A biomarker for diagnosing polycystic ovary syndrome and its application
By using circSPECC1(4) as a diagnostic biomarker for polycystic ovary syndrome (PCOS), and utilizing specific siRNA and detection methods, the issues of specificity and accuracy in the diagnosis of PCOS have been resolved, enabling rapid and accurate detection and differential diagnosis of PCOS.
Patent Information
- Application Number
- CN202610299912.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-12
- Publication Date
- 2026-06-02
AI Technical Summary
Current technologies for diagnosing polycystic ovary syndrome (PCOS) lack objective, specific, and stable early diagnostic targets, leading to frequent missed diagnoses and misdiagnoses, making it difficult to achieve early screening and risk warning for the disease. Research on circular RNA in the diagnosis of PCOS is incomplete, and there is a lack of standardized detection systems.
circSPECC1(4) was used as a diagnostic biomarker. Its expression was knocked down by specific siRNA. The expression of circSPECC1(4) in ovarian granulosa cells or peripheral serum samples was detected by real-time quantitative PCR and fluorescence in situ hybridization. Specific primers and probes were designed to ensure the accuracy and specificity of the detection.
It provides a highly specific and stable diagnostic tool for polycystic ovary syndrome (PCOS), reducing the risk of missed diagnoses and misdiagnoses. It is suitable for invasive precision diagnosis and non-invasive initial screening, supports rapid and accurate detection and differential diagnosis of the disease, is applicable to a variety of clinical samples, and meets the needs of the entire process of PCOS diagnosis and treatment.
Smart Images

Figure CN122128423A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to a biomarker for diagnosing polycystic ovary syndrome and its application. Background Technology
[0002] Polycystic ovary syndrome (PCOS) is a common reproductive endocrine and metabolic disease in women of reproductive age. It has a high degree of clinical heterogeneity. Its core pathological features include abnormal ovarian granulosa cell function, follicular development disorders, and hyperandrogenemia. It can not only cause reproductive system problems such as menstrual disorders and infertility, but also significantly increase the risk of long-term diabetes, cardiovascular disease, and endometrial lesions, seriously affecting women's health throughout their entire life. Currently, the diagnosis of polycystic ovary syndrome (PCOS) in clinical practice mainly relies on the Rotterdam criteria, which requires a comprehensive assessment based on multiple pieces of evidence, including the patient's clinical phenotype, sex hormone level testing, and pelvic ultrasound imaging. However, this diagnostic model has significant limitations: patients' clinical phenotypes vary greatly from person to person, sex hormone levels are easily affected by factors such as testing time, medication use, and menstrual cycle, and imaging results are highly dependent on the operator's experience. It lacks objective, specific, and stable early diagnostic targets, making it easy to miss or misdiagnose the disease and making it difficult to achieve early screening and risk warning. Circular RNA is a type of closed circular non-coding RNA formed by backsplicing. Compared with linear nucleic acid molecules, it has natural structural stability that resists nuclease degradation, is not easily degraded in biological samples, and has strict tissue and disease expression specificity, making it an ideal potential biomarker in the field of molecular diagnosis of various diseases. In recent years, studies have successively found that circular RNAs are involved in the pathological process of polycystic ovary syndrome (PCOS). However, current research on the diagnosis of PCOS using circular RNAs is still incomplete. Most studies are only at the stage of differential expression screening, lacking complete verification of the structure, location, and pathological function of biomarkers. Furthermore, a standardized and clinically applicable detection system has not been formed, which cannot meet the full-process diagnosis and treatment needs of rapid screening, accurate diagnosis, and dynamic monitoring of PCOS in clinical practice. Summary of the Invention
[0003] The purpose of this invention is to provide a biomarker for diagnosing polycystic ovary syndrome and its application, so as to solve the problems mentioned in the background art.
[0004] To achieve the above objectives, the present invention adopts the following technical solution: A biomarker for diagnosing polycystic ovary syndrome (PCOS) is circSPECC1(4), which is formed by reverse splicing and circularization of the fourth exon of the SPECCC1 gene, has a length of 1580 nt, and possesses a closed circular RNA structure. circSPECC1(4) is specifically highly expressed in ovarian granulosa cells of PCOS patients, and there is no significant difference in the mRNA expression level of its parent gene SPECCC1. circSPECC1(4) possesses RNase R nuclease resistance stability and is mainly located in the cytoplasm of cells. Knocking down the expression of circSPECC1(4) can significantly promote apoptosis of ovarian granulosa cells and arrest the ovarian granulosa cell cycle at the G0 / G1 phase.
[0005] A small interfering RNA targeting circSPECC1 (4) for the diagnosis of polycystic ovary syndrome (PCOS) is described. The specific siRNA targeting the reverse splice junction region of circSPECC1 (4) has a sense strand sequence of 5'-GCCAAGGGGCCUUUACAACTT-3' and an antisense strand sequence of 5'-GUUGUAAAGGCCCCUUGGCTT-3'. The siRNA can specifically knock down the expression of circSPECC1 (4) with a knockdown efficiency of not less than 85% and does not affect the mRNA expression of the maternal gene SPECC1.
[0006] A reagent for detecting polycystic ovary syndrome, used to detect the expression level of circSPECC1 (4) in a sample by one or more methods including real-time quantitative PCR, fluorescence in situ hybridization, and RT-PCR, said reagent comprising primers or probes that specifically recognize the reverse splice ligation sequence of circSPECC1 (4).
[0007] As a further improvement to this technical solution: the primers that specifically recognize the reverse splicing ligation sequence of circSPECC1(4) are reverse PCR primers, with the following sequences: F:GAATTACTAAAGGCAAACGGTGAA; R:TGTTTCGTAGGAGTGGGAGTGTT As a further improvement to this technical solution: the probe sequence for specifically recognizing the circSPECC1 (4) backsplicing connection sequence is as follows: Probe F: TAATACGACTCACTATAGTCTGCTGGCCAAGGGGCCCTTTACAACA; Probe R: TGTGTAAAGGCCCCTTTGGCCAGCAGAGTATAGTGAGTCGTATTA.
