A recombinant expression vector, an engineering bacteria and application and method thereof in construction of synthetic artemisinin cotton

By overexpressing artemisinin metabolism genes in cotton, the problem of high extraction costs of artemisinin has been solved, enabling efficient synthesis of artemisinin and enhancing cotton's insect resistance, thus promoting an integrated production model of agriculture and medicine.

CN122128324APending Publication Date: 2026-06-02HENAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HENAN UNIVERSITY
Filing Date
2026-03-06
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

In existing technologies, the extraction of artemisinin relies on Artemisia annua, which has problems such as long planting cycle, scarce land resources, high cost, low enzyme catalytic efficiency and heavy cell metabolic burden, resulting in high industrial fermentation costs and difficulty in increasing yield.

Method used

By using a recombinant expression vector to overexpress artemisinin metabolism genes in cotton, and through multi-gene synergistic expression and reprogramming of the cotton endogenous metabolic network, agricultural waste leaves are transformed into medicinal raw materials, achieving efficient synthesis of artemisinin, which is then introduced into cotton plants to enhance their resistance to bollworms.

Benefits of technology

This achievement enables the efficient and stable synthesis of artemisinin in cotton, increasing the output value per unit of land and the efficiency of resource utilization. It creatively integrates drug production into the cotton agricultural system, realizing the dual use of medicine and cotton, reducing costs and increasing yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128324A_ABST
    Figure CN122128324A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of plant metabolic engineering and biosynthesis technology, and relates to a recombinant expression vector, engineered bacteria, and their application and method in constructing cotton plants capable of synthesizing artemisinin. This invention integrates five key genes from the artemisinin metabolic pathway—ADS and CYP71AV1 from *Artemisia annua*, and ADH1, DBR2, and ALDH1 from *Bryum arvense*—into a multi-gene overexpression vector for genetic transformation in cotton. Optimal expression strategies for cotton plants capable of synthesizing artemisinin were screened using quantitative real-time radiometric analysis (RCR) and artemisinin content determination. Compared with wild-type plants lacking artemisinin, cotton leaves overexpressing the ADS, CYP71AV1, ADH1, DBR2, and ALDH1 genes showed an artemisinin content as high as 2.34 μg / g DW.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant metabolic engineering and biosynthesis technology, and relates to the reprogramming of cotton endogenous metabolic network through multi-gene synergistic expression. Background Technology

[0002] Artemisinin and its derivatives (artesunate, artemether, etc.) are core components of first-line antimalarial drugs certified by the World Health Organization. Furthermore, the market demand for artemisinin continues to grow in areas such as anti-tumor treatment and the treatment of immune diseases (Chen et al., 2025. Single-cell profiling reveals immunoregulation of artemisinin on CD8). + GZMB + T cells via JAK2-STAT3 in malaria-infected mice. Innovation (Cambridge (Mass.)), 6(9), 101080.). However, the extraction method relying on Artemisia annua has a long planting cycle, scarce land resources, low content and high cost; although breakthroughs have been made in microbial heterologous synthesis, it still faces bottlenecks such as long metabolic pathways, low enzyme catalytic efficiency, heavy cellular metabolic burden and product toxicity, which poses a serious challenge to cost control and yield improvement in industrial fermentation (Han et al., 2025, Guo et al., 2025. Integrated metabolomic and transcriptomic analysis reveals the coordinated regulatory mechanisms of artemisinin and flavonoid mediated by AaMYB8 in Artemisia annua. International Journal of Biological Macromolecules 330(Pt 2): 147998.).

