Unlike the AHAS isoenzyme in Escherichia coli, which is extremely sensitive to feedback inhibition of branched-chain amino acids, Bacillus subtilis AlsS naturally possesses a certain degree of feedback resistance, and its catalytic substrate pyruvate has a relatively high Km value, which is beneficial for maintaining a high catalytic rate in engineered strains with high concentrations of pyruvate accumulation.
[0004] However, wild-type AlsS exhibits limited feedback inhibition resistance. Its enzyme activity remains significantly inhibited as intracellular concentrations of end products such as valine and isoleucine increase in the later stages of fermentation, thus limiting the sustained and efficient output of metabolic flux. Furthermore, the soluble expression levels, thermal stability, and competitive selectivity of wild-type AlsS for substrates like pyruvate and α-ketobutyrate in heterologous hosts (such as Corynebacterium glutamicum or Escherichia coli) often fail to fully meet the stringent requirements for catalytic efficiency and robustness in high-intensity industrial fermentation production. Therefore, developing novel acetolactate synthase mutants with significant feedback resistance and excellent catalytic properties, and constructing stable and efficient valine-producing strains based on these mutants, is of significant industrial application value and practical importance for reducing production costs, increasing fermentation yield, and expanding the application scope of related platform compound biosynthetic pathways. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide an acetolactate synthase mutant.
[0006] Another technical problem to be solved by the present invention is to provide the application of the above-mentioned acetolactate synthase mutant.
[0007] Another technical problem to be solved by the present invention is to provide a valine-producing strain constructed using the above-mentioned acetyllactate synthase mutant.
[0008] Another technical problem to be solved by the present invention is to provide a method for constructing the above-mentioned valine-producing strain.
[0009] Another technical problem to be solved by the present invention is to provide the application of the above-mentioned valine-producing strain.
[0010] To solve the above-mentioned technical problems, the technical solution of the present invention is as follows: An acetolactate synthase mutant was obtained by mutation of acetolactate synthase. The amino acid sequence of the acetolactate synthase is shown in SEQ ID NO.3 of the sequence listing. The specific mutations are as follows: isoleucine (Ile) at position 325 is mutated to threonine (Thr, I325T), serine (Ser) at position 330 is mutated to arginine (Arg, S330R), and asparagine (Asn) at position 477 is mutated to aspartic acid (Asp, N477D). (The corresponding coding nucleotide mutations are as follows: nucleotides 973–975 (encoding position 325 Ile) are mutated from ATT (Ile) to ACT (Thr); nucleotides 988–990 (encoding position 330 Ser) are mutated from AGC (Ser) to AGG (Arg); and nucleotides 1429–1431 (encoding position 477 Asn) are mutated from AAC (Asn) to GAC (Asp)).
[0011] Preferably, the above-mentioned acetolactate synthase mutant has an amino acid sequence as shown in SEQ ID NO.4 of the sequence listing or has a sequence identity of more than 95% and originates from the same species.
[0012] Preferably, the above-mentioned acetolactate synthase mutant has a nucleotide sequence as shown in SEQ ID NO.2 of the sequence listing or has a sequence identity of more than 95% and originates from the same species.
[0013] The biological material associated with the above-mentioned acetolactate synthase mutant is any one of the following (a1) to (a4): (a1) The nucleic acid molecule encoding the above-mentioned acetolactate synthase mutant; (a2) An expression cassette containing the nucleic acid molecule described in (a1): (a3) A recombinant vector comprising the nucleic acid molecule described in (a1) or the expression cassette described in (a2); (a4) A recombinant microorganism comprising the nucleic acid molecule of (a1), the expression cassette of (a2), or the recombinant vector of (a3).
[0014] Preferably, in the above-mentioned biological material, the nucleotide sequence of the nucleic acid molecule encoding the acetolactate synthase mutant in (a1) is as shown in the sequence listing SEQ ID NO.2 or is more than 95% identical to the sequence and originates from the same species.
[0015] Preferably, in the above-mentioned biological materials, the vector skeleton of the recombinant vector in (a3) includes pK18, pK19, pK18mobsacB, pNV18, or pNV19, etc.
[0016] Preferably, in the above-mentioned biological material, the recombinant microorganisms in (a4) include Escherichia coli, Corynebacterium glutamicum, or Bacillus.
[0017] The above-mentioned acetyllactate synthase mutants or biological materials are used in the construction of valine-producing strains or the fermentation production of valine.