[0008] As a further improvement to this technical solution: a kit for detecting polycystic ovary syndrome, wherein the test sample of the kit is human ovarian granulosa cells or human peripheral blood serum, the kit contains circSPECC1(4) specific qPCR primers, internal reference gene GAPDH primers, qPCR reaction reagents, positive control, negative control and blank control; the sequence of the circSPECC1(4) specific qPCR primers is forward FGAATTACTAAAGGCAAACGGTGAA, reverse RTGTTTCGTAGGAGTGGGAGTGTT, the sequence of the internal reference gene GAPDH primers is forward FCATGTACGTTGCTATCCAGGC, reverse RTCCTTAATGTCACGCACGAT, the positive control is SVOG cell cDNA known to highly express circSPECC1(4), the negative control is template-free and enzyme-free water, and the blank control is a system containing only qPCR reaction reagents.
[0009] A method for applying diagnostic biomarkers specifically includes the following steps: S1. Biomarker pre-validation stage: Complete the validation of the ring structure stability, subcellular localization and cell function of circSPECC1(4) to confirm the specific expression characteristics and pathological regulatory function of circSPECC1(4) in polycystic ovary syndrome. S2. Sample processing stage: Collect ovarian granulosa cells or peripheral blood serum samples from the subject, extract total RNA from the samples, verify the purity and integrity of RNA, and then reverse transcribe to obtain cDNA template. S3. In the specific quantitative detection stage, the circSPECC1(4) specific qPCR primers described in claim 2 are used to prepare the PCR reaction system, and the cDNA template is amplified by fluorescence quantitative PCR. The amplification signal and Ct value data are collected. S4. Result determination stage: Calculate the relative expression level of circSPECC1(4) in the sample to be tested, determine the test results by comparing with the preset diagnostic threshold, and complete the auxiliary diagnosis in combination with the clinical characteristics of polycystic ovary syndrome.
[0010] As a further improvement to this technical solution: the preset diagnostic thresholds are Ct value ≤ 32.5, relative expression level of circSPECC1(4) in ovarian granulosa cell samples ≥ 2.0, and relative expression level of circSPECC1(4) in serum samples ≥ 1.5; the detection results of the method are used for clinical screening of polycystic ovary syndrome, diagnosis of suspected cases, differential diagnosis with other reproductive endocrine diseases, and dynamic monitoring of the condition of polycystic ovary syndrome patients during treatment.
[0011] Compared with the prior art, the beneficial effects of the present invention are: 1. The present invention clearly defines circSPECC1(4) as a specific diagnostic biomarker for polycystic ovary syndrome (PCOS), fully verifying the structural characteristics, expression specificity, and pathological regulatory function of the circular RNA, filling the gap in the existing field of PCOS diagnosis where there is a lack of highly specific and stable molecular diagnostic targets; the biomarker has excellent nuclease resistance stability and is not easily degraded during the storage and transportation of clinical samples, and has stronger clinical applicability compared to traditional linear nucleic acid biomarkers. At the same time, relying on the specific detection system designed for its reverse splicing site, it can effectively eliminate the interference of linear homologous nucleic acid and genomic contamination, greatly improving the specificity and accuracy of disease diagnosis. It can also be adapted to various types of clinical samples such as ovarian granulosa cells and peripheral blood serum, taking into account the clinical needs of invasive precision diagnosis and non-invasive primary screening. At the same time, it can assist in the clinical differential diagnosis of PCOS and other reproductive endocrine diseases, significantly reducing the risk of misdiagnosis and missed diagnosis of the disease.
[0012] 2. The present invention provides a specific primer composition and probe designed for the reverse splicing ligation sequence of circSPECC1 (4), which can accurately identify and amplify the target circular RNA without significant non-specific amplification. The detection reagents and kits prepared based on this, together with supporting components such as nucleic acid extraction reagents, internal reference primers, and control standards, support multiple detection methods such as real-time RT-PCR and fluorescence in situ hybridization. They are easy to operate and have high detection efficiency, which can meet the clinical needs for rapid and accurate detection of PCOS and are suitable for large-scale clinical applications.
