A primer pair, a kit and a method for identifying sorghum and elephant grass
By designing specific primer pairs and combining them with PCR amplification and analysis methods, the problem of identifying sorghum and sorghum seeds was solved, enabling rapid and accurate seed identification and improving identification efficiency and accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUANGXI UNIV
- Filing Date
- 2026-05-07
- Publication Date
- 2026-06-09
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify sorghum and sorghum seeds, leading to mixing or misplanting, which affects ecological adaptability, regeneration characteristics and nutritional quality, causing economic losses and market reputation issues.
A primer pair, including forward and reverse primers, was designed and amplified using a PCR reaction system. The results were combined with electrophoresis detection, sequencing analysis, and melting curve analysis to distinguish between sorghum and sorghum sorghum.
It achieves highly sensitive, accurate, and easy-to-use seed identification, and can quickly distinguish between sorghum and sorghum sorghum grass in a short time, ensuring seed quality and market order.
Smart Images

Figure CN122168796A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to the identification of sorghum and sorghum seed, and more specifically, to a primer pair, kit, and identification method for identifying sorghum and sorghum. Background Technology
[0002] sorghum ( Sorghum bicolor ) and Sorghum sulphureus ( S. hybrid sudangrass Sorghum and Sudan grass are important forage crops in the Poaceae family. However, they have significant differences in growth characteristics: Sorghum is more suitable for planting in arid, barren, and slightly saline-alkali areas, especially in temperate to subtropical climates with sufficient sunlight and moderate rainfall, and has outstanding stress resistance (Ren Yaling et al., 2025); Sorghum-Sudan grass, as a hybrid of sorghum and Sudan grass, combines the advantages of both parents and has a wider range of adaptability. It is drought-tolerant, salt-alkali-tolerant, and can achieve multiple cropping in plots with good water and fertilizer conditions. It is suitable for planting in most parts of my country, especially for large-scale breeding scenarios that require high-frequency harvesting (Guo Zhenlin et al., 2025).
[0003] In practical applications, sorghum and sorghum-dandelion grass offer both economic and ecological benefits. With the large-scale development of animal husbandry and the advancement of ecological environment construction, the demand for high-quality seeds and seedlings of both continues to grow. Although they belong to the same genus *Sorghum* and are closely related, they differ significantly in their cultivation management objectives and forage utilization methods.
[0004] Mature sorghum plants are tall and robust, with significant individual plant vigor, but weak tillering and relatively poor regeneration. Their grains have high starch content and outstanding energy density. In addition to being used for silage and haymaking, some varieties can also be used for grain or sugar processing. Sorghum is drought-resistant, tolerant of poor soil, and has strong lodging resistance. It has a well-developed root system and can be used for ecological restoration and soil structure improvement in arid areas (Tang Sanyuan et al., 2019).
[0005] Sorghum plants are also tall when mature, but they have strong tillering ability and outstanding regeneration, and their annual total yield is usually higher than that of sorghum. They inherit the relatively low lignin characteristics of Sudan grass, with lignin content about 40%–60% lower than that of sorghum. They have higher content of digestible cellulose and hemicellulose, and their stems and leaves are crisp and tender with good palatability. Their crude protein content is slightly higher than that of sorghum, making them a high-quality green fodder and silage material commonly used by cattle, sheep, fish and other animals (Li Chenqiong, 2003). Sorghum has a wide range of soil adaptability and can be planted in sandy loam, slightly acidic soil and slightly saline-alkali soil. It is also drought resistant.
[0006] However, due to the similar morphology of sorghum and sorghum-sudangrass seeds, with only slight differences in grain size, color, and the degree of hull covering, they are difficult to distinguish precisely with the naked eye. This leads to mixing or misplanting during production and distribution, potentially resulting in decreased survival rates, reduced yields, and lower forage quality due to differences in ecological adaptability, regeneration characteristics, and nutritional quality, causing economic losses and impacting market reputation. Currently, identification mainly relies on morphological observation or field planting identification, which is time-consuming, labor-intensive, and susceptible to human and varietal factors, with limited accuracy. With the development of molecular technology, establishing rapid and accurate molecular identification methods is of great significance for ensuring seed quality supervision, regulating market order, promoting the application of high-quality forage, and identifying the authenticity of hybrid breeding materials.