[0018] A valine-producing strain, obtained by modifying a starting strain, wherein the modification includes introducing multiple mutation sites into acetolactate synthase, and the nucleotide sequence of the acetolactate synthase mutant encoding gene after the introduction of multiple mutation sites is as shown in SEQ ID NO.2 of the sequence listing or is more than 95% identical to the sequence and originates from the same species.
[0019] Preferably, the valine-producing strain mentioned above is a wild-type Corynebacterium glutamicum. Corynebacterium glutamicum .
[0020] Preferably, the valine-producing strain mentioned above is wild-type Corynebacterium glutamicum ATCC13032.
[0021] Preferably, in the above-mentioned valine-producing strain, the nucleotide sequence of the acetolactate synthase is as shown in SEQ ID NO.1 or is more than 95% identical to the sequence and originates from the same species.
[0022] The specific steps for constructing the above-mentioned valine-producing strain are as follows: using gene editing technology, the acetolactate synthase mutant is integrated into the genome of the starting strain Corynebacterium glutamicum through homologous recombination to construct the recombinant strain.
[0023] Application of the above-mentioned valine-producing strains in the fermentation production of valine.
[0024] Preferably, in the above application, valine is produced using shake-flask fermentation, and the specific steps are as follows: (1) Seed activation and culture: The bacterial solution was evenly spread on the activation slant, and after culture, it was transferred to the activation slant for further culture, and then transferred to the seed culture medium for seed culture. (2) Fermentation culture: Inoculate the seed liquid into the fermentation medium, shake and culture, and maintain the pH at 7.0-7.2 during the fermentation process.
[0025] Preferably, in the above application, valine is produced using shake-flask fermentation, and the specific steps are as follows: (1) Seed activation and culture: The bacterial solution was evenly spread on the activation slant and cultured at 32℃ for 12h. The culture was then transferred to the activation slant and cultured for another 10h. Finally, the culture was transferred to a shaker containing seed culture medium for seed culture. (2) Fermentation culture: Inoculate the seed liquid into the Erlenmeyer flask containing the fermentation medium at a rate of 15%, seal the flask with gauze, and culture at 32℃ and 220r / min with shaking. During the fermentation process, urea is added to maintain the pH at 7.0-7.2.
[0026] Preferably, in the above application, the activation culture medium used is: glucose 1.0-3.0 g / L, peptone 8.0-12.0 g / L, yeast extract 4.0-6.0 g / L, sodium chloride 2.0-3.0 g / L, KH2PO4 0.8-1.2 g / L, MgSO4 0.1-0.3 g / L, agar powder 2.0-3.0%, adjusted to pH 7.0-7.2, with the remainder being water.
[0027] Preferably, in the above application, the activation culture medium used is: glucose 2.0 g / L, peptone 10.0 g / L, yeast extract 5.0 g / L, sodium chloride 2.5 g / L, KH2PO4 1.0 g / L, MgSO4 0.2 g / L, agar powder 2.5%, adjusted to pH 7.0-7.2, with the remainder being water.
[0028] Preferably, in the above application, the seed culture medium used is: yeast extract 7.0-9.0 g / L, peptone 2.0-4.0 g / L, KH2PO4 2.0-4.0 g / L, V B1 V B2 V B3 V B5 V B12 1-3 mg / L each, V H 0.5-1.5 mg / L, MgSO4·7H2O 0.4-0.6 g / L, the remainder is water.
[0029] Preferably, in the above application, the seed culture medium used is: yeast extract 8.0 g / L, peptone 3.0 g / L, KH2PO4 3.0 g / L, V B1 V B2 V B3 V B5 V B12 2 mg / L each, V H 1 mg / L, MgSO4·7H2O 0.5 g / L, the remainder is water.
[0030] Preferably, in the above application, the fermentation medium used is: glucose 70.0-90.0 g / L, corn flour 10.0-20.0 g / L, glutamic acid 1.0-3.0 g / L, KH2PO4 2.0-2.5 g / L, MgSO4·7H2O 1.0-2.0 g / L, FeSO4·7H2O 9-11 mg / L, V B1 V B2 V B3 V B5 V B12 Each 0.5-1.5 mg / L, V H 0.08-0.12 mg / L, phenol red 1-3%, the remainder is water.