[0013] 3. The specific small interfering RNA designed in this invention targets the circSPECC1 (4) backsplicing site, which can efficiently knock down the expression of the target circular RNA (knockdown efficiency of over 85%), and has no effect on the linear SPECC1 RNA of the maternal gene, with extremely high specificity; this small interfering RNA can significantly promote ovarian granulosa cell apoptosis and arrest the cell cycle in the G0 / G1 phase, thereby improving the core pathological features of ovarian granulosa cell proliferation arrest and follicle development disorder in PCOS patients at the molecular level, providing a new functional molecular tool for targeted treatment of PCOS. Attached Figure Description
[0014] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this application, illustrate exemplary embodiments of the invention and, together with their description, serve to explain the invention and do not constitute an undue limitation thereof. In the drawings: Figure 1 shows the expression results of circSPECC1 (4) in ovarian granulosa cells of PCOS patients, indicating that circSPECC1 (4) was significantly upregulated in PCOS patients, while there was no significant difference in expression of the maternal gene SPECC1. Figure 2 shows the circular structure of circSPECC1 (4) and the Sanger sequencing results, confirming that circSPECC1 (4) is formed by the fourth exon of the SPECC1 gene and the reverse splicing site is accurate. Figure 3 shows the results of the RNase R enzyme digestion experiment of circSPECC1 (4), which confirms that circSPECC1 (4) has stability against RNase R enzyme digestion. Figure 4 shows the RT-PCR verification results of specific primers for circSPECC1 (4), confirming that circSPECC1 (4) is a closed circular structure; Figure 5 shows the results of the actinomycin D stability verification of circSPECC1 (4), confirming that the half-life of circSPECC1 (4) is significantly longer than that of linear RNA. Figure 6 shows the results of the nucleocytoplasmic separation experiment of circSPECC1 (4), confirming that circSPECC1 (4) is mainly located in the cytoplasm; Figure 7 The figure shows the FISH experiment results of circSPECC1 (4), which confirms that circSPECC1 (4) is located in the cytoplasm at the single-cell level. Figure 8 The figure shows the verification results of the interference efficiency of circSPECC1 (4), which shows that si-circSPECC1 (4) can efficiently knock down the expression of circSPECC1 (4) without affecting linear SPECC1; Figure 9 The results of apoptosis analysis after interfering with circSPECC1 (4) show that knocking down circSPECC1 (4) can significantly promote apoptosis of ovarian granulosa cells. Figure 10The cell cycle analysis results after interfering with circSPECC1 (4) show that knocking down circSPECC1 (4) can arrest the ovarian granulosa cell cycle at the G0 / G1 phase. Detailed Implementation
[0015] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. The invention is described more specifically in the following paragraphs by way of example with reference to the accompanying drawings. It should be noted that the drawings are in a very simplified form and use non-precise proportions, and are only used to facilitate and clarify the illustration of the embodiments of the present invention. Example 1
[0016] In this embodiment of the invention, a biomarker for diagnosing polycystic ovary syndrome (PCOS) is circSPECC1(4). circSPECC1(4) is formed by reverse splicing and circularization of the fourth exon of the SPECC1 gene, with a length of 1580 nt and a closed circular RNA structure. circSPECC1(4) is specifically highly expressed in ovarian granulosa cells of PCOS patients, and there is no significant difference in the mRNA expression level of its parent gene SPECC1. circSPECC1(4) possesses RNase R nuclease resistance stability and is mainly located in the cytoplasm of cells. Knocking down the expression of circSPECC1(4) can significantly promote apoptosis of ovarian granulosa cells and arrest the ovarian granulosa cell cycle at the G0 / G1 phase. Specifically, structural features: circSPECC1(4) is formed by reverse splicing and circularization of the fourth exon of the SPECC1 gene, with a length of 1580nt and a closed circular RNA structure; this restriction is the core that distinguishes circSPECC1(4) from linear SPECC1 mRNA, and the closed circular structure is the fundamental reason for its high stability. Expression characteristics: circSPECC1(4) is specifically highly expressed in ovarian granulosa cells of patients with polycystic ovary syndrome, and there is no significant difference in the mRNA expression level of its maternal gene SPECC1; this limitation confirms that the expression difference of circSPECC1(4) is caused by its own circularization regulation, rather than by changes in the expression of the maternal gene, thus fundamentally confirming its rationality as a specific diagnostic marker for polycystic ovary syndrome. Physicochemical characteristics: circSPECC1(4) has RNase R nuclease resistance stability; RNase R nuclease can degrade most linear RNAs, but has no degradation effect on closed circular RNAs. This characteristic is the core marker that distinguishes circular RNAs from linear RNAs, and also confirms that this marker is not easily degraded during the storage and transportation of clinical samples, and has the practicality of clinical detection. Location characteristics: circSPECC1(4) is mainly located in the cytoplasm of cells; the subcellular location characteristics clarified the intracellular distribution pattern of this marker, provided a basis for the study of its functional mechanism, and further confirmed the molecular properties of this circular RNA; Functional characteristics: The expression of circSPECC1(4) can significantly promote apoptosis of ovarian granulosa cells and arrest the ovarian granulosa cell cycle in the G0 / G1 phase. This limitation confirms from a functional perspective that circSPECC1(4) directly participates in the core pathological process of polycystic ovary syndrome, rather than simply the expression difference, providing a complete pathological mechanism support for its use as a diagnostic marker.
[0017] A reagent for detecting polycystic ovary syndrome, used to detect the expression level of circSPECC1 (4) in a sample by one or more methods including real-time quantitative PCR, fluorescence in situ hybridization, etc., said reagent comprising primers or probes that specifically recognize the reverse splicing ligation sequence of circSPECC1 (4); The primers that specifically recognize the reverse splicing ligation sequence of circSPECC1(4) are reverse PCR primers, and their sequences are as follows: F:GAATTACTAAAGGCAAACGGTGAA; R:TGTTTCGTAGGAGTGGGAGTGTT; The probe sequence that specifically identifies the circSPECC1 (4) backsplicing ligation sequence is as follows: Probe F: TAATACGACTCACTATAGTCTGCTGGCCAAGGGGCCCTTTACAACA; Probe R: TGTGTAAAGGCCCCTTTGGCCAGCAGAGTATAGTGAGTCGTATTA.
[0018] Specifically, the reverse PCR primer is used to verify the reverse splice site of circSPECC1(4). After PCR amplification using this primer, combined with Sanger sequencing, it can be confirmed that the sequence of the amplified product is completely matched with the reverse splice site of circSPECC1(4). This confirms the accuracy of the amplification target at the molecular level and avoids false positive amplification. It is the core tool for verifying the authenticity of this biomarker. Specific qPCR primers: These are the core primers used in clinical testing to quantify the expression level of circSPECC1(4). The primers are designed to completely span the reverse splice site of circSPECC1(4), and can only specifically amplify the circular circSPECC1(4). They cannot amplify linear SPECC1 mRNA or genomic DNA, thus ensuring the specificity of clinical testing from the root.