[0007] In view of this, the present invention is proposed. Summary of the Invention
[0008] The purpose of this invention is to provide a primer pair, reagent kit, and identification method for identifying sorghum and sorghum dandelion to achieve rapid and accurate identification of sorghum and sorghum dandelion.
[0009] This invention is implemented as follows: In a first aspect, the present invention provides a primer pair for identifying sorghum and sorghum sorghum, comprising: a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO.1 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2.
[0010] Secondly, the present invention provides a PCR reaction system for identifying sorghum and sorghum sorghum, comprising the aforementioned primer pairs and reaction buffer.
[0011] Thirdly, the present invention provides a kit for identifying sorghum and sorghum sorghum, comprising the primer pairs described above or the PCR reaction system described above.
[0012] Fourthly, the present invention provides the application of primer pairs, PCR reaction systems, or kits for identifying sorghum and sorghum sapstone in the identification of sorghum and sorghum sapstone.
[0013] Fifthly, the present invention provides a method for identifying sorghum and sorghum sorghum, comprising the following steps: The genome of the sample to be tested was mixed with the primer pairs described above, and PCR amplification was performed in the PCR reaction system; sorghum and sorghum sorghum were distinguished according to at least one of the following methods: (1) The obtained PCR products are detected by electrophoresis. If the amplification product is a single band, the sample is identified as sorghum; if the amplification product is a double band, the sample is identified as sorghum. (2) Sequencing analysis of PCR products. If the sequencing results show that there are both 126bp and 99bp sequencing peaks, and the 99bp sequencing peak is missing 27bp of nucleotide sequence as shown in SEQ ID NO.6, then the sample is identified as Sorghum. If the sequencing results show that there is only 126bp sequencing peak, then the sample is identified as Sorghum. (3) Perform melting curve analysis on the PCR product. If the melting temperature Tm is 79℃, the sample is identified as sorghum. If the melting temperature Tm is 79.25℃, the sample is identified as sorghum.
[0014] The present invention has the following beneficial effects: The primer pairs designed in this invention can effectively distinguish between sorghum and sorghum-sulphur grass materials (especially sorghum and sorghum-sulphur grass seeds). The primers amplify the genomic DNA of sorghum materials, producing a single band on electrophoresis, while amplifying the genomic DNA of sorghum-sulphur grass materials produces a double band on electrophoresis, thus enabling differentiation between the two materials. The method for identifying sorghum and sorghum-sulphur grass seeds using these primers is characterized by high sensitivity, high accuracy, and high repeatability. Furthermore, the PCR primer combination of this invention for identifying sorghum and sorghum-sulphur grass seeds is time-efficient and simple to operate, allowing for identification to be completed quickly under laboratory conditions. The detection method of this invention helps laboratory personnel to rapidly identify sorghum and sorghum-sulphur grass seeds; therefore, the primer combination provided by this invention has high application value. Attached Figure Description
[0015] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0016] Figure 1This image shows a morphological comparison of sorghum and sorghum-sulphur grass at different growth stages, along with related agronomic traits and seed morphological data. In (a) to (d), the left side of the images represents sorghum, and the right side represents sorghum-sulphur grass. (a) is a comparison image of sorghum and sorghum-sulphur grass seeds; (b) is a comparison image of sorghum and sorghum-sulphur grass seedlings at 12 days old; (c) is a comparison image of sorghum and sorghum-sulphur grass phenotypes at 40 days of growth; and (d) is a comparison image of sorghum and sorghum-sulphur grass leaves at 40 days of growth. The scale bar in (a) represents 1 cm, the scale bars in (b) and (c) represent 3 cm, and the scale bar in (d) represents 2 cm. (e)-(j) are agronomic trait indicators of sorghum and sorghum-sulphur grass seedlings at 12 days of growth, including fresh weight, dry weight, dry-to-fresh