[0003] Cotton boasts a mature cultivation system and can be produced at near-zero raw material costs. Furthermore, its fibers are naturally separated from potentially drug-containing tissues (such as leaves), allowing for the simultaneous harvesting of medicinal cotton without impacting the primary industry (Lin et al., 2025. Adirigent protein redirects extracellular terpenoid metabolism for defense against biotic challenges. Nat Commun, Oct 20;16(1):9270.). More importantly, cotton itself is a powerful carrier for sesquiterpene synthesis, and its clear metabolic pathway provides a well-defined engineering target for the targeted production of artemisinin through synthetic biology. This makes this option not only low-cost but also possesses the potential to build high-tech barriers, potentially giving rise to a revolutionary agricultural-pharmaceutical integrated production model. Summary of the Invention

[0004] To address the aforementioned technical challenges, this invention proposes a recombinant expression vector, engineered bacteria, and their application and method in constructing cotton for artemisinin synthesis. This transforms a large amount of agricultural waste—leaves—from cotton production into high-value medicinal raw materials, achieving high-value utilization of the entire plant by "turning waste into treasure." The entire production process is green and low-carbon, fully aligning with the global strategic direction of circular economy and sustainable agricultural development, and is expected to lead biomanufacturing from "laboratory fermenters" to "tens of thousands of acres of farmland" into a new era.

[0005] The technical solution of this invention is implemented as follows:

[0006] One objective of this invention is to provide a recombinant expression vector comprising a 35S promoter, a CDS sequence of the ADS gene and the CDS sequence of the CYP71AV1 gene from Artemisia annua, and CDS sequences of the ADH1 gene, the DBR2 gene, and the ALDH1 gene from Moss licheniformis.

[0007] Preferably, the CDS sequences of the ADS gene and the CYP71AV1 gene are connected at their ends by two alanine residues, and the CDS sequence of the ALDH1 gene is connected to the CDS sequence of the DBR2 gene by two alanine residues.

[0008] Furthermore, the CDS sequences of the ADS gene are shown in SEQ ID No. 1, the CDS sequence of the ALDH1 gene is shown in SEQ ID No. 2, the CDS sequence of the CYP71AV1 gene is shown in SEQ ID No. 3, the CDS sequence of the ADH1 gene is shown in SEQ ID No. 4, and the CDS sequence of the DBR2 gene is shown in SEQ ID No. 5.

[0009] The second objective of this invention is to provide engineered bacteria containing the above-mentioned recombinant expression vector.

[0010] A third objective of this invention is to provide the application of the aforementioned engineered bacteria in constructing cotton that synthesizes artemisinin. By introducing the engineered bacteria into cotton plants to be improved, transgenic cotton lines capable of synthesizing artemisinin and exhibiting enhanced resistance to bollworms are obtained through screening. This invention also provides a method for producing artemisinin by overexpressing five artemisinin metabolism genes in cotton, as well as the resulting product.

[0011] Preferably, the cotton plants to be improved are upland cotton.

[0012] The fourth objective of this invention is to provide a systematic strategy for creating efficient, stable, and industrially scalable synthetic artemisinin-producing cotton germplasm resources by introducing exogenous artemisinin synthesis genes, without affecting cotton growth and production. Specifically, this invention provides a method for enabling cotton leaves to produce artemisinin, resist bollworms, and without affecting cotton yield, comprising the following steps:

[0013] (1) Codon optimization of ADS and CYP71AV1 genes from Artemisia annua and ADH1, DBR2 and ALDH1 genes from Bryum simulans.

[0014] (2) The five optimized genes were constructed into the Cotton2.0 vector to obtain the Cotton2.0-ADS-2A-ALDH1 plasmid and the Cotton2.0-CYP71AV1-2A-ADH1-2A-DBR2 plasmid containing the target gene fragment;

[0015] (3) Using Cotton2.0-ADS-2A-ALDH1 plasmid and Cotton2.0-CYP71AV1-2A-ADH1-2A-DBR2 plasmid as templates, respectively, the ADS-2A-ALDH1 gene and CYP71AV1-2A-ADH1-2A-DBR2 gene were amplified and the target gene fragments were recovered.

[0016] (4) The target gene fragment and the Cotton3.0 expression vector were digested with enzymes and ligated to obtain the recombinant vector Cotton3.0-ART. After transformation and verification, it was introduced into the cotton plants to be improved through genetic transformation to obtain transgenic cotton lines.

