A method for creating a low-cadmium accumulation and high-yield rice

Abstract

This invention relates to a method for creating low-cadmium-accumulation, high-yield rice. The invention utilizes CRISPR / Cas9 technology to render the function of isorhamnetin diglyceride synthase in rice deficient, exhibiting significant advantages under cadmium stress: the mutant shows significantly higher aboveground part length, aboveground dry weight, and root length than the wild type under cadmium stress; cadmium accumulation at both the whole plant and subcellular levels is significantly reduced; and the cadmium content in grains at grain maturity is significantly lower than that of the wild type, while yield is no different from the wild type. This mutant achieves the triple goals of "cadmium stress resistance, low cadmium accumulation, and high yield and quality," reducing the risk of cadmium pollution while ensuring planting benefits, providing a new solution for safe rice production in cadmium-polluted areas.

Description

Technical Field

[0001] This invention belongs to the field of rice breeding technology and relates to a method for creating high-yield rice with low cadmium accumulation. Background Technology

[0002] Cadmium, a major heavy metal pollutant in global arable land, is classified as a Group 1 carcinogen by the World Health Organization. Through the "soil-crop-human" exposure chain, it leads to reduced food yields and causes excessive dietary cadmium exposure, which is linked to some chronic diseases. Rice, the staple food for more than half the world's population, has a significantly higher cadmium absorption and accumulation capacity than other grains, contributing over 50% of the average person's dietary cadmium intake. Therefore, reducing the cadmium content of rice and ensuring food security has become a critical and urgent issue.

[0003] Current technologies for controlling cadmium pollution in rice mainly employ two methods: one is precise regulation based on gene editing technology, which involves using tools such as CRISPR-Cas9 to target and knock out cadmium transporter genes (e.g., OsNRAMP5 , OsHMA3 , OsZIP7 The methods employed include two approaches: first, blocking key transport pathways of cadmium ions, such as root absorption, vacuolar storage, and xylem loading, to reduce the efficiency of cadmium accumulation in grains; and second, enhancing cadmium detoxification based on metabolic regulation mechanisms. These include inducing the synthesis of intracellular small-molecule chelating agents (such as glutathione and phytochelatin) to complex cadmium ions and transport them to vacuolar storage, activating antioxidant enzyme systems such as superoxide dismutase (SOD) and peroxidase (POD) to scavenge reactive oxygen species generated by cadmium stress, and forming an iron film on the root surface through root secretion of oxidizing substances to adsorb and fix cadmium ions. These methods construct a cadmium pollution control system from two dimensions: blocking transport pathways and enhancing metabolic detoxification.

[0004] However, while techniques such as CRISPR-Cas9 knockout of cadmium transporter genes can directly block cadmium absorption and transport pathways, the process inevitably involves the cotransportation of metal ions. These transporters are often cotransporters of essential metal ions such as manganese, zinc, and calcium. Knockout of these proteins may simultaneously reduce the rice's absorption efficiency of essential elements, leading to "nutrient imbalance-type growth disorders," such as reduced tiller numbers and insufficient grain filling. Furthermore, complete knockout of some genes (such as OsNRAMP5) may cause abnormal root morphology, indirectly reducing the rice's ability to absorb water and nutrients, ultimately affecting yield stability. Cadmium detoxification technologies based on metabolic regulation such as chelator synthesis and antioxidant enzyme activation are limited in performance by the complex cross-regulation of metabolic networks. On the one hand, the synthesis of intracellular small molecule chelating agents (such as phytochelates and glutathione) depends on multiple enzymatic reactions, and their expression levels are easily affected by environmental factors such as cadmium exposure concentration and growth stage, resulting in a dose-dependent fluctuation in detoxification efficiency. On the other hand, the activation of antioxidant enzyme systems requires a large amount of reducing power (such as NADPH), which may compete with basic physiological processes such as photosynthesis and respiration for resources, causing a growth-detoxification trade-off. In addition, the fixation of root surface iron films is significantly affected by the soil microenvironment such as soil pH and redox potential. In acidic or reducing soils, the stability of the iron film is prone to decline, leading to a significant reduction in cadmium adsorption efficiency and limiting the applicability of the technology.