[0019] A small interfering RNA targeting circSPECC1 (4) for the diagnosis of polycystic ovary syndrome is described. The specific siRNA targeting the reverse splice junction region of circSPECC1 (4) has a sense strand sequence of 5'-GCCAAGGGGCCUUUACAACTT-3' and an antisense strand sequence of 5'-GUUGUAAAGGCCCCUUGGCTT-3'. The siRNA can specifically knock down the expression of circSPECC1 (4) with a knockdown efficiency of not less than 85% and does not affect the mRNA expression of the maternal gene SPECC1. Specifically, the siRNA sequence design targets the backsplicing junction of circSPECC1(4), which can only specifically bind to the backsplicing site of the circular circSPECC1(4) and cannot bind to the linear SPECC1 mRNA. This achieves specific knockdown of circSPECC1(4) without affecting the expression of its parent gene, thus avoiding the influence of parent gene interference on the results of functional experiments. Functional effect limitation: the knockdown efficiency of siRNA on circSPECC1(4) is not less than 85%. This knockdown efficiency meets the requirements of cell function experiments and can stably achieve silencing of circSPECC1(4) expression. This provides a stable experimental tool for verifying the regulatory function of this marker on apoptosis and cell cycle of ovarian granulosa cells and supports the functional characteristics of circSPECC1(4).
[0020] A kit for detecting polycystic ovary syndrome (PCOS) is provided. The test sample of the kit is human ovarian granulosa cells or human peripheral blood serum. The kit contains circSPECC1(4) specific qPCR primers, internal reference gene GAPDH primers, qPCR reaction reagents, positive control, negative control and blank control. The circSPECC1(4) specific qPCR primer sequences are forward FGAATTACTAAAGGCAAACGGTGAA and reverse RTGTTTCGTAGGAGTGGGAGTGTT. The internal reference gene GAPDH primer sequences are forward FCATGTACGTTGCTATCCAGGC and reverse RTCCTTAATGTCACGCACGAT. The positive control is SVOG cell cDNA known to highly express circSPECC1(4). The negative control is template-free and enzyme-free water. The blank control is a system containing only qPCR reaction reagents. Specifically, the test samples are limited to human ovarian granulosa cells or human peripheral blood serum for auxiliary diagnostic reagents or kits; among them, ovarian granulosa cells are suitable for the accurate diagnosis of surgical patients, and serum samples are suitable for non-invasive initial screening of outpatients, covering the testing needs of different clinical scenarios and expanding the clinical applicability of this biomarker. Reagent Kit Core Components Requirements: The reagent kit must contain the following core components, and the uses of each component are as follows: circSPECC1(4) specific qPCR primers: used for specific amplification and quantification of target molecules, and are the core functional components of the kit; Internal reference gene GAPDH primers: used to correct for differences in RNA loading and reverse transcription efficiency between different samples, ensuring the accuracy of quantitative results, and are a routine reference component for qPCR detection; qPCR reaction reagents: These provide the basic reaction system for qPCR amplification and include hot-start Taq enzyme, dNTPs, fluorescent dyes, buffers, etc. They are the basic components for achieving the amplification reaction. Positive control, negative control, and blank control constitute the three-level quality control system of the kit. The positive control is used to verify the effectiveness of the kit's amplification system, the negative control is used to detect whether there is genomic contamination in the sample, and the blank control is used to exclude contamination from the reagent itself. The three work together to ensure the reliability of each batch of test results and avoid false positive and false negative results.
[0021] A method for applying diagnostic biomarkers includes the following steps: S1. Biomarker pre-validation stage: Complete the validation of the ring structure stability, subcellular localization and cell function of circSPECC1(4) to confirm the specific expression characteristics and pathological regulatory function of circSPECC1(4) in polycystic ovary syndrome. S2. Sample processing stage: Collect ovarian granulosa cells or peripheral blood serum samples from the subject, extract total RNA from the samples, verify the purity and integrity of RNA, and then reverse transcribe to obtain cDNA template. S3. In the specific quantitative detection stage, the circSPECC1(4) specific qPCR primers of claim 2 are used to prepare the PCR reaction system, and the cDNA template is amplified by fluorescent quantitative PCR. The amplification signal and Ct value data are collected. S4. Result determination stage: Calculate the relative expression level of circSPECC1(4) in the sample to be tested, determine the test results by comparing with the preset diagnostic threshold, and complete the auxiliary diagnosis in combination with the clinical characteristics of polycystic ovary syndrome. Specifically, the S1 biomarker pre-validation stage: This step is the prerequisite for clinical testing. By completing the verification of the ring structure stability, subcellular localization, and cell function of circSPECC1(4), the molecular authenticity, disease specificity, and pathological relevance of the biomarker are fully confirmed, providing a solid theoretical and experimental basis for subsequent clinical testing and ensuring the accuracy of clinical testing targets. S2 Sample Processing Stage: This step is the core step in obtaining a qualified test template. Through standardized sample collection, RNA extraction, purity and integrity verification, and reverse transcription, a high-quality cDNA template is obtained from clinical samples. This avoids deviations in test results caused by sample degradation and contamination, and is a fundamental step in ensuring reliable test results. S3 Specific Quantitative Detection Stage: This step is the core of the detection method. The specific primers described in claim 2 are used to achieve specific amplification of circSPECC1(4). The fluorescence signal and Ct value during the amplification process are collected by a fluorescence quantitative PCR instrument to provide raw data for subsequent quantitative calculation. This is the core step to achieve target molecule quantification. S4 Result Determination Stage: This step is the output stage of the detection method. The relative expression level of circSPECC1(4) in the sample to be tested is calculated by the 2−ΔΔCt method. The positive and negative results are determined by comparing with the preset diagnostic threshold. Combined with the clinical characteristics of polycystic ovary syndrome, it provides auxiliary diagnostic basis for clinical practice and realizes the clinical diagnostic value of this biomarker.
