A molecular marker, primers, kit, and application for identifying the spiciness of chili peppers.

By using molecular markers and KASP technology developed on chromosome 2 of chili peppers, the problems of subjectivity and high cost in chili pepper spiciness identification have been solved, enabling rapid and accurate identification of chili pepper spiciness and efficient breeding.

CN122128450APending Publication Date: 2026-06-02HUNAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HUNAN AGRI UNIV
Filing Date
2026-01-27
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Current technologies for identifying the spiciness of chili peppers rely on sensory evaluation or high-performance liquid chromatography, which suffer from problems such as high subjectivity, poor repeatability, high cost, and long time consumption, making it difficult to meet the needs of large-scale breeding and screening.

Method used

A molecular marker based on KASP technology was developed. Using the AT base deletion site at position 169761968-169761969 on chromosome 2 of the Zunla-1 reference genome, specific primers were designed for PCR amplification and fluorescence detection to rapidly and accurately identify the spiciness of chili peppers.

Benefits of technology

This technology enables rapid and accurate identification of chili pepper spiciness, significantly accelerates the breeding process of restorer line materials, provides a genetic basis for precise breeding and offspring, shortens the breeding cycle, and improves breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128450A_ABST
    Figure CN122128450A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of chili molecular breeding technology, and discloses a molecular marker, primers, kit, and application for identifying the spiciness of chili fruits. The molecular marker uses the "Zunla-1" reference genome as a reference genome, is located on chromosome 2, and its nucleotide sequence contains the wild-type sequence shown in SEQ ID NO: 1 or the mutant sequence shown in SEQ ID NO: 2. This invention also discloses primers for the molecular marker used to identify the spiciness of chili fruits, including forward primers 1 and 2 and a reverse primer. This invention utilizes the BSA mapping method to locate a novel gene controlling the spiciness of chili fruits, and based on the mutation site of this gene, develops a molecular marker associated with this capsaicin-reducing gene, and provides a method for identifying or assisting in the identification of chili spiciness. This method allows for rapid and accurate identification of the chili spiciness phenotype.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of chili molecular breeding technology, and in particular relates to a molecular marker, primer, reagent kit and application for identifying the spiciness of chili fruits. Background Technology

[0002] Chili peppers are important vegetables and seasoning crops, and their spiciness is a key trait determining their edible and commercial value. Capsaicin is the main component that produces spiciness in chili peppers, and its content directly affects the spiciness, making it the most important quality and domestication trait of chili peppers. Capsaicin is not only a secondary metabolite but is also considered to be related to plant resistance to insects, bacteria, and abiotic stresses (such as drought and high temperature). Studying its synthetic pathway helps in breeding more resistant varieties, reducing pesticide use, and achieving green production. Currently, the identification of chili pepper spiciness mainly relies on sensory evaluation or high-performance liquid chromatography (HPLC). The former is highly subjective and has poor repeatability, while the latter is costly and time-consuming, making it difficult to meet the needs of large-scale breeding screening. Molecular marker-assisted selection (MMAC) is a modern breeding method that uses DNA molecular markers closely linked to the target trait for genotypic selection, with the advantage of being unaffected by external environmental factors. KASP (Kompetitive Allele-Specific PCR) is a fluorescence-based homogenization technique developed in recent years, with advantages of high efficiency, accuracy, and low cost, and has broad application prospects in crop breeding. Therefore, identifying molecular markers related to capsaicin content and developing corresponding molecular markers (such as SNPs and Indels) can provide effective molecular tools for early screening of chili spiciness traits and breeding of high-quality varieties, enabling rapid screening and targeted breeding at the seedling stage, significantly shortening the breeding cycle, and cultivating varieties that meet diversified market demands. This is of great significance for improving the efficiency of chili breeding. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the background art above, and to provide a molecular marker, primer, kit and application for identifying the spiciness of chili peppers.

[0004] To solve the above-mentioned technical problems, the technical solution proposed by this invention is as follows:

[0005] A molecular marker for identifying the spiciness of chili peppers, using “Zunla-1” as a reference genome (http: / / peppersequence.genomics.cn / ), the molecular marker being located on chromosome 2, and its nucleotide sequence containing either the wild-type sequence shown in SEQ ID NO: 1 or the mutant sequence shown in SEQ ID NO: 2; The wild-type sequence contains the two bases "AT" at genomic positions 169761968-169761969. The mutant sequence is based on the wild-type sequence, with the two "AT" bases deleted at genomic positions 169761968-169761969.