[0005] In conclusion, developing new and effective technologies for controlling cadmium pollution in rice is of great significance for preventing and controlling cadmium pollution in rice. Summary of the Invention

[0006] In response to the shortcomings of existing technologies and practical needs, this invention provides a method for creating low-cadmium-accumulation, high-yield rice, with the aim of developing new rice varieties with low cadmium pollution risk and stable agronomic traits.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides the application of a reagent that renders rice thioisorhamnoglycerol diglyceride synthase nonfunctional in the creation of low-cadmium-accumulation, high-yield rice.

[0008] This invention provides an in-depth analysis of the cadmium accumulation metabolic process in rice and designs a novel genetic modification strategy to remove the functional thio-isorhamnoglycerol diglyceride synthase, thereby regulating the composition and structural stability of the plasma membrane glycolipids and specifically blocking the transmembrane transport pathway of cadmium ions from the perspective of membrane biology. This achieves a highly efficient reduction in cadmium accumulation in grains without affecting the absorption of essential elements by rice.

[0009] Optionally, the nucleic acid sequence of the gene encoding the thioisorhamnoglycerol diglyceride synthase includes the sequence shown in SEQ ID NO. 1.

[0010] SEQ ID NO.1:

[0011] Optionally, the reagent comprises a gene-editing agent that knocks out or knocks down the gene encoding thioisorhamnoglycerol synthase.

[0012] Optionally, the reagent includes a CRISPR / Cas9 gene editing system, wherein the nucleic acid sequence of the target sequence of the CRISPR / Cas9 gene editing system includes the sequence shown in SEQ ID NO.2.

[0013] Secondly, the present invention provides a kit for creating low-cadmium-accumulation, high-yield rice, the kit comprising a CRISPR / Cas9 gene editing system, wherein the nucleic acid sequence of the target sequence of the CRISPR / Cas9 gene editing system comprises the sequence shown in SEQ ID NO.2.

[0014] Optionally, the CRISPR / Cas9 gene editing system includes a CRISPR / Cas9 vector.

[0015] Thirdly, the present invention provides a method for creating low-cadmium-accumulation, high-yield rice, the method comprising: By depleting the functional thio-isorhamnoglycerol synthase in rice, a high-yield rice with low cadmium accumulation was obtained.

[0016] Optionally, the method for creating low-cadmium-accumulation, high-yield rice includes the following steps: S1. In the thioisorhamnoglycerol diglyceride synthase gene OsSQD1 Target sequences are selected from exons in the 5'-UTR region; S2. Construct a CRISPR / Cas9 recombinant vector containing the target sequence; S3. The CRISPR / Cas9 recombinant vector was introduced into rice callus to obtain transgenic seedlings; S4. Screen for transgenic positive plants among the transgenic seedlings; S5. Obtain mutant plants using the transgenic positive plants.

[0017] Optionally, the nucleic acid sequence of the target sequence includes the sequence shown in SEQ ID NO.2.

[0018] In this invention, the CRISPR / Cas9 recombinant vector can be introduced into rice callus tissue using Agrobacterium-mediated transformation.

[0019] Optionally, step S5 includes extracting DNA from the transgenic positive plant, performing PCR amplification to obtain the amplification product, sequencing the amplification product, and selecting T0 generation homozygous mutant plants with loss-of-function mutations as mutant plants.

[0020] Compared with the prior art, the present invention has at least the following beneficial effects: This invention utilizes CRISPR / Cas9 technology to render the function of thioisorhamnoglycerol synthase in rice deficient, exhibiting significant advantages under cadmium stress: the mutant showed significantly higher aboveground part length, aboveground dry weight, and root length than the wild type under cadmium stress, and significantly reduced cadmium accumulation at both the whole plant (aboveground and root) and subcellular (cell wall, organelles, and cytoplasm) levels. Furthermore, the cadmium content in the grains at maturity was significantly lower than that of the wild type, while the yield was no different from that of the wild type. This mutant achieved the triple goals of "cadmium stress resistance, low cadmium accumulation, and high yield and quality," reducing the risk of cadmium pollution while ensuring planting benefits, providing a new solution for safe rice production in cadmium-polluted areas. Attached Figure Description

[0021] Figure 1 To build OsSQD1 Vector maps of CRISPR / Cas9 mutant materials, where Figure A shows the pH-Ubi-Cas9-7 vector and Figure B shows the pOs-sgRNA vector.

[0022] Figure 2 for OsSQD1 Image showing the results of identifying homozygous CRISPR / Cas9 mutants.