[0022] The preset diagnostic thresholds are Ct value ≤ 32.5, relative expression of circSPECC1(4) in ovarian granulosa cell samples ≥ 2.0, and relative expression of circSPECC1(4) in serum samples ≥ 1.5. The detection results of the method are used for clinical screening of polycystic ovary syndrome, diagnosis of suspected cases, differential diagnosis with other reproductive endocrine diseases, and dynamic monitoring of the condition of polycystic ovary syndrome patients during treatment. Specifically, the diagnostic threshold is defined as follows: Ct value ≤ 32.5, relative expression level of circSPECC1(4) in ovarian granulosa cell samples ≥ 2.0, and relative expression level of circSPECC1(4) in serum samples ≥ 1.5. This threshold is determined based on ROC curve analysis of large sample clinical data. Differential thresholds are set for the characteristics of granulosa cells and serum samples, taking into account both the sensitivity and specificity of the detection. It is the core basis for clinical determination of positive and negative results. Clinical application scenarios are limited: the test results can be used for initial clinical screening of polycystic ovary syndrome (PCOS), diagnosis of suspected cases, differential diagnosis with other reproductive endocrine diseases, and dynamic monitoring of the patient's condition during treatment. This limitation fully covers the needs of the entire process of clinical diagnosis and treatment of PCOS, from initial screening, diagnosis, differential diagnosis to treatment monitoring, comprehensively expanding the clinical application value of this biomarker and fully defining the clinical applicability of this test method.
[0023] The method of use and working principle of this invention are as follows: Instructions for use: Before use, first verify the ring structure stability, subcellular localization and cellular function of the circSPECC1(4) biomarker to confirm its specific expression characteristics and pathological regulatory function in polycystic ovary syndrome. Then, collect the corresponding biological samples of the test subjects in a standardized manner, extract the total RNA from the samples and verify its purity and integrity before reverse transcription to obtain the cDNA template. Then, use specific primers designed for the reverse splicing site of the biomarker to configure the PCR reaction system, perform fluorescent quantitative PCR amplification on the cDNA template and collect the amplification signal and related data. Then, calculate the relative expression level of the biomarker using a standardized method, and determine the positive or negative result of the test by comparing it with the preset diagnostic threshold. Finally, combine the clinical characteristics of polycystic ovary syndrome to complete the auxiliary diagnosis of the disease. The test results can be used simultaneously for the initial clinical screening of the disease, the diagnosis of suspected cases, the differential diagnosis with other reproductive endocrine diseases and the dynamic monitoring of the patient's condition during the treatment process.
[0024] Working principle: circSPECC1(4), which is specifically highly expressed in patients with polycystic ovary syndrome (PCOS), is used as the core diagnostic biomarker. This biomarker is a closed circular RNA formed by the reverse splicing and circularization of the corresponding maternal gene exon. It has structural stability that resists nuclease degradation and can participate in the core pathological process of the disease by regulating the apoptosis and cell cycle of ovarian granulosa cells. Based on this, specific primers designed across the reverse splicing site of this biomarker can only specifically amplify the circular target biomarker without recognizing linear homologous nucleic acids. The expression level of the target biomarker can be accurately quantified by real-time PCR technology. Combined with a preset diagnostic threshold, the expression difference of the biomarker is transformed into a clinically interpretable auxiliary diagnostic result, and finally, the in vitro auxiliary diagnosis of PCOS is realized. Example 2
[0025] Screening and identification of circSPECC1 (4) 1. Sample collection: Ovarian granulosa cell samples were collected from 3 PCOS patients and 3 normal women of childbearing age. All samples were approved through ethical review and the patients signed informed consent forms.
[0026] 2. Total RNA extraction: Total RNA was extracted from the samples using Trizol reagent. The sequencing data was quality controlled using FastQC (v0.11.9) software, and Trim Galore (v0.6.5) was used to remove adapters and poor-quality sequences from the raw data.
[0027] 3. circRNA screening and analysis: CIRIquant (v1.1.3) software was used to identify the backsplicing sites and expression levels of circRNAs, HISAT2 (2.2.1) software was used to align the original reads to the reference genome, and StringTie (v1.3.4) software was used to calculate gene expression levels and screen for differentially expressed circRNAs.
[0028] 4. Results: circSPECC1 (4) was found to be significantly upregulated in ovarian granulosa cells of PCOS patients, while there was no significant difference in expression of the maternal SPECC1 gene. circSPECC1 (4) is formed by the circularization of the fourth exon of the SPECC1 gene and is 1580 nt in length. The accuracy of its reverse splicing site was verified by reverse PCR and Sanger sequencing. The reverse PCR primers were: circSPECC1 (4)-3F: TGAAGAGCCCACCACTCAG, circSPECC1 (4)-5R: CATTTGTTGCTGGTCTGATA. Example 3
[0029] Stability verification of the ring structure of circSPECC1 (4) RNase R enzyme digestion experiment 1. Take total RNA (2 μg / group) from the same sample and divide it into 2 groups: blank control group (RNA only, no enzyme) and RNase R treatment group (10 U / μg RNase R added, incubated at 37℃ for 30 min). 2. After the reaction is complete, add EDTA (final concentration 10mM) to terminate the reaction, and use Novizan nucleic acid purification magnetic beads to recover RNA from each group; 3. The relative expression levels of circSPECC1 (4) and linear RNA (GAPDH mRNA, linear SPECC1 mRNA) were detected by real-time quantitative PCR. The primers were circular-specific primers for circSPECC1 (4) and linear RNA-specific primers, respectively. 4. Results: The expression level of circSPECC1 (4) in the RNase R treatment group was not significantly different from that in the blank control group (P>0.05), while the expression level of linear RNA was significantly reduced (P<0.05, reduction ≥80%), confirming that circSPECC1 (4) has the stability of a circular structure that resists RNase R enzyme digestion.