ratio, plant height, stem diameter, and compressive strength. (k)-(p) are morphological indicators of sorghum and sorghum-sulphur grass seeds, including length, width, area, length-to-width ratio, thousand-grain weight, and perimeter. Sb represents sorghum, and Shs represents sorghum-sulphur grass. Figure 2 The figures show the PCR identification results of sorghum and sorghum-sulphur grass seeds in Example 4. Numbers 1-20 in the figure represent 20 individual plants of sorghum and sorghum-sulphur grass. "M" represents DNA Marker, and "H2O" represents the negative control group using ddH2O as a template. Figure a shows the electrophoresis results using the genomic DNA of 10 individual seeds of sorghum (Zhongke Tian 968) and sorghum-sulphur grass (sorghum-sulphur grass-SX19) as templates. Figure b shows the electrophoresis results using the genomic DNA of 10 individual seeds of sorghum (Zhongke Tian 968) and sorghum-sulphur grass (sorghum-sulphur grass-SX19) (numbered 11-20) as templates. Figure 3 The results of PCR identification between different sorghum and sorghum seeds in Example 5 are shown. The numbers 1-12 for sorghum represent 12 different sorghum germplasms, and the numbers 1-10 for sorghum represent 10 different sorghum germplasms. “M” represents DNA Marker, and “H2O” represents the negative control group with ddH2O as a template. Figure 4 The following are sequence alignment diagrams and partial sequencing peak diagrams of sorghum and sorghum in Example 6; (a) shows the sequence alignment diagram of sorghum and sorghum using DNAman, with shaded areas indicating identical sequences and unshaded areas indicating sequence differences caused by insertions or deletions; (b) is a partial sequencing peak diagram of sorghum and sorghum. Figure 5 For the comparison of melting curves in Example 7, the blue lines represent the melting curves of 12 sorghum germplasms, the red lines represent the melting curves of 10 sorghum germplasms, and the black lines represent the melting curves of the negative control group using ddH2O as a template. Figure 6 Electrophoresis results of primer detection for sorghum and sorghum sorghum in Comparative Example 1; Figure 7 Electrophoresis results of primer detection for sorghum and sorghum sorghum in Comparative Example 2; Figure 8 Electrophoresis results of primer detection for sorghum and sorghum sorghum in Comparative Example 3; Figure 9 Electrophoresis results of PCR amplification products of DNA from sorghum and sorghum sorghum in different mass ratios. Detailed Implementation
[0017] Reference will now be made to detailed embodiments of the present invention, one or more of which are described below. Each example is provided for explanation and not for limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the invention without departing from its scope or spirit. For example, features described or illustrated as part of one embodiment may be used in another embodiment to produce further embodiments.
[0018] In a first aspect, the present invention provides a primer pair for identifying sorghum and sorghum sorghum, comprising: a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO.1 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2.
[0019] Sorghum-F (5′-3′): CCGCCAATGCCTACATATTTC -SEQ ID NO.1; Sorghum-R (5′-3′): CAACCCTAGATATGTCCGTCCT-SEQ ID NO. 2.
[0020] The morphology of sorghum and sorghum sapstone at different stages, as follows: Figure 1 As shown, in order to quickly, accurately and efficiently distinguish sorghum and sorghum sulphureus from the seed stage, this invention screened a target region in the sorghum genome and two target regions in the sorghum sulphureus genome based on the characteristics of the gene sequences of these two plants. Based on this, a pair of primers for identifying sorghum and sorghum sulphureus seeds was designed. The sequence of the target region of sorghum is shown in SEQ ID NO.3; the sequence of the target region of sorghum sulphureus is shown in SEQ ID NO.4-5.
[0021] CCGCCAATGCCTACATATTTCCCTTTACATTTTCTTTTGAGAAATTTCTTCCCTTTTACAAAACAGCAAGATTTGGTTAAGTCTTCAGGCCCATTTGCTGTTGGAGGACGGACATATCTAGGGTTG-SEQ ID NO.3. The target region size is 126bp.
[0022] CCGCCAATGCCTACATATTTCCCTTTACATTTTCTTTTGAGAAATTTCTTCCCTTTTACAAAACAGCAAGATTTGGTTAAGTCTTCAGGCCCATTTGCTGTTGGAGGACGGACATATCTAGGGTTG-SEQ ID NO.4. The length of SEQ IDNO.4 is 126bp.
[0023] CCGCCAATGCCTACATATTTCTTCCCTTTTACAAAACAGCAAGATTTGGTTAAGTCTTCAGGCCCATTTGCTGTTGGAGGACGGACATATCTAGGGTTG-SEQ ID NO.5. The length of SEQ ID NO. 5 is 99 bp.