[0023] Figure 3 for OsSQD1 The growth of CRISPR / Cas9 mutants under different Cd treatments is shown in Figure A, which compares the growth under different Cd treatments; Figure B shows the aboveground length; Figure C shows the aboveground dry weight; Figure D shows the root length; and Figure E shows the root dry weight.

[0024] Figure 4 For different Cd treatment conditions OsSQD1 Figure showing the Cd accumulation results in the roots and shoots of the CRISPR / Cas9 mutant.

[0025] Figure 5 For different Cd treatment conditions OsSQD1 Image showing the Cd accumulation results in the subcellular aerial parts of the CRISPR / Cas9 mutant.

[0026] Figure 6 for OsSQD1 Figures showing the yield and Cd accumulation in grains of CRISPR / Cas9 mutants. Figure A shows the yield per plant, Figure B shows the Cd content in bran, and Figure C shows the Cd content in grains.

[0027] Figure 7 For rice OsSQD1 A schematic diagram of the mutant creation process. Detailed Implementation

[0028] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0029] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0030] This invention creates rice using CRISPR-Cas9 technology. OsSQD1 The mutant aims to address the core shortcomings of existing cadmium pollution control technologies: firstly, it overcomes the limitations of traditional cadmium transporter genes (such as...). OsNRAMP5 , OsHMA3 The study aimed to address two main challenges: first, the knockout of essential metal ions (manganese, zinc, etc.) leading to impaired absorption and hindered growth and development; and second, to overcome the limitations of metabolic regulation mechanisms (chelator synthesis, antioxidant enzyme activation) due to network complexity, resulting in low control efficiency and strong environmental dependence. This was achieved through targeted editing of the thioisorhamnosyl diglyceride (SQDG) synthase gene. OsSQD1 By regulating the composition and structural stability of plasma membrane glycolipids, and specifically blocking the transmembrane transport pathway of cadmium ions from the perspective of membrane biology, this method can efficiently reduce the accumulation of cadmium in grains without affecting the absorption of essential elements by rice. Ultimately, this aims to cultivate new rice varieties with low cadmium pollution risk and stable agronomic traits, providing a novel molecular improvement strategy for food security production in cadmium-polluted arable land.

[0031] Example 1 This embodiment provides rice. OsSQD1 The process of creating mutants is illustrated in the following diagram. Figure 7 As shown, it includes the following steps: (1) OsSQD1 Creation of CRISPR / Cas9 mutant materials Constructed using CRISPR / Cas9 technology ossqd1 Mutant strains. First, search... OsSQD1A spacer sequence containing an NGG or CCN structure was selected as the gene editing target sequence from the exon closest to the 5'-UTR region (SEQ ID NO.2: 5'-CCCGTGCGGTATTCACTCAGCAT-3'). Candidate spacers were selected and sequence alignment was performed on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) to ensure the uniqueness of the gene editing target sequence. The spacer was annealed in PCR to form an oligonucleotide double strand, which was then ligated into the pOs-sgRNA vector (…). Figure 1 (Figure B), and under the action of LRClonase II enzyme, it undergoes Gateway LR reaction, and is transferred into the final epivector pH-Ubi-Cas9-7 containing Cas9 ( Figure 1 (Figure A in the middle), after sequencing verification, it is saved for later use.

[0032] (2) OsSQD1 Obtaining CRISPR / Cas9 mutant materials The correctly sequenced expression vector from step (1) was transferred into Agrobacterium tumefaciens EHA105 via electroporation. Detailed steps: ① Pick a single Agrobacterium tumefaciens clone and inoculate it into 5 mL of YEP (containing 50 mg / L Str) liquid medium. Incubate at 28°C with shaking at 250 rpm for 36 h. Transfer the bacterial culture 1:100 to 100 mL of YEP (containing 50 mg / L Str) medium and incubate at 28°C with shaking at 250 rpm until OD600 ≈ 0.3 (approximately 4-5 h). Transfer to a 50 mL sterile, pre-chilled centrifuge tube, place on ice for 10 min, centrifuge at 4°C and 4000 rpm for 10 min, and discard the supernatant. ② Resuspend the culture in 20 mL of pre-chilled 1 mM HEPES (pH=7.0, must be freshly prepared), centrifuge at 4°C and 4000 rpm for 10 min, and discard the supernatant. Repeat step 4 3-4 times. Resuspend in 2 mL of pre-cooled 10-15% glycerol. Aliquot 100 μL into 2 mL sterile Eppendorf tubes and store at -70°C.