[0031] Preferably, in the above application, the fermentation medium used is: glucose 80.0 g / L, corn flour 15.0 g / L, glutamic acid 2.0 g / L, KH2PO4 2.3 g / L, MgSO4·7H2O 1.5 g / L, FeSO4·7H2O 10 mg / L, V B1 V B2 V B3 V B5 V B12 1 mg / L each, V H 0.1 mg / L, phenol red 2%, the remainder is water.
[0032] All of the above-mentioned culture media can be prepared using standard methods.
[0033] Beneficial effects: The above-mentioned valine-producing strain was obtained by modifying an acetyllactate synthase mutant. The valine-producing strain does not contain plasmids, has no growth defects, does not require induction, and has advantages such as good genetic stability and high fermentation yield. It is an excellent strain that can stably produce valine. The strain can efficiently synthesize valine de novo using glucose as a substrate, and the valine yield is significantly improved. After 36 hours of shake-flask fermentation, the valine yield can reach up to 3.5 g / L. Detailed Implementation
[0034] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be further described in detail below with reference to specific embodiments.
[0035] The starting strain used in the examples was wild-type Corynebacterium glutamicum ATCC 13032 (commercially available, purchased from Shanghai Enzyme-Link Biotechnology Co., Ltd., catalog number ml-CC1275).
[0036] The acetyllactone synthase AlsS is the original sequence (nucleotide sequence shown in SEQ ID NO.5 of the sequence listing), derived from Bacillus subtilis 168. Genscript Biotech Co., Ltd. was commissioned to optimize the sequence codons of this gene based on the codon bias of Corynebacterium glutamicum, resulting in a new acetyllactone synthase. alsS- cgl (The amino acid sequence is shown in SEQ ID NO.3 and the nucleotide sequence is shown in SEQ ID NO.1), and the initial template was provided by the company.
[0037] The gene editing method used is based on the literature (Wang T, Li Y, Li J, et al. An update of the suicide plasmid-mediated genome editing system in Corynebacterium glutamicum. Microbial Biotechnology, 2019, 12: 907-919.). The technical terms such as gene integration and homologous recombination used in the following examples are explained in that article.
[0038] Example 1 Expression and purification of acetyllactate synthase The target gene derived from Bacillus subtilis alsS-cgl After ligation into plasmid pK18 (pK18mobSacB, purchased from Miaoling Plasmid Platform, catalog number P0100), the protein was expressed as a recombinant protein with a C-terminus His-tag in Corynebacterium glutamicum ATCC 13032. The protein was purified using a Ni-His binding column, and the purified protein was collected for SDS-PAGE. The electrophoresis results showed that AlsS was efficiently expressed in Corynebacterium glutamicum ATCC 13032, and the purified band was clear (~60 kDa), consistent with the theoretical molecular weight. This indicates that the target gene can be expressed in Corynebacterium glutamicum ATCC 13032 and undergo self-cleavage to produce an active subunit.
[0039] Example 2 Construction of mutant libraries and preparation of strains 2.1 Construction of random mutant libraries To obtain a dominant mutant of acetolactate synthase, alsS-cgl The gene was used as a mutation template, and a random mutant library was constructed using error-prone PCR with universal primers AF and AR. The sequence of universal primer AF is ttgacaaaagcaacaaaagaacaaaatcccttgtg (SEQ ID NO. 6), and the sequence of AR is tagagagctttcgttttcatgagttccc (SEQ ID NO. 7). The random mutation reaction system is shown in Table 1. When constructing the random mutant library, the mutation rate was controlled to be around 1% by changing the amount of template added, annealing temperature, and the amount of other components in the PCR system. Agarose gel electrophoresis results showed that the error-prone PCR bands were the correct size, and sequencing results showed that the mutation rate met the requirements. The PCR products were purified using a DNA purification kit (TIANGEN, China) to obtain... alsS-cgl A library of random mutant genes.
[0040] Table 1
[0041] 2.2 Preparation of strains containing random mutants; primers used are shown in Table 2. To insert the mutant into *Corynebacterium glutamicum* strain ATCC 13032, a vector containing the target mutant fragment was constructed. Specifically, primers Up-SS-F / Up-SS-R were designed to amplify the upstream homologous arm and primers Down-SS-F / Down-SS-R were designed to amplify the downstream homologous arm, targeting the insertion site noxA in *Corynebacterium glutamicum* strain ATCC 13032. The alsS fragment containing the homologous arm was amplified using primers alsS-F and alsS-R. The PCR reaction conditions were as follows: denaturation at 95°C for 5 minutes; followed by 29 cycles, each cycle consisting of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 150 seconds; and finally, extension at 72°C for 5 minutes.