[0006] The wild-type sequence shown in SEQ ID NO: 1: ATTATGGGGTCGAACATGCCACGGAATGAGTATTGTGATCAGAGTATGAAGGTTTTTCTTCAGACAGTCGAATCAACCGAGTCACTTCCATCCTCATCTGTAAGACCAAATTCCTACAAATCTTATTATTATTATTATTATTATTATTATTTATTTTCAAGTCGGACT GATTCTACTAGAAAATCTTAAAGTTGAATGAGTTTTGGAAAAGGCTAAAAAAGAAAAACACTACTAAGAGGAGAATTCAACAAATTGGAAAGCTTACCACAAAGCTGGATTAGTCATCGCTGACGCTACTGAACGTGTCCATTACGTGGAATTCAAATAAAATACACATGTTAT The mutant sequence shown in SEQ ID NO: 2: ATTATGGGGTCGAACATGCCACGGAATGAGTATTGTGATCAGAGTATGAAGGTTTTTCTTCAGACAGTCGAATCAACCGAGTCACTTCCATCCTCATCTGTAAGACCAAATTCCTACAAATCTTATTATTATTATTATTATTATTATT--TTATTTTCAAGTCGGACT GATTCTACTAGAAAATCTTAAAGTTGAATGAGTTTTGGAAAAGGCTAAAAAAGAAAAACACTACTAAGAGGAGAATTCAACAAATTGGAAAGCTTACCACAAAGCTGGATTAGTCATCGCTGACGCTACTGAACGTGTCCATTACGTGGAATTCAAATAAAATACACATGTTAT As a general inventive concept, the present invention also provides primers for molecular markers used to identify the spiciness of chili pepper fruits, comprising: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTATTATTATTATTATTTA-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTATTATTATTATTTATTT-3'; Reverse primer: 5'-AGTCAGAGATCAAGTTCCGAC-3'.

[0007] Preferably, the fluorescent sequence connected to the forward primer 1 is FAM, and the fluorescent sequence connected to the forward primer 2 is HEX.

[0008] As a general inventive concept, the present invention also provides a kit for identifying the spiciness of chili pepper fruits using molecular markers, comprising the primers described above.

[0009] As a general inventive concept, the present invention also provides an application of the primers or reagent kits described above, the applications including at least one of the following: (1) Identifying and assisting in screening the spiciness of chili peppers; (2) Used for identification, screening or auxiliary breeding of non-spicy mutants of chili peppers.

[0010] The above application, preferably, includes the following steps: Using the genomic DNA of the sample to be tested as a template, PCR amplification was performed using the primers described above or the kit described above; then, the amplification products were subjected to fluorescence detection, and the sample genotyping information was determined based on the fluorescence signal, and the spiciness of the chili pepper was determined.

[0011] In the above application, preferably, the PCR amplification is performed using Touchdown PCR amplification. The Touchdown PCR amplification program is as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 30 cycles.

[0012] In the above application, preferably, if FAM fluorescence corresponding to forward primer 1 is detected, the detection site contains AT bases, and the corresponding chili pepper has a spicy phenotype; if HEX fluorescence corresponding to forward primer 2 is detected, the site in the chili pepper genome to be tested lacks AT bases, and the corresponding chili pepper has a non-spicy phenotype.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) This invention utilizes the BSA mapping method to locate a new gene controlling the spiciness of chili peppers, and develops molecular markers associated with this capsaicin-reducing gene based on the mutation site of this gene. It also provides a method for identifying or assisting in the identification of chili pepper spiciness, which allows for rapid and accurate identification of the chili pepper spiciness phenotype. This invention has significant theoretical and economic value for using molecular markers to assist in the selection of chili pepper germplasm or breeding progeny materials with specific spiciness levels.