[0033] CRISPR / Cas9 mutant rice materials were obtained through rice transgenic technology. The transgenic steps are as follows: ① First, the hulled seeds of Zhonghua 11 rice were disinfected by immersing them in 70% alcohol for 2 min, then treating them with 2% sodium hypochlorite solution for 30 min, rinsing them repeatedly with sterile water, and soaking them for 30 min. The surface moisture was then absorbed and the seeds were dried in a clean bench with strong airflow. Subsequently, 12-15 seeds were placed in each induction medium, sealed with sealing film, and cultured in a 30℃ light incubator for 4 weeks. ② After the culture was completed, naturally dispersed, pale yellow, dense, spherical embryogenic callus tissue was selected and transferred to subculture medium. The cells were then subcultured in a 30℃ light incubator for 1-2 weeks. During the Agrobacterium culture stage, a single colony was inoculated into 100 μL of bacterial suspension and transferred to YEP liquid medium (4 mL) containing 50 mg / L kanamycin and 50 mg / L streptomycin. The cells were cultured at 28℃ and 250 rpm for 20-36 h until the bacterial suspension reached its OD value. 600 The value reached 0.8-1.0; 1 mL of bacterial suspension was centrifuged to precipitate the precipitate, and resuspended in 30 mL of AAM inoculum containing 200 μmol / L acetylsyringone to prepare a suspension. High-quality callus tissue (pale yellow, round, firm) was selected, enough to cover the bottom of a 50 mL centrifuge tube. Agrobacterium suspension was added for 5 min of infection. After discarding the bacterial suspension, the callus was placed on sterile filter paper to drain, and then dried in a clean bench under strong air for 30-40 min until completely dry. It was then evenly spread on the surface of a co-culture medium lined with sterile filter paper and incubated in the dark for 2.5 days. ③ After co-culture, the callus was transferred to a selective medium containing 250 mg / L carbenicillin and 50 mg / L hygromycin and cultured for 14 days. A second round of selective culture was then performed, transferring resistant callus to a selective medium containing 250 mg / L Carbenicillin and 80 mg / L hygromycin and continuing culture for 10 days. ④ Select bright yellow resistant callus tissues from the same callus source and transfer them to differentiation tanks containing differentiation medium (6-8 pieces per tank). Seal the tanks with sealing film and place them in a constant temperature incubator for 30-60 days until they differentiate into seedlings. When the seedlings reach about 3 cm in length, transfer them to rooting medium to strengthen them. The cycle from differentiation to transplanting of transgenic seedlings is about two months. When the seedlings with well-differentiated roots and stems reach the top of the test tube, open the lid promptly, remove the seedlings, add an appropriate amount of sterile water to prevent contamination of the medium, harden the seedlings for 3-7 days, wash off any residual agar from the roots, and then transplant them into soil pots. Subsequent growth observation, testing, and seed harvesting will be conducted.

[0034] (3) OsSQD1 Identification of CRISPR / Cas9 mutant materials First, hygromycin screening was performed: After rooting and cleaning, clean, intact transgenic rice leaves (1.0-1.5 cm) were placed in a petri dish containing hygromycin medium. Leaves without transgenes served as negative controls, and leaves from identified positive seedlings served as positive controls. After 48 hours of inverted cultivation in a light incubator, the treatment was observed: leaves turning yellow and wilting indicated false positives; leaves remaining unchanged were positive seedlings. Subsequently, PCR amplification was performed to identify the insertion and mutation of the Cas9 mutant: DNA was extracted and used as a template for PCR detection. Leaves from transgenic T0 generation seedlings were collected, and rice genomic DNA was extracted using the TPS method. Using the genomic DNA as a template, Cas9 was amplified by PCR (primers F: CACCATCTACCACCTGAGAA; R: CGAAGTTGCTCTTGAAGTTG), producing a product of 371 bp. If the Cas9 fragment was amplified, the seedling was considered a transgenic positive seedling. OsSQD1 The mutant identification primers (F: TGTGACTTTGATTTCCTTTC; R: ATTGCAGTTTCATCTCTGTTCT) were used to amplify the target fragment using genomic DNA from positive seedlings as a template. This fragment was then cloned into the pEASY-Blunt cloning vector, sequenced, and aligned. Effective mutant lines were selected and transplanted into soil, and seeds were harvested for later use. PCR results are shown below. Figure 2 As shown, homozygous OsSQD1 CRISPR / Cas9 mutants were obtained after identification. ossqd1 Sequencing results showed that an extra C base was present at a distance of 589 bp from ATG, resulting in... OsSQD1 A frameshift mutation occurred at (LOC_Os05g32140), causing premature termination of translation (Table 1).