[0024] Secondly, the present invention provides a PCR reaction system for identifying sorghum and sorghum sorghum, comprising the aforementioned primer pairs and reaction buffer.
[0025] Reaction buffers, including but not limited to PB series, Tris series, etc. The reaction buffers contain lyophilization protectants, such as at least one of mannitol, trehalose, dextran, gelatin, hydrogenated maltose, and sucrose.
[0026] The PCR amplification reaction system can be adjusted according to the actual experimental conditions. The reaction system can be a 10 μL system, a 20 μL system, a 50 μL system, a 100 μL system, or other systems.
[0027] In one embodiment, when the reaction system is 10 μL, its specific components are: 5.0 μL PCR amplification reagent, 0.2 μL forward primer, 0.2 μL reverse primer, 1.0 μL template DNA, and 3.6 μL ddH2O; wherein the concentration of template DNA is 50 ng / μL; and the concentrations of forward and reverse primers are 10 μM.
[0028] The PCR reaction system can be in liquid, solid, or semi-solid form.
[0029] In one embodiment, when the reaction system is 50 μL, its specific components are: 25.0 μL of PCR amplification reagent, 1.0 μL of forward primer, 1.0 μL of reverse primer, 5.0 μL of template DNA, and 18.0 μL of ddH2O; wherein, the concentration of template DNA is 50 ng / μL; and the concentrations of forward and reverse primers are 10 μM.
[0030] Thirdly, the present invention provides a kit for identifying sorghum and sorghum sorghum, comprising the primer pairs described above or the PCR reaction system described above.
[0031] In a preferred embodiment of the present invention, the kit also includes Taq DNA polymerase, dNTPs, MgCl2, DNA template, and water.
[0032] The detection products (such as kits) provided by the present invention may optionally include any reagents and / or consumables acceptable in the art for PCR reactions or for preparing PCR reaction systems. Specific embodiments may include, but are not limited to, one or more of salt or salt solutions, negative controls, positive controls, blank controls, calibrators, and PCR reaction containers.
[0033] In addition to the PCR amplification reagents provided in this invention, commercially available reagents of the same type can also be used in the PCR reaction system.
[0034] Amplification must meet the following prerequisites: positive control samples should amplify the expected target band or corresponding amplification curve, and negative control samples should not show any amplification band or amplification curve.
[0035] Fourthly, the present invention provides the application of primer pairs, PCR reaction systems, or kits for identifying sorghum and sorghum sapstone in the identification of sorghum and sorghum sapstone.
[0036] Fifthly, the present invention provides a method for identifying sorghum and sorghum sorghum, comprising the following steps: The genome of the sample to be tested was mixed with the primer pairs described above, and PCR amplification was performed in the PCR reaction system; sorghum and sorghum sorghum were distinguished according to at least one of the following methods: (1) The obtained PCR products are detected by electrophoresis. If the amplification product is a single band, the sample is identified as sorghum; if the amplification product is a double band, the sample is identified as sorghum. (2) Sequencing analysis of PCR products. If the sequencing results show that there are both 126bp and 99bp sequencing peaks, and the 99bp sequencing peak is missing 27bp of nucleotide sequence as shown in SEQ ID NO.6, then the sample is identified as Sorghum. If the sequencing results show that there is only 126bp sequencing peak, then the sample is identified as Sorghum. (3) Perform melting curve analysis on the PCR product. If the melting temperature Tm is 79℃, the sample is identified as sorghum. If the melting temperature Tm is 79.25℃, the sample is identified as sorghum.
[0037] CCTTTACATTTTCTTTTGAGAAATTTC-SEQ ID NO.6.
[0038] In a preferred embodiment of the present invention, the PCR amplification reaction program is as follows: 98±0.5℃ for 2-2.5 min, 98±0.5℃ for 10±2 s, 58±0.5℃ for 30±5 s, 68±0.5℃ for 30±5 s, for 35-40 cycles, and 68±0.5℃ for 5-5.5 min.
[0039] In a preferred embodiment of the present invention, the final concentrations of both the forward and reverse primers in the reaction system are 0.2 ± 0.02 μM.