[0014] (2) The molecular marker developed in this patent for identifying the spiciness of chili peppers can significantly accelerate the breeding process of restorer line materials. Through hybridization and backcrossing, it efficiently integrates the spiciness restorer gene with other excellent trait genes, laying a genetic foundation for creating new varieties with excellent comprehensive traits. The development of this marker is not only beneficial for the precise breeding of chili peppers with different spiciness levels, but also provides a key tool for further cloning the spiciness restorer gene and analyzing the molecular regulatory network of spiciness formation in chili peppers. It has important scientific value for elucidating the molecular mechanism of capsaicin synthesis. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 This is a QTL localization analysis of the capsaicin mutant c68 gene in Example 1 of the present invention.

[0017] Figure 2 This is a sequence alignment diagram of the capsaicin mutant and the wild-type plant near the mutation site in Example 1 of the present invention, where the red box indicates the location of the "AT" base deletion. Detailed Implementation

[0018] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and preferred embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.

[0019] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of the invention.

[0020] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0021] Example 1: 1. Group building Using the backbone chili pepper parent 'S8', bred through multiple generations of self-pollination, and the non-spicy chili pepper material 'c68' (both materials are from the Hunan Agricultural University Germplasm Resource Bank and are publicly available), the non-spicy phenotype of 'c68' chili peppers is genetically stable and unaffected by environmental factors, representing a completely non-spicy type. The spicy parent 'S8' was crossed with the non-spicy parent 'c68' to obtain the F1 generation. The F1 generation was then self-pollinated to obtain the F2 population.

[0022] 2. Scores determination of chili peppers The phenotypic data of the genetic population were recorded in Table 1 through phenotypic survey and chi-square test. In the F2 population of 201 plants, 155 individuals exhibited wild-type traits, and 46 individuals exhibited the non-spicy mutant trait. The phenotypic diagram is shown below. Figure 1 As shown, the actual ratio is approximately 3:1, which is very close to the theoretical ratio for single-gene recessive inheritance. In summary, the F2 population exhibits a 3:1 segregation ratio, passes the chi-square test, and conforms to Mendelian laws of independent inheritance, indicating that... c68 The capsaicin mutant trait is a trait controlled by a single recessive nuclear gene.

[0023] Table 1: Statistical Results of Traits

[0024] 3. Preliminary localization of candidate genes controlling capsaicin synthesis Genomic DNA was extracted from both parents ('S8' and 'c68') and from the spicy pool (WT-pool) and non-spicy pool (MT-pool) constructed based on the F2 population phenotype. After library construction, high-throughput sequencing (BSA-seq) was performed. Bioinformatics analysis techniques were used to align the sequencing data to the "Zunla-1" reference genome (http: / / peppersequence.genomics.cn / ). SNP / Indel analysis was performed using tools such as Samtools. Based on the Δ(SNP-index) of the two DNA libraries, a statistically significant peak was found on chromosome 2, such as... Figure 1 As shown, the region of this peak is therefore presumed to be the region where candidate genes exist. Mutation sites within this region were selected for Kasp experiments. Table 2 shows 12 typical Kasp sites, and their distribution is illustrated in the table. Figure 1 In this study, the candidate gene for spiciness was located in the region between 150.0 and 175.5 M on chromosome 2 of the pepper plant. Figure 1 ).

[0025] Table 2: Location of Kaasp loci and number of recombinant single plants

[0026] 4. Fine localization and validation of key mutation sites Molecular markers were developed within the candidate region for fine localization. Sanger sequencing of PCR products from parents and single plants exhibiting extreme traits revealed a double-base (AT) deletion variant at the Chr02:169761968-169761969 bp position. Sequence alignment results showed (e.g.) Figure 2 The wild-type parent 'S8' has an "AT" base at this position, while the mutant parent 'c68' has an "AT" deletion at this position, resulting in the "T" bases in the sequences before and after this site being directly linked.

[0027] 5. Development and typing of KASP molecular markers Based on the aforementioned "AT" deletion site, a set of KASP genotyping primers was designed, including two forward primers and one reverse primer. The two forward primers are connected to fluorescent adapter sequences selected as FAM and HEX, respectively, as detailed below: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTATTATTATTATTATTTA-3' (SEQ ID NO: 3); Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTATTATTATTATTTATTT-3' (shown in SEQ ID NO: 4); Reverse primer: 5'-AGTCAGAGATCAAGTTCCGAC-3' (SEQ ID NO: 5).