[0035] Table 1 OsSQD1 CRISPR / Cas9 mutant sequence analysis results Example 2 This embodiment presents a growth and cadmium (Cd) accumulation experiment under 5 μM CdCl2 nutrient solution treatment.

[0036] (1) Material preparation: Wild-type rice (WT), OsSQD1 CRISPR / Cas9 mutant homozygote ( ossqd1 50 seeds each.

[0037] (2) Seedling stage: Seed disinfection: 70% alcohol soak for 2 min → 2% sodium hypochlorite solution treatment for 30 min → sterile water repeated 5 times → soaking for 30 min → absorbing surface moisture, cultured in a 30℃ light incubator (16 h light / 8 h dark) for 20 days until seedling age of 20 days (full nutrient solution culture).

[0038] (3) Cd stress treatment: 20-day-old seedlings were transferred to rice nutrient solutions containing 0 μM, 1 μM, 2 μM, 5 μM, 10 μM and 20 μM CdCl2 respectively, and cultured for 7 days in a 30℃ light incubator.

[0039] (4) Measurement of indicators: Growth indicators: Measure the length of the aboveground part (cm) with a ruler, and weigh the dry weight of the aboveground part (g / plant) and the root length (cm) after drying. Cd accumulation: Cd content (mg / kg) in the aboveground parts and roots was determined by atomic absorption spectrometry.

[0040] Growth index results as follows Figure 3 As shown, after culturing in a 5 μM CdCl2 rice nutrient solution, the aboveground length of the mutant was 23.6–28.9 cm (WT = 19.5 cm, an increase of 21.0–48.2%); the aboveground dry weight was 0.1–0.13 g / plant (WT = 0.07 g / plant, an increase of 42.9–85.7%); and the root length was 12.9–13.8 cm (WT = 9.8 cm, an increase of 31.6–40.8%). This indicates… OsSQD1 CRISPR / Cas9 mutant homozygotes showed significantly enhanced resistance to Cd stress.

[0041] The Cd accumulation results are as follows: Figure 4 As shown, under 2-20 μM Cd treatment, the cadmium content in the roots and shoots of WT was significantly higher than that in the two mutants, indicating that... OsSQD1 The CRISPR / Cas9 mutation reduces root uptake of Cd and its accumulation in the aboveground parts, especially at high Cd concentrations. OsSQD1 CRISPR / Cas9 mutant homozygotes can still effectively block Cd transport, and the amount of Cd accumulated is significantly reduced compared to WT.

[0042] Subsequently, the subcellular level Cd content of the aboveground parts of rice seedlings treated with different Cd nutrient solutions (1 and 5 μM CdCl2) for 7 days was detected, and the results are as follows: Figure 5 As shown, under different Cd treatment conditions, OsSQD1 CRISPR / Cas9 mutants reduced Cd accumulation in cell walls, organelles, and cytoplasm in both the aerial parts and roots, indicating that... OsSQD1CRISPR / Cas9 mutations reduce the accumulation of Cd at subcellular levels.

[0043] Example 3 This embodiment presents a yield and grain Cd content test conducted under 5 μM Cd-contaminated soil.

[0044] (1) Materials and seedling raising: Refer to Example 1 (WT and ossqd1 50 plants each, 20 days old.

[0045] (2) Soil preparation: Mix ordinary farmland soil with CdCl2 solution, adjust to 5 μM Cd concentration, and after equilibration for 1 week, fill pots (5 kg of soil per pot).

[0046] (3) Transplanting and cultivation: 20-day-old seedlings were transplanted into Cd-contaminated soil, 2 seedlings per pot, and managed with conventional water and fertilizer (30℃ natural light) for 21 weeks.