[0017] Preferably, the CDS sequences of the ADS gene are shown in SEQ ID No. 1, the CDS sequences of the ALDH1 gene are shown in SEQ ID No. 2, the CDS sequences of the CYP71AV1 gene are shown in SEQ ID No. 3, the CDS sequences of the ADH1 gene are shown in SEQ ID No. 4, and the CDS sequences of the DBR2 gene are shown in SEQ ID No. 5.

[0018] Furthermore, in step (2), the primers used to construct the Cotton2.0-ADS-2A-ALDH1 plasmid are Cotton2.0-ADS-2A-F (SEQ ID No. 6), ADS-2A-ALDH1-R (SEQ ID No. 7), ADS-2A-ALDH1-F (SEQ ID No. 8), and ALDH1-Cotton2.0-R (SEQ ID No. 9).

[0019] The primers used for the Cotton2.0-CYP71AV1-2A-ADH1-2A-DBR2 plasmid are Cotton2.0-CYP71AV1-2A-F (SEQ ID No. 10), CYP71AV1-2A-ADH1-R (SEQ ID No. 11), CYP71AV1-2A-ADH1-F (SEQ ID No. 12), and DBR2-Cotton2.0-R (SEQ ID No. 13).

[0020] Preferably, the cotton mentioned above is upland cotton.

[0021] The present invention has the following beneficial effects:

[0022] The core advantage of this invention lies in its innovative industrial integration capability: it successfully integrates the production of artemisinin, a high-value drug, into a globally scaled, mechanized cotton agricultural system, achieving enormous production benefits with near-zero cost. More importantly, this invention pioneers a new paradigm of "dual-use of medicinal cotton," enabling cotton to produce artemisinin from its non-fiber components while ensuring the production of high-quality fiber. This allows for the simultaneous harvesting of high-quality fiber and the extraction of artemisinin from the non-fiber parts of the cotton plant, such as leaves. Figure 1 Zhong A has achieved a doubling of output value per unit of land and resource utilization efficiency. This systematic solution integrates cutting-edge technologies such as metabolic reprogramming and multi-gene stable inheritance, building extremely high technological barriers. It not only transforms agricultural waste into valuable raw materials, but also leads a new direction of sustainable biomanufacturing from "laboratory fermentation" to "green farmland". Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 This study focuses on the screening of artemisinin synthesis genes and the construction of multi-gene vectors. Figure A shows the chemical molecular formula and synthesis pathway of artemisinin, while Figure B shows the construction map of multi-gene vectors.

[0025] Figure 2 Phenotypic identification of transgenic cotton plants synthesizing artemisinin; Figure A shows a comparison of plant morphology between wild-type cotton (WT) and transgenic cotton synthesizing artemisinin (ART-33) (scale bar = 2 cm); Figure B shows a comparison of seeds (scale bar = 5 mm) and fibers (scale bar = 2 cm) between wild-type cotton (WT) and transgenic cotton synthesizing artemisinin (ART-33); Figure C is a bar chart showing plant height, seed weight, and fiber length between wild-type cotton (WT) and transgenic cotton synthesizing artemisinin (ART-33) (ns: no significant difference).

[0026] Figure 3 The study aimed to detect the efficiency of artemisinin synthesis. Figure A shows the characteristic peaks of artemisinin detected in wild-type (WT) and transgenic lines ART-6, ART-11, and ART-33 using ultra-high performance liquid chromatography-mass spectrometry (UPLC-MS / MS). Figure B shows the bar chart of artemisinin content detected in wild-type (WT) and transgenic lines ART-6, ART-11, and ART-33, as well as the expression levels of ADS, CYP71AV1, ADH1, DBR2, and ALDH1 genes (ns: no significant difference; **: extremely significant difference).

[0027] Figure 4 The study included the detection of artemisinin's antibacterial and insecticidal effects. Figure A shows the growth status of Fusarium wilt pathogens under conditions of no and no artemisinin application (scale bar = 1 mm); Figure B is a bar chart of Fusarium wilt pathogen colony area (**: extremely significant difference); Figure C shows leaves of wild-type WT and artemisinin-modified ART-33 cotton plants after being eaten by bollworms (scale bar = 1 cm) and corresponding bollworm images; Figure D is a bar chart of leaf consumption area and bollworm weight (**: extremely significant difference).