[0040] In a preferred embodiment of the present invention, the melting curve analysis procedure includes: 95℃ for 30 s; 40℃ for 30 s, with a temperature change rate of 1.5℃ / s from 95℃ to 40℃; 65℃ for 15 s, with a temperature change rate of 4.4℃ / s from 40℃ to 65℃, and a temperature change rate of 0.02℃ / s from 65℃ to 95℃, with 25 fluorescence acquisitions per degree.
[0041] High-resolution melting curve detection eliminates the need for probe setup. It combines PCR amplification with melting curve analysis, utilizing a high-resolution temperature-detecting PCR instrument and novel saturated fluorescent dyes for gene sequence analysis. The principle involves obtaining a large number of target sequences through PCR amplification, followed by a melting program. As the temperature rises, the double-stranded DNA gradually unwinds, causing the dye embedded in the DNA double strands to detach, resulting in a weakening fluorescence signal. This process continues until the double-stranded DNA is completely unwound, at which point the fluorescence signal reaches its minimum. Monitoring this process allows for DNA sequence analysis.
[0042] In real-time quantitative PCR, when double-stranded DNA is heated, the hydrogen bonds between its complementary bases gradually break, causing the double helix to separate into two single strands. This process is called DNA "melting." The temperature at which half of the total DNA double helix structure is degraded is called the melting temperature (Tm). Different DNA sequences have different GC content and distribution, resulting in different Tm values. As the temperature increases, the fluorescence intensity of the DNA changes. By monitoring this change, the resulting graph is the DNA melting curve.
[0043] In a preferred embodiment of the present invention, when using melting curve analysis to determine sample type, the PCR reaction system also includes saturated dye; In a preferred embodiment of the present invention, the saturated dye is selected from any one of SYBRGreenI, EvaGreen, SytoxGreen, EtBr, SYBRGreenII, SYBRGold, SYBRSafe, LCGreen, GelGreen, GelRed, DAPI, Syto9, SytoxBlue, SytoxRed, SytoxOrange, and ThiazoleOrange.
[0044] In a preferred embodiment of the present invention, the sample to be tested is the seed, leaf, stem, or root of the plant to be tested.
[0045] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0046] The features and performance of the present invention will be further described in detail below with reference to embodiments.
[0047] Example 1 This embodiment provides a primer pair for identifying sorghum and sorghum seeds, wherein the sequence of the forward primer is shown in SEQ ID NO.1 and the sequence of the reverse primer is shown in SEQ ID NO.2.
[0048] Sorghum-F (5′-3′): CCGCCAATGCCTACATATTTC -SEQ ID NO.1; Sorghum-R (5′-3′): CAACCCTAGATATGTCCGTCCT - SEQ ID NO. 2.
[0049] Example 2 This embodiment is a kit for identifying sorghum and sorghum seeds, the components of which include the primer pair, PCR amplification reagent and ddH2O from Example 1.
[0050] The PCR amplification reagent contains Taq DNA polymerase, dNTPs, MgCl2, reaction buffer, and other commonly used auxiliary reagents. In this example, the PCR amplification reagent is selected from commercially available premixed solution, 2×SsoRobust Green Taq PCRProMix (Guangzhou Yingzan Biotechnology Co., Ltd., product number: T111A).
[0051] Example 3 This embodiment describes a method for identifying sorghum and sorghum seeds, which utilizes the primers from Example 1 for detection. The specific steps are as follows: S1. Collect seeds and use the single-layer filter paper germination method at 25℃ for 6-8 days until the seedlings are relatively robust. Use the SDS lysis method to extract genomic DNA from the germinated seeds for later use. S2. Using the primer pair shown in SEQ ID NO.1-2, PCR detection of genomic DNA from sorghum seeds was performed: The total volume of the PCR detection system was 10 µL, which included 5.0 µL of 2×SsoRobust Green Taq PCR ProMix (Guangzhou Yingzan Biotechnology Co., Ltd., product number: T111A), 0.2 µL of primer Sorghum-F (concentration of 10 μM / L), 0.2 µL of primer Sorghum-R (concentration of 10 μM / L), 3.6 µL of ddH2O, and 1.0 µL of sorghum DNA template (50 ng / µL).