[0047] 4) Measurement of indicators: Yield: The weight of grains per plant (g) is recorded after harvest; Cd content of grains: The Cd content of grains (mg / kg) is determined by atomic absorption spectrometry.

[0048] The results are as follows Figure 6 As shown, under 1 μM and 5 μM Cd treatment conditions, the yield of individual mutant plants was not significantly different from that of wild type, indicating that under different Cd treatment conditions, OsSQD1 CRISPR / Cas9 mutations do not affect normal rice yield; comparison of Cd content in grains shows that the Cd content in mutant grains is lower than that in wild types, decreasing by 42.5%-44.8% (1 μM Cd) and 44.0%-44.2% (5 μM Cd), respectively; in addition, it also reduces the accumulation of Cd in bran and grains, indicating that... OsSQD1 The CRISPR / Cas9 mutation can effectively reduce the Cd content in the edible parts (grains) of rice while ensuring rice yield, and has good application value in cultivating green, high-quality and high-yield rice.

[0049] In summary, this invention knocks out rice using CRISPR / Cas9 technology. OsSQD1The mutant exhibited significant advantages under cadmium (Cd) stress: after 20-day seedling CdCl2 treatment (0-20 μM) and 21-week soil planting trials, the mutant showed significantly higher aboveground length, aboveground dry weight, and root length than the wild type under Cd stress. The Cd accumulation in the whole plant (aboveground and roots) and at the subcellular (cell wall, organelles, and cytoplasm) levels was significantly reduced, and the Cd content in the grains at the grain maturity stage was significantly lower than that in the wild type. The yield was no different from that of the wild type. This mutant achieved the triple goals of "resistance to Cd stress, low Cd accumulation, and high yield and quality", which not only reduced the risk of Cd pollution but also ensured planting benefits, providing an innovative solution for the safe production of rice in Cd-polluted areas.

[0050] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. Application of reagents that deactivate the function of thioisorhamnoglycerol synthase in rice in the creation of low-cadmium-accumulation, high-yield rice.

2. The application according to claim 1, characterized in that, The nucleic acid sequence of the gene encoding the thioisorhamnoglycerol synthase includes the sequence shown in SEQ ID NO.

1.

3. The application according to claim 1 or 2, characterized in that, The reagents include gene-editing agents that knock out or knock down the gene encoding thioisorhamnoglycerol synthase.

4. The application according to any one of claims 1-3, characterized in that, The reagent includes a CRISPR / Cas9 gene editing system, and the nucleic acid sequence of the target sequence of the CRISPR / Cas9 gene editing system includes the sequence shown in SEQ ID NO.

2.

5. A reagent kit for creating low-cadmium-accumulation, high-yield rice, characterized in that, The kit includes a CRISPR / Cas9 gene editing system, wherein the nucleic acid sequence of the target sequence of the CRISPR / Cas9 gene editing system includes the sequence shown in SEQ ID NO.

2.

6. The reagent kit for creating low-cadmium-accumulation, high-yield rice according to claim 5, characterized in that, The CRISPR / Cas9 gene editing system includes a CRISPR / Cas9 vector.

7. A method for creating low-cadmium-accumulation, high-yield rice, characterized in that, The method includes: By depleting the functional thio-isorhamnoglycerol synthase in rice, a high-yield rice with low cadmium accumulation was obtained.

8. The method for creating low-cadmium-accumulation, high-yield rice according to claim 7, characterized in that, The method includes the following steps: S1. In the thioisorhamnoglycerol diglyceride synthase gene OsSQD1 Target sequences are selected from exons in the 5'-UTR region; S2. Construct a CRISPR / Cas9 recombinant vector containing the target sequence; S3. The CRISPR / Cas9 recombinant vector was introduced into rice callus to obtain transgenic seedlings; S4. Screen for transgenic positive plants among the transgenic seedlings; S5. Obtain mutant plants using the transgenic positive plants.

9. The method for creating low-cadmium-accumulation, high-yield rice according to claim 7 or 8, characterized in that, The nucleic acid sequence of the target sequence includes the sequence shown in SEQ ID NO.

2.

10. The method for creating low-cadmium-accumulation, high-yield rice according to any one of claims 7-9, characterized in that, Step S5 includes extracting DNA from the transgenic positive plants, performing PCR amplification to obtain amplification products, sequencing the amplification products, and selecting T0 generation homozygous mutant plants with loss-of-function mutations as mutant plants.

Images