[0028] Figure 5The images show comparisons of codon optimizations; where A is a comparison of ADS-2A codons before and after optimization; B is a comparison of ALDH1 codons before and after optimization; C is a comparison of CYP71AV1-2A codons before and after optimization; and D is a comparison of ADH1-2A-DBR2 codons before and after optimization. Detailed Implementation

[0029] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0031] Unless otherwise expressly defined, the technical and scientific terms used herein are consistent with conventional understanding in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to this invention. The illustrative embodiments and materials described herein are for illustrative purposes only and do not constitute limitation.

[0032] The Phanta Max high-protection enzyme, Taq Plus DNase, and DNA Maker used in this invention were purchased from Nanjing Novizan Biotechnology Co., Ltd.; anhydrous ethanol, n-hexane, acetone, dichloromethane, and chromatographic grade methanol were purchased from Fuyu Fine Chemical Co., Ltd.; rifampin, kanamycin, and cephalosporin standards were purchased from Beijing Solarbio Biotechnology Co., Ltd.; chromatographic grade 2,6-di-tert-butyl-p-cresol (BHT) was purchased from Aladdin Biochemical Technology Co., Ltd.; the RNAprep Pure polysaccharide and polyphenol plant total RNA extraction kit was purchased from Tiangen Biotech Co., Ltd., Germany; the reverse transcription kit (Hifair® Ⅲ first-strand cDNA synthesis premix, suitable for qPCR) was purchased from Shanghai Yisheng Biotechnology Co., Ltd.; the real-time quantitative PCR kit (2× Universal SYBR Green Fast qPCR Mix) was purchased from Wuhan Aibote Biotechnology Co., Ltd.; the plasmid rapid extraction kit was purchased from Tiangen Biotech Co., Ltd., Germany; and the homologous recombination cloning kit ClonExpressMultiS One Step Cloning was used. Kits were purchased from Nanjing Novizan Biotechnology Co., Ltd.; restriction endonucleases SpeI and EcoRI were purchased from New England Biotechnology (Beijing) Co., Ltd. All primer synthesis and nucleic acid sequencing involved in the experiments were performed by Shanghai Sangon Biotech Co., Ltd. The implementation methods and related materials listed in this article are for illustrative purposes only and do not constitute a limitation on actual operations.

[0033] Example 1: Screening of key genes in the artemisinin metabolic pathway and construction of multi-gene vectors

[0034] First, five key genes involved in artemisinin metabolism were screened to reconstruct the artemisinin biosynthetic pathway in cotton (Figure 1A). These genes were ADS and CYP71AV1 from Artemisia annua, and ADH1, DBR2, and ALDH1 from Bryum simonii (Farhi et al., 2011). Given that the expression of heterologous genes may be influenced by codon preferences in different species, codon optimization was performed on these five genes to improve their expression efficiency in cotton. Figure 5 Images showing the before-and-after alignment results of five gene sequences (optimized before and after). Finally, using the Goden Gate method (Engler et al., 2009), the sequences were integrated into a multi-gene expression vector, Cotton3.0-ART, for plant transformation and expression. Figure 1 B).

[0035] The gene cloning primers used in this application are as follows:

[0036] 1. Cotton 2.0-ADS-2A-ALDH1

[0037] Cotton2.0-ADS-2A-F(SEQ ID No.6):

[0038] cctgcaggcggccgcactagtATGAGTTTGACTGAAGAGAAGCCC;

[0039] ADS-2A-ALDH1-R(SEQ ID No.7):

[0040] GGCACCGCTAGACATGGGTCCTGGGTTTGATTCGA;

[0041] ADS-2A-ALDH1-F(SEQ ID No.8):

[0042] TCAAACCCAGGACCCATGTCTAGCGGTGCCAACGG;

[0043] ALDH1-Cotton2.0-R(SEQ ID No.9):