[0052] The amplification conditions were: (1) 98℃ pre-denaturation for 2 min; (2) 98℃ denaturation for 10 s; (3) 58℃ annealing for 30 s; (4) 68℃ extension for 30 s; (5) 35 cycles of steps 2-4; (6) 68℃ extension for 5 min. S3. Using the primer pair shown in SEQ ID NO.1-2, perform PCR detection of genomic DNA from Sorghum oleraceus seeds: The total volume of the PCR detection system was 10 µL, including 5.0 µL of 2×SsoRobust Green Taq PCR ProMix (Guangzhou Yingzan Biotechnology Co., Ltd., product number: T111A), 0.2 µL of primer Sorghum-F (concentration of 10 μM), 0.2 µL of primer Sorghum-R (concentration of 10 μM), 3.6 µL of ddH2O, and 1.0 µL of Sorghum DNA template (50 ng / µL). The amplification conditions were: (1) 98℃ pre-denaturation for 2 min; (2) 98℃ denaturation for 10 s; (3) 58℃ annealing for 30 s; (4) 68℃ extension for 30 s; (5) 35 cycles of steps 2-4; (6) 68℃ extension for 5 min. S4. Electrophoresis was performed on the same 3.5% agarose gel with 1 µL / 50 mL of nucleic acid dye, at a voltage of 100 V, for 45 min, followed by photographing under UV light. S5. The sorghum that amplified a single band of 126 bp was sorghum; the sorghum sorghum that amplified two bands of 126 bp and 99 bp were sorghum sorghum.
[0053] Example 4 To verify whether the primer pairs in Example 1 could distinguish between sorghum and sorghum seeds of any variety, one germplasm was selected from each of the 12 sorghum and 10 sorghum germplasms as test materials (as shown in Table 1). The single-layer filter paper germination method was used at 25℃ for 6-8 days until the seedlings were relatively robust. Genomic DNA was extracted from 15 single seedlings from each germplasm using the SDS lysis method. The DNA was diluted to 50 ng / µL and used as templates for PCR amplification using the primer pairs in Example 1.
[0054] Table 1 Information on the two test materials
[0055] The PCR amplification method was the same as in Example 3. Twenty PCR products of sorghum and sorghum were electrophoresed on the same 3.5% agarose gel. The nucleic acid dye was 1 µL / 50 mL, the electrophoresis voltage was 100 V, the gel was run for 45 min, and the gel was photographed under ultraviolet light.
[0056] Figure 2 Using genomic DNA from 20 individual seeds of sorghum (Zhongke Tian 968) and sorghum sorghum (Sorghum sorghum-SX19) as templates, the electrophoretic amplification showed two types of bands: sorghum (Zhongke Tian 968) showed a single band of 126 bp, while sorghum sorghum (Sorghum sorghum-SX19) showed two bands of 126 bp and 99 bp, respectively.
[0057] Comparative Example 1 The total volume of the PCR detection system was 10 µL, which included 5.0 µL of 2×SsoRobust Green Taq PCR ProMix (Guangzhou Yingzan Biotechnology Co., Ltd., product number: T111A), 0.2 µL of primer Sorghum-F1 (GAATGCTAACAGGTCTGATTTTC, SEQ ID NO.7) (concentration of 10 μM / L), 0.2 µL of primer Sorghum-R1 (GATGGAACCTTCTACTCATAATTG, SEQ ID NO.8) (concentration of 10 μM / L), 3.6 µL of ddH2O, and 1.0 µL of sorghum (Zhongke Tian 968) or sorghum-sweet grass (sorghum-sweet grass-SX19) DNA template (50 ng / µL).
[0058] The amplification conditions were: (1) 98℃ pre-denaturation for 2 min; (2) 98℃ denaturation for 10 s; (3) 54℃ annealing for 30 s; (4) 68℃ extension for 30 s; (5) 35 cycles of steps 2-4; (6) 68℃ extension for 5 min. PCR products of sorghum and sorghum-sulphur grass were electrophoresed on the same 3.5% agarose gel. Nucleic acid dye was applied at 1 µL / 50 mL, the electrophoresis voltage was 100 V, and the gel was run for 55 min. The gel was then photographed under UV light. Both products amplified as single bands, each 175 bp in size, making it impossible to distinguish between sorghum and sorghum-sulphur grass. Figure 6 ).
[0059] The numbers 1-5 for sorghum represent 5 different sorghum germplasms, and the numbers 1-5 for sorghum-dandelion germplasm represent 5 different sorghum-dandelion germplasms. “M” represents DNA Marker, and “H2