[0042] The mutant fragment was ligated to its upstream and downstream homologous arms using a seamless cloning enzyme pk18 linear vector (pK18mobSacB, purchased from Miaoling Plasmid Platform, catalog number P0100), and then transformed into *E. coli* Top10 (purchased from Shanghai Angyu Biotechnology Co., Ltd., catalog number: G6015). After transforming the prepared gene into *E. coli* Top10, the transformed strains were selected in LB solid medium containing kanamycin. Plasmid DNA was obtained from the correct Top10 strains using a plasmid extraction kit, yielding the pk18-alsS-cgl vector containing the mutant.
[0043] The vector pk18-alsS-cgl was electroporated into *Corynebacterium glutamicum* ATCC13032 via homologous recombination on the chromosome. Strains that had inserted the vector into the chromosome via homologous sequence recombination were selected in BHI solid medium containing kanamycin. PCR was performed using primers Cva-SS-F and Cva-SS-R on *Corynebacterium glutamicum* transformants that had undergone secondary recombination as templates to identify whether the target gene mutant had been integrated into the genome. All randomly generated mutant strains were inoculated onto activated medium plates to obtain a strain library containing multiple random mutants.
[0044] The activation medium consisted of: 2.0 g / L glucose, 10.0 g / L peptone, 5.0 g / L yeast extract, 2.5 g / L sodium chloride, 1.0 g / L KH2PO4, 0.2 g / L MgSO4, and 2.5% agar powder. After dissolving in water, the pH was adjusted to 7.0-7.2 with sodium hydroxide, and the volume was brought to 500 mL. The mixture was then sterilized in a high-pressure steam autoclave at 121 °C for 20 min.
[0045] Table 2
[0046] Example 3 Evaluation of dominant mutants and screening of strains To select mutant strains that have increased L-valine production capacity compared to Corynebacterium glutamicum ATCC 13032, fermentation potential tests were performed on strains from a random mutant strain library.
[0047] The culture medium used is as follows: Activation medium: glucose 2.0 g / L, peptone 10.0 g / L, yeast extract 5.0 g / L, sodium chloride 2.5 g / L, KH2PO4 1.0 g / L, MgSO4 0.2 g / L, agar powder 2.5%, dissolved in water, pH adjusted to 7.0-7.2 with sodium hydroxide, and brought to a final volume of 500 mL. Sterilize in an autoclave at 121℃ for 20 min.
[0048] Seed culture medium: yeast extract 8.0 g / L, peptone 3.0 g / L, KH2PO4 3.0 g / L, V B1 V B2 V B3 V B5 V B12 2 mg / L each, V H 1 mg / L, MgSO4·7H2O 0.5 g / L, the remainder is water.
[0049] Fermentation medium: glucose 80.0 g / L, corn flour 15.0 g / L, glutamic acid 2.0 g / L, KH2PO4 2.3 g / L, MgSO4·7H2O 1.5 g / L, FeSO4·7H2O 10 mg / L, V B1 V B2 V B3 V B5 V B12 1 mg / L each, V H 0.1 mg / L, phenol red 2%, the remainder is water.
[0050] 1. Seed activation and culture: Inoculate the bacterial suspensions of Corynebacterium glutamicum ATCC 13032 and the library strain into the preservation tube, spread them evenly on the activation slant, and incubate at 32°C for 12 h. Then, transfer the activated slant to continue incubation for 10 h, and finally transfer it to a shaker containing 5 mL of seed culture medium for seed culture.
[0051] 2. Fermentation culture: The seed culture was inoculated at a rate of 15% into 500 mL Erlenmeyer flasks containing fermentation medium (final volume 30 mL). The flasks were sealed with nine layers of gauze and incubated at 32°C with shaking at 220 rpm. During fermentation, the pH was maintained at 7.0-7.2 by supplementing with urea (phenol red was used as an indicator; the fermentation broth turning yellow indicated acidity, at which point urea was added). The fermentation period was 36 h, and no antibiotics or inducers were added during the fermentation process. After 36 h of shake-flask fermentation, the concentration of L-valine was analyzed by HPLC, and the analytical concentrations of L-valine are shown in Table 3.