[0044] GAAAGCTGGGTTCTAGAATTCTCATAACCACGGAGAATCATATATTGG;

[0045] 2. Cotton 2.0 - CYP71AV1-2A-ADH1-2A-DBR2

[0046] Cotton2.0-CYP71AV1-2A-F(SEQ ID No.10):

[0047] cctgcaggcggccgcactagtATGAAGTCCATTCTGAAAGCTATGG;

[0048] CYP71AV1-2A-ADH1-R(SEQ ID No.11):

[0049] GAGCCTTTTGAGCCATCGGCCCAGGATTGCTCTC;

[0050] CYP71AV1-2A-ADH1-F(SEQ ID No.12):

[0051] GAGCAATCCTGGGCCGATGGCTCAAAAGGCTCCCG;

[0052] DBR2-Cotton2.0-R(SEQ ID No.13):

[0053] GAAAGCTGGGTTCTAGAATTCTCATAGCAGACTTCCTTTATCTAAAGAAG.

[0054] 1. Gene cloning

[0055] Using the synthesized plasmid as a template, the PCR amplification program employed a three-step procedure: 95℃ for 3 min; 95℃ for 15 s; 58℃ for 15 s; 72℃ for 30 s / kb; 38 cycles; 72℃ for 5 min. The PCR products were purified and recovered via gel electrophoresis, and their size and concentration were verified by agarose gel electrophoresis.

[0056] 2. Preparation of intermediate support

[0057] The Cotton 2.0 plasmid vector was double-digested using SpeI and EcoRI restriction endonucleases (NEB). The specific digestion reaction system was as follows: 2 μg Cotton 2.0 vector, 1 μL each of SpeI and EcoRI endonucleases, 5 μL CutSmart buffer, and sterile deionized water to a total volume of 50 μL. The reaction system was incubated in a 37°C metal bath for 3 hours. After obtaining the linearized band of the expected size via electrophoresis, the target band was purified by gel extraction.

[0058] 3. Homologous recombination 35S promoter and gene

[0059] To fuse the artemisinin gene with the 35S promoter, the Novizan ClonExpress MultiS OneStep Cloning Kit was used to ligate the double-digested Cotton 2.0 linear vector with the target fragment containing adapters. The total volume of the recombination reaction was 10 μL, specifically composed of: 2 μL of 5×CE MultiS buffer, 1 μL of Exnase MultiS homologous recombinase, 1 μL of enzyme-digested linearized vector (concentration 50 ng / μL), and the target fragment with adapters at both ends (concentration 50 ng / μL each). The volume was then brought to 10 μL with sterile deionized water. The mixture was incubated at 37°C for 30 minutes, and the vector was transformed into DH5α competent cells by heat shock at 42°C. Positive single clones were then selected.

[0060] 4. Construction of multi-gene vectors

[0061] The recombined promoter and gene fragments were constructed into the final vector, Cotton 3.0-ART, using the Golden Gate method. The reaction mixture (15 μL) consisted of: 1.5 μL 10×CutSmart Buffer, 1.5 μL 10 mM ATP, Cotton 3.0-ART vector (100 ng), a mixture of gene expression cassettes (50 ng), 0.5 μL (10 U) BsaⅠ-HF enzyme, and 0.2 μL (80 U) T4 DNA ligase. The cells were transformed into *E. coli* DH5α competent cells by heat shock, and positive clones were selected using kanamycin-resistant plates. The plasmid, verified by sequencing, was transformed into *Agrobacterium* LBA4404. (See diagram below.) Figure 1 As shown in Figure B, the hypocotyl of etiolated cotton seedlings was transformed using Agrobacterium-mediated transformation. Key processes included cell dedifferentiation induction, callus redifferentiation, and plant regeneration, ultimately yielding gene-edited cotton plants.