[0030] Actinomycin D test 1. The cultured SVOG cells were divided into circSPECC1 (4) experimental group (with 5 μg / mL actinomycin D added) and control group (without added); 2. Collect cells at different time points (0h, 2h, 4h, 8h, and 12h) and extract total RNA; 3. Real-time quantitative PCR was used to detect the relative expression levels of circSPECC1 (4) and linear RNA, and the half-life was calculated. 4. Results: The degradation rate of circSPECC1 (4) was significantly slower than that of linear RNA, and its half-life was ≥2 times that of linear RNA, further confirming the stability of its circular structure.
[0031] Specific primer RT-PCR verification 1. Culture SVOG cells to 90% density, extract total RNA using Vazyme FreeZol Reagent, reverse transcribe cDNA using YEASEN Reverse Transcription Kit (11119ES60), and extract gDNA using Tiangen DP304 Kit; 2. Using cDNA and gDNA as templates, PCR amplification was performed using reverse PCR primer pairs (to amplify circSPECC1 (4)) and forward PCR primer pairs (to amplify linear SPECC1). The PCR system and procedure are as follows: The standard PCR system for reverse PCR primers is as follows: Prime Star Mix 12.5 μL, water to 25 μL, primer F / R 0.5 μL each, template 1 μL; program: 95℃ for 1 min, 98℃ for 10 s, 55℃ for 30 s, 72℃ for 30 s, 35 cycles, 72℃ for 7 min, and store at 12℃. Real-time quantitative PCR system: YEASEN Hieff® qPCR SYBR Green Master Mix 10 μL, water 8.68 μL, primers F / R 0.16 μL each, template 1 μL; program: 95℃ for 5 min, 95℃ for 15 s, 60℃ for 1 min, 45 cycles, melting curve analysis; 3. PCR products were detected by agarose gel electrophoresis; 4. Results: specific amplification bands were visible with cDNA + reverse PCR primers, while no amplification bands were visible with gDNA + reverse PCR primers, confirming that circSPECC1 (4) is a closed circular structure. Example 4
[0032] Subcellular localization validation of circSPECC1 (4) Nucleocytoplasmic separation experiment 1. Collect 2×10⁶ SVOG cells and separate the nucleus and cytoplasm using the Beyotime Nuclear and Cytoplasmic Protein Extraction Kit (P0027); 2. Equal amounts of external reference RNA were added to the lysate products of the cell nucleus and cytoplasm, total RNA was extracted using Trizol reagent, and cDNA was synthesized using the YEASEN reverse transcription kit; 3. Real-time quantitative PCR was used to detect the relative expression levels of circSPECC1 (4), U1 (nuclear marker), and ACTB (cytoplasmic marker). Primer sequences are described in the invention. 4. Results: U1 was mainly distributed in the nucleus, ACTB was mainly distributed in the cytoplasm, and circSPECC1 (4) was mainly distributed in the cytoplasm. The nucleoplasm separation effect was good, and the subcellular localization of circSPECC1 (4) was clarified.
[0033] Fluorescence in situ hybridization (FISH) experiment 1. Probe preparation: Synthesize an in vitro transcription probe targeting the circSPECC1 (4) reverse splicing ligation sequence, labeled with digoxigenin / biotin, the probe sequence is described in the invention content; 2. Cell spreader preparation: SVOG cells are seeded onto 12-well plates and cultured until confluence reaches 60%-70%. 3. Cell fixation and permeabilization: Wash 3 times with 1×PBS for 5 min each time, fix with 4% paraformaldehyde at room temperature for 10 min, wash 3 times with PBS for 5 min each time, permeabilize with 0.5% Triton X-100 at room temperature for 5 min, and wash 3 times with PBS for 5 min each time. 4. Prehybridization and hybridization: Add 400 μL of prehybridization solution and block at 37°C for 30 min. Discard the prehybridization solution and add 200 μL of hybridization solution containing 1 μg of labeled probe. Hybridize overnight at 37°C in the dark. 5. Washing: Wash 3 times for 5 min with 4×SSC + 0.1% Tween20 at 42℃, wash once with 2×SSC, wash once with 1×SSC, and wash 3 times for 5 min with 1×PBS. 6. Blocking and antibody incubation: Block with 1% BSA + 0.3% Triton X-100 at room temperature for 30 min, dilute Anti-Biotin-FITC antibody 1:400, incubate in the dark for 1 h, and wash 3 times with PBS for 5 min each time. 7. Nuclear staining: Stain with 1% Hoechst 33342 at room temperature in the dark for 20 min, then wash with PBS 3 times for 5 min each time; 8. Mounting and Detection: Mount the slides with anti-fluorescence quenching mounting medium and observe them under a fluorescence microscope / confocal microscope; 9. Results: circSPECC1 (4) showed a specific fluorescent signal in the cytoplasm of SVOG cells, but no obvious signal in the nucleus, confirming its location in the cytoplasm at the single-cell level. Example 5