[0052] Table 3
[0053] Based on the results shown in Table 3, it was found that the valine production of *Corynebacterium glutamicum* ATCC 13032 and the Cval-alsS strain with integrated unmutated genes was only slightly increased. The Cval-alsS-E5 strain, which showed the greatest increase in valine production compared to *Corynebacterium glutamicum* ATCC 13032 and the Cval-alsS (unmutated) strain (i.e., the control group), was selected. This result confirms that the introduction of the dominant alsS mutant can effectively improve the valine production of the strain.
[0054] Example 4 Identifying mutations through gene sequencing The mutant gene of this strain with outstanding valine production was sequenced and compared with the originating alsS. -cgl Gene comparisons were conducted. The results revealed a mutant (alsS) in the Cval-alsS-E5 strain with enhanced valine production. -cgl-E5 The alsS gene contains multiple nucleotide sequence mutations at specific locations in the ORF region.
[0055] Specifically, alsS was discovered -cgl-E5 with alsS -cgl The gene underwent multiple site mutations, and the specific mutation locations and amino acid changes are shown in Table 4.
[0056] Table 4
[0057] The above alsS -cgl-E5 The amino acid sequence of the gene is shown in SEQ ID NO.4, and the nucleotide sequence is shown in SEQ ID NO.2.
[0058] In summary, this invention employs random mutation technology to target alsS -cglGene sequences were randomly mutagenized to construct random mutant libraries. Mutants from this library were integrated into the genome of *Corynebacterium glutamicum* ATCC 13032 to obtain mutant strain libraries. Fermentation performance screening revealed that strains integrating specific advantageous mutants exhibited significantly higher valine production than both non-mutated and wild-type strains.
[0059] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention. Improvements and modifications such as strain modification based on the method of the present invention or based on the method are all considered to be within the scope of protection of the present invention.
Claims
1. An acetolactate synthase mutant, characterized in that: Its amino acid sequence is shown in the sequence listing SEQ ID NO.
4.
2. A biomaterial related to the acetolactate synthase mutant of claim 1, characterized in that: It can be any one of the following (a1) to (a4): (a1) Encoding a nucleic acid molecule of the acetolactate synthase mutant as described in claim 1; (a2) An expression cassette containing the nucleic acid molecule described in (a1): (a3) A recombinant vector comprising the nucleic acid molecule described in (a1) or the expression cassette described in (a2); (a4) A recombinant microorganism comprising the nucleic acid molecule of (a1), the expression cassette of (a2), or the recombinant vector of (a3).
3. The biomaterial according to claim 2, characterized in that: The nucleotide sequence of the nucleic acid molecule encoding the acetolactate synthase mutant in (a1) is shown in the sequence listing SEQ ID NO.
2.
4. The use of the acetolactate synthase mutant of claim 1 or the biomaterial of claim 2 in constructing valine-producing strains or in the fermentation production of valine.
5. A valine-producing strain, characterized in that: It was obtained by modifying the original strain, wild-type Corynebacterium glutamicum, and the modification included: introducing a mutation site into acetolactate synthase, and the nucleotide sequence of the acetolactate synthase mutant encoding gene after the introduction of the mutation site is shown in SEQ ID NO.2 of the sequence listing.
6. The valine-producing strain according to claim 5, characterized in that: The starting strain was wild-type Corynebacterium glutamicum ATCC 13032.
7. The valine-producing strain according to claim 5, characterized in that: The nucleotide sequence of the acetolactate synthase is shown in SEQ ID NO.
1.
8. The method for constructing the valine-producing strain according to any one of claims 5-7, characterized in that: The specific steps are as follows: Using gene editing technology, the acetolactate synthase mutant is integrated into the genome of the starting strain Corynebacterium glutamicum through homologous recombination to construct a recombinant strain.
9. The use of the valine-producing strain according to any one of claims 5-7 in the fermentation production of valine.
10. The application according to claim 9, characterized in that: The specific steps for producing valine using shake-flask fermentation are as follows: (1) Seed activation and culture: The bacterial solution was evenly spread on the activation slant, and after culture, it was transferred to the activation slant for further culture, and then transferred to the seed culture medium for seed culture. (2) Fermentation culture: Inoculate the seed liquid into the fermentation medium, shake and culture, and maintain the pH at 7.0-7.2 during the fermentation process.
Citation Information
Patent Citations
Genetically engineered bacterium for high-yielding L-valine and method for producing L-valine by fermentation
CN110607268A
Mutant Acetolactate Synthase and a Method for Producing Branched-Chain L-Amino Acids
US20090197309A1