[0062] Example 2: Creation of Artemisinin-Generating Transgenic Cotton

[0063] Using upland cotton Jin668 as the transformation recipient material, the artemisinin multi-gene expression vector Cotton3.0-ART was transferred into cotton using an Agrobacterium-mediated cotton genetic transformation system, aiming to reconstruct the artemisinin synthesis pathway in cotton. Phenotypic observation of the obtained transgenic cotton plants revealed no significant differences in growth and development between the ART and wild-type (WT) transgenic cottons, including plant height, leaf color, seed size, and fiber length. There were no significant differences between ART and WT in these aspects. Figure 2 ).

[0064] Example 3: Detection of Artemisinin Content in Transgenic Cotton

[0065] To verify the ability of cotton leaves to synthesize artemisinin, the content of artemisinin in transgenic plants was identified using ultra-high performance liquid chromatography-mass spectrometry (UPLC-MS / MS). Distinct characteristic peaks of artemisinin were detected in lines ART-11 and ART-33, while no characteristic peaks of artemisinin were observed in the WT and ART-6 lines. Figure 3 (A)

[0066] Quantitative analysis showed that the artemisinin content in ART-11 and ART-33 lines reached 1.97 μg / g DW and 2.34 μg / g DW, respectively. qRT-PCR was used to identify the expression levels of artemisinin synthesis genes in WT, ART-6, ART-11, and ART-33 plants. The results showed high expression levels of five genes (ADS, CYP71AV1, ADH1, DBR2, and ALDH1) in ART-11 and ART-33, while only ADS and ALDH1 showed high expression levels in ART-6, and the other three genes were almost not expressed. Therefore, artemisinin synthesis was not detected in this line. Figure 3 (B)

[0067] The primers used for quantitative analysis are as follows:

[0068] qRT-PCR detection primers:

[0069] UB7-F:GAAGGCATTCCACCTGACCAAC;

[0070] UB7-R: CTTGACCTTCTTCTTCTTGTGCTTG;

[0071] ADS-RT-F: AAGAATGCTCCTTGTTTGCGTG;

[0072] ADS-RT-R: AGATCAGTCCTGCCTTCCTTTGC;

[0073] ALDH1-RT-F: AATGGTCCTGCGTTCATGTTTG;

[0074] ALDH1-RT-R: CACGGGCTTGAGATTTGATAGA;

[0075] CYP71AV1-RT-F: GGGCAATTTCAGAGCTAATCAA;

[0076] CYP71AV1-RT-R: AAGCCTCAGCATCTTTCCAGTA;

[0077] ADH1-RT-F: GGTTCCCTATTCCCTTGTTTCC;

[0078] ADH1-RT-R: CAGCGACAGCATATTCAGTCCA;

[0079] DBR2-RT-F: ACCGAGGGTACAATGATAAGC;

[0080] DBR2-RT-R: CCCGATAATCTTCAACCACCT.

[0081] Example 4: Detection of resistance to bollworm in transgenic cotton leaves

[0082] Given that previous studies have reported the antibacterial activity of artemisinin (Ho et al., 2014), in order to clarify its potential for controlling cotton wilt, this study evaluated the inhibitory effect of artemisinin on cotton wilt pathogens through in vitro antibacterial experiments. The results showed that when wilt pathogens were inoculated with artemisinin, their growth was significantly inhibited, and the colony area was significantly smaller than that of the control group treated with methanol. Figure 4 (AB) indicates that artemisinin has some effect on the control of cotton wilt pathogen. Cotton bollworms were fed leaves of WT and the artemisinin-transgenic line ART-33, respectively. The results showed that the consumption of ART-33 leaves was significantly lower than that of WT leaves. Similarly, the weight of cotton bollworms fed ART-33 leaves was significantly lower than that fed WT leaves. Figure 4 The results (CD) indicate that cotton leaves capable of synthesizing artemisinin exhibit certain resistance to feeding and growth inhibition against bollworms. These results suggest that the biosynthesis of artemisinin in cotton not only increases the added value of cotton but also provides some assistance to the cotton's resistance to diseases and pests due to the presence of artemisinin.

[0083] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A recombinant expression vector, characterized in that: The recombinant expression vector contains a 35S promoter, a CDS sequence of the ADS gene from Artemisia annua and a CDS sequence of the CYP71AV1 gene, and a CDS sequence of the ADH1 gene, DBR2 gene and ALDH1 gene from Moss licheniformis.