[0034] Construction and Interference Efficiency Verification of si-circSPECC1 (4) 1. siRNA design and synthesis: A specific siRNA (si-circSPECC1 (4)) was designed targeting the reverse splicing junction of circSPECC1 (4), with the sense strand being 5'-GCCAAGGGGCCUUUACAACTT-3' and the antisense strand being 5'-GUUGUAAAGGCCCCUUGGCTT-3', and was synthesized by Gemma Gene. At the same time, a negative control siRNA (NC) and a siRNA targeting linear SPECC1 (si-SPECC1) were synthesized. 2. Preparation of siRNA storage solution: Centrifuge siRNA dry powder at 4℃ (4000 rpm, 5 min), add 125 μL of DEPC water to prepare a 20 pmol / μL storage solution, and store at -20℃; 3. Cell transfection: SVOG cells were seeded in 12-well plates and cultured to a confluence of 60%-80%. They were then transfected using Lipofectamine™ RNAiMAX transfection reagent. The cells were divided into two groups: NC group and si-circSPECC1 (4) group, with two biological replicates per group. The transfection system consisted of tube A (50 μL opti-MEM + 3 μL transfection reagent) and tube B (50 μL opti-MEM + 1.5 μL 30 pmol / μL siRNA). The cells were incubated at room temperature for 5 min, then mixed and incubated in the dark for 15 min before being added to the cell wells. 4. RNA extraction and cDNA synthesis: 36 h after transfection, cells were washed with PBS, total RNA was extracted using Vazyme FreeZolReagent, and cDNA was synthesized using the YEASEN reverse transcription kit; 5. Real-time quantitative PCR detection: qRT-PCR was performed using specific primers for circSPECC1 (4) and linear SPECC1, and the relative expression level was calculated using the 2−ΔΔCt method; 6. Results: Compared with the NC group, the expression level of circSPECC1 (4) in the si-circSPECC1 (4) group was significantly reduced, with a knockdown efficiency of over 85% (p<0.01), and the expression level of linear SPECC1 did not change significantly, confirming that si-circSPECC1 (4) can specifically knock down the expression of circSPECC1 (4). Example 6
[0035] Effect of knockdown of circSPECC1 (4) on apoptosis of ovarian granulosa cells 1. Cell transfection: SVOG cells were seeded in 6-well plates and cultured until the confluence reached 60%-80%. siRNA transfection was performed according to the transfection method in Example 4. Groups: NC group, si-circSPECC1 (4) group; 2. Cell collection: 36 h after transfection, collect the culture medium, digest adherent cells with trypsin without EDTA, stop digestion with culture medium, centrifuge at 1000 rpm for 5 min, discard the supernatant, resuspend in pre-cooled PBS and wash twice to obtain cell pellet; 3. Annexin V-FITC / PI double staining: Resuspend cells in 1×Binding Buffer to a concentration of 1-5×10⁶ / ml. Take 100μL of cell suspension, add 5μL of Annexin V-FITC, incubate at room temperature in the dark for 5min, add 5μL of LPI and 400μL of 1×Binding Buffer, mix well and immediately load the sample. 4. Flow cytometry detection: Set up blank control tubes, single-stained FITC tubes, and single-stained PI tubes, adjust the voltage and compensation, collect data from the detection tubes, and analyze the apoptosis rate using FlowJo VX software; 5. Results: Compared with the NC group, the total apoptosis rate (early + late) of the si-circSPECC1 (4) group was significantly increased, and the proportion of early apoptotic cells was significantly increased, confirming that knockdown of circSPECC1 (4) can significantly promote apoptosis of ovarian granulosa cells. Example 7
[0036] Effects of circSPECC1 knockdown (4) on the ovarian granulosa cell cycle 1. Cell transfection: As in Example 5, SVOG cells were seeded in 6-well plates and transfected with siRNA; 2. Cell collection and fixation: 48 h after transfection, cells were collected and washed, resuspended in 1 mL of pre-cooled 70% ethanol, and fixed overnight at 4°C; 3. Cell staining: Centrifuge at 1000g for 5 min, discard the supernatant, wash twice with pre-cooled PBS, add 0.5m of staining working solution (containing PI and RNase A) from LYEASEN Cell Cycle and Apoptosis Analysis Kit (40301ES50), and incubate at 37℃ in the dark for 30 min; 4. Flow cytometry detection: BD FACSCanto II flow cytometer, excitation wavelength 488nm, emission wavelength 617nm, ModFit LT software analysis of the proportion of each phase of the cell cycle; 5. Results: Compared with the NC group, the proportion of cells in the G0 / G1 phase was significantly increased in the si-circSPECC1 (4) group, while the proportion of cells in the S phase and G2 / M phase was significantly decreased, confirming that knocking down circSPECC1 (4) can arrest the ovarian granulosa cell cycle in the G0 / G1 phase and inhibit cells from entering the S phase.
[0037] Example 8 Preparation of kits for detecting polycystic ovary syndrome The kit contains the following components: 1. Nucleic acid extraction reagents: Trizol reagent, chloroform, isopropanol, 75% ethanol, DEPC water; 2. Specific primer composition: The reverse PCR primer pair of circSPECC1 (4), the forward PCR primer pair of linear SPECC1, and the detection primer pair of internal reference gene (U1 / ACTB / GAPDH) were all prepared into a 10 μmol / L stock solution. 3. Specific probe: an in vitro transcription probe targeting circSPECC1 (4), labeled with biotin at a concentration of 1 μg / μL; 4. PCR reaction reagents: YEASEN Hieff® qPCR SYBR Green Master Mix, Prime StarMix, reverse transcriptase, dNTPs, RNase inhibitor, PCR buffer; 5. Staining and auxiliary reagents: agarose, nucleic acid dyes, DL5000 DNA Marker, Hoechst 33342, Anti-Biotin-FITC antibody; 6. Controls: Positive control (cDNA containing circSPECC1 (4)) and negative control (cDNA of normal ovarian granulosa cells). 7. Buffer solutions: 1×PBS, 10×Binding Buffer, hybridization wash buffer, blocking buffer.
[0038] The kit can be used in accordance with the detection requirements by selecting real-time quantitative PCR, conventional RT-PCR, or FISH. It is easy to operate, highly specific, and can achieve rapid diagnosis of PCOS.
[0039] Example 9 Preparation of pharmaceutical compositions for treating polycystic ovary syndrome Taking liposome encapsulation formulation as an example, a pharmaceutical composition containing si-circSPECC1 (4) was prepared: Soybean lecithin and cholesterol are mixed in a mass ratio of 3:1, dissolved in chloroform, and the chloroform is removed by rotary evaporation to form a lipid film. Add PBS buffer containing si-circSPECC1 (4) (concentration 20 pmol / μL), hydrate the lipid membrane, and sonicate to form a liposome suspension; Sterilize by passing through a 0.22μm filter membrane, aliquot, and store at 4℃; this liposome encapsulation formulation can achieve local targeted delivery of si-circSPECC1(4) to the ovary, improve its stability and cellular uptake efficiency, and reduce systemic side effects.
[0040] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Those skilled in the art can readily implement the present invention based on the accompanying drawings and the description above. However, any modifications, alterations, or variations made by those skilled in the art without departing from the scope of the present invention, using the disclosed technical content, are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, or variations made to the above embodiments based on the essential technology of the present invention are still within the protection scope of the present invention.
Claims
1. A biomarker for diagnosing polycystic ovary syndrome, characterized in that, The diagnostic biomarker is circSPECC1(4), which is formed by reverse splicing and circularization of the fourth exon of the SPECC1 gene. It is 1580 nt in length and has a closed circular RNA structure. circSPECC1(4) is specifically highly expressed in ovarian granulosa cells of patients with polycystic ovary syndrome, and there is no significant difference in the mRNA expression level of its parent gene SPECC1. circSPECC1(4) has RNase R nuclease resistance stability and is mainly located in the cytoplasm of cells. Knocking down the expression of circSPECC1(4) can significantly promote apoptosis of ovarian granulosa cells and arrest the ovarian granulosa cell cycle in the G0 / G1 phase.
2. An application of a small interfering RNA targeting circSPECC1(4) as a biomarker for diagnosing polycystic ovary syndrome, characterized in that, A specific siRNA targeting the reverse splicing junction region of circSPECC1(4) has a positive strand sequence of 5'-GCCAAGGGGCCUUUACAACTT-3'. The antisense sequence is 5'-GUUGUAAAGGCCCCUUGGCTT-3'; The siRNA can specifically knock down the expression of circSPECC1(4) with a knockdown efficiency of not less than 85%, and does not affect the mRNA expression of the maternal gene SPECC1.
3. A reagent for detecting polycystic ovary syndrome, used to detect the expression level of circSPECC1(4) in a sample by one or more methods selected from real-time quantitative PCR, fluorescence in situ hybridization, and RT-PCR, characterized in that: The reagent contains primers or probes that specifically recognize the circSPECC1 (4) reverse splice ligation sequence.
4. The reagent for detecting polycystic ovary syndrome according to claim 3, characterized in that, The primers that specifically recognize the reverse splicing ligation sequence of circSPECC1(4) are reverse PCR primers, and their sequences are as follows: F:GAATTACTAAAGGCAAACGGTGAA; R:TGTTTCGTAGGAGTGGGAGTGTT.
5. The reagent for detecting polycystic ovary syndrome according to claim 3, characterized in that, The probe sequence specifically identifying the circSPECC1 (4) backsplicing ligation sequence is as follows: Probe F: TAATACGACTCACTATAGTCTGCTGGCCAAGGGGCCCTTTACAACA; Probe R: TGTGTAAAGGCCCCTTTGGCCAGCAGAGTATAGTGAGTCGTATTA.
6. A kit for detecting polycystic ovary syndrome, comprising the reagents described in claims 3-5, characterized in that, The test sample of the kit is human ovarian granulosa cells or human peripheral blood serum. The kit contains circSPECC1(4) specific qPCR primers, internal reference gene GAPDH primers, qPCR reaction reagents, positive control, negative control and blank control. The circSPECC1(4) specific qPCR primer sequences are forward FGAATTACTAAAGGCAAACGGTGAA and reverse RTGTTTCGTAGGAGTGGGAGTGTT. The internal reference gene GAPDH primer sequences are forward FCATGTACGTTGCTATCCAGGC and reverse RTCCTTAATGTCACGCACGAT. The positive control is SVOG cell cDNA known to highly express circSPECC1(4). The negative control is template-free and enzyme-free water. The blank control is a system containing only qPCR reaction reagents.
7. A method for applying diagnostic biomarkers, characterized in that, Includes the following steps: S1. Biomarker pre-validation stage: Complete the validation of the ring structure stability, subcellular localization and cell function of circSPECC1(4) to confirm the specific expression characteristics and pathological regulatory function of circSPECC1(4) in polycystic ovary syndrome. S2. Sample processing stage: Collect ovarian granulosa cells or peripheral blood serum samples from the subject, extract total RNA from the samples, verify the purity and integrity of RNA, and then reverse transcribe to obtain cDNA template. S3. In the specific quantitative detection stage, the circSPECC1(4) specific qPCR primers described in claim 2 are used to prepare the PCR reaction system, and the cDNA template is amplified by fluorescence quantitative PCR. The amplification signal and Ct value data are collected. S4. Result determination stage: Calculate the relative expression level of circSPECC1(4) in the sample to be tested, determine the test results by comparing with the preset diagnostic threshold, and complete the auxiliary diagnosis in combination with the clinical characteristics of polycystic ovary syndrome.
8. A method for applying diagnostic biomarkers according to claim 7, characterized in that, The preset diagnostic thresholds are: Ct value ≤ 32.5, relative expression level of circSPECC1(4) in ovarian granulosa cell samples ≥ 2.0, and relative expression level of circSPECC1(4) in serum samples ≥ 1.5; The detection results of the method are used for clinical screening of polycystic ovary syndrome, diagnosis of suspected cases, differential diagnosis with other reproductive endocrine diseases, and dynamic monitoring of the condition of polycystic ovary syndrome patients during treatment.