[0028] Using genomic DNA from the parental lines and individual F2 plants as templates, KASP-PCR amplification was performed using the primers described above. Touchdown PCR was employed, and the reaction system is shown in Table 3 below.

[0029] Table 3 PCR reaction system

[0030] The PCR program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s; 57℃ for 60 s, 30 cycles.

[0031] 6. Association analysis between typing results and phenotypes After PCR, the endpoint fluorescence signal was detected, and some results are shown in Table 4.

[0032] When the FAM fluorescence signal corresponding to the fluorescent sequence linked by the forward primer 1 is detected, the detection site contains AT bases, and it is determined to be a single plant with a spicy phenotype of pepper fruit; the genotype is interpreted as wild-type allele homozygous (A:A, corresponding to the presence of "AT"). When the HEX fluorescence signal corresponding to the fluorescent sequence linked by the forward primer 2 is detected, the detection site does not contain the TA base, and it is determined to be a single plant with a non-spicy pepper fruit phenotype; the genotype is interpreted as a mutant allele homozygous (T:T, corresponding to "AT" deletion). When two fluorescent signals are detected simultaneously, the plant is identified as having the spicy phenotype of chili pepper fruit.

[0033] The molecular marker completely co-segregated with the non-spicy phenotype of chili peppers. Genotyping of 201 individual plants in the F2 population was performed using this marker, with a 100% concordance rate.

[0034] Table 4. Genotyping results of selected individuals from the parents and F2 population.

[0035] In summary, this invention successfully identified a dibase (AT) deletion molecular marker located on chromosome 2 of pepper (Chr02:169761968-169761969bp) that is completely linked to capsaicin synthesis. Based on this marker, a high-throughput and accurate genotyping KASP marker and its detection method were developed. This marker can accurately distinguish between the hot and non-hot phenotypes of peppers, providing a reliable tool for marker-assisted selection breeding.

Claims

1. A molecular marker for identifying the spiciness of chili pepper fruits, characterized in that, Using the "Zunla-1" reference genome as a reference genome, the molecular marker is located on chromosome 2, and its nucleotide sequence contains the wild-type sequence shown in SEQ ID NO: 1 or the mutant sequence shown in SEQ ID NO: 2; The wild-type sequence contains the two bases "AT" at genomic positions 169761968-169761969. The mutant sequence is based on the wild-type sequence, with the two "AT" bases deleted at genomic positions 169761968-169761969.

2. A primer for identifying the spiciness of chili pepper fruits, characterized in that, include: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTATTATTATTATTATTTA-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTATTATTATTATTTATTT-3'; Reverse primer: 5'-AGTCAGAGATCAAGTTCCGAC-3'.

3. The primer as described in claim 2, characterized in that, The forward primer 1 is connected to the fluorescent sequence FAM; the forward primer 2 is connected to the fluorescent sequence HEX.

4. A kit for identifying the spiciness of chili pepper fruits using molecular markers, characterized in that, Includes the primers as described in claim 2 or 3.

5. The application of the primer as described in claim 2 or 3 or the kit as described in claim 4, characterized in that, The application includes at least one of the following: (1) Identifying and assisting in screening the spiciness of chili peppers; (2) Used for identification, screening or auxiliary breeding of non-spicy mutants of chili peppers.

6. The application as described in claim 5, characterized in that, Includes the following steps: Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the primers described in claim 2 or 3 or the kit described in claim 4; then, the amplification products are subjected to fluorescence detection, and the sample genotyping information is determined based on the fluorescence signal, and the spiciness of the chili pepper is determined.

7. The application as described in claim 6, characterized in that, The PCR amplification was performed using Touchdown PCR. The Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 30 cycles.

8. The application as described in claim 6, characterized in that, If FAM fluorescence is detected corresponding to forward primer 1, the detection site contains AT bases, and the corresponding chili pepper has a spicy phenotype; if HEX fluorescence is detected corresponding to forward primer 2, the AT bases are missing at that site in the genome of the chili pepper being tested, and the corresponding chili pepper has a non-spicy phenotype.