2. The recombinant expression vector according to claim 1, characterized in that: The CDS sequences of the ADS gene and the CYP71AV1 gene are connected by two alanine residues at their ends, and the CDS sequences of the ALDH1 gene and the DBR2 gene are connected by two alanine residues.

3. The recombinant expression vector according to claim 2, characterized in that: The CDS sequences of the ADS gene are shown in SEQ ID No. 1, the CDS sequences of the ALDH1 gene are shown in SEQ ID No. 2, the CDS sequences of the CYP71AV1 gene are shown in SEQ ID No. 3, the CDS sequences of the ADH1 gene are shown in SEQ ID No. 4, and the CDS sequences of the DBR2 gene are shown in SEQ ID No.

5.

4. Engineered bacteria containing the recombinant expression vector according to any one of claims 1-3.

5. The application of the engineered bacteria according to claim 4 in constructing cotton for synthesizing artemisinin, characterized in that: By introducing engineered bacteria into cotton plants to be improved, transgenic cotton lines that can synthesize artemisinin and have enhanced resistance to bollworms were obtained through screening.

6. The application according to claim 5, characterized in that: The cotton plant to be improved is upland cotton.

7. A method for enabling cotton leaves to produce artemisinin, resisting bollworm, and without affecting cotton yield, characterized in that, The steps are as follows: (1) Codon optimization of ADS and CYP71AV1 genes from Artemisia annua and ADH1, DBR2 and ALDH1 genes from Bryum simulans. (2) The five optimized genes were constructed into the Cotton2.0 vector to obtain the Cotton2.0-ADS-2A-ALDH1 plasmid and the Cotton2.0-CYP71AV1-2A-ADH1-2A-DBR2 plasmid containing the target gene fragment; (3) Using Cotton2.0-ADS-2A-ALDH1 plasmid and Cotton2.0-CYP71AV1-2A-ADH1-2A-DBR2 plasmid as templates, respectively, the ADS-2A-ALDH1 gene and CYP71AV1-2A-ADH1-2A-DBR2 gene were amplified and the target gene fragments were recovered. (4) The target gene fragment and the Cotton3.0 expression vector were digested with enzymes and ligated to obtain the recombinant vector Cotton3.0-ART. After transformation and verification, it was introduced into the cotton plants to be improved through genetic transformation to obtain transgenic cotton lines.

8. The method for producing artemisinin in cotton leaves and resisting bollworms without affecting cotton yield, as described in claim 7, is characterized in that: The CDS sequences of the ADS gene are shown in SEQ ID No. 1, the CDS sequences of the ALDH1 gene are shown in SEQ ID No. 2, the CDS sequences of the CYP71AV1 gene are shown in SEQ ID No. 3, the CDS sequences of the ADH1 gene are shown in SEQ ID No. 4, and the CDS sequences of the DBR2 gene are shown in SEQ ID No.

5.

9. The method for producing artemisinin in cotton leaves and resisting bollworms without affecting cotton yield, as described in claim 7, is characterized in that: In step (2), the primers used to construct the Cotton2.0-ADS-2A-ALDH1 plasmid are Cotton2.0-ADS-2A-F (SEQ ID No. 6), ADS-2A-ALDH1-R (SEQ ID No. 7), ADS-2A-ALDH1-F (SEQ ID No. 8), and ALDH1-Cotton2.0-R (SEQ ID No. 9). The primers used for the Cotton2.0-CYP71AV1-2A-ADH1-2A-DBR2 plasmid are Cotton2.0-CYP71AV1-2A-F (SEQ ID No. 10), CYP71AV1-2A-ADH1-R (SEQ ID No. 11), CYP71AV1-2A-ADH1-F (SEQ ID No. 12), and DBR2-Cotton2.0-R (SEQ ID No. 13).

10. The method for producing artemisinin in cotton leaves and resisting bollworms without affecting cotton yield, as described in claim 7, is characterized in that: The cotton in question is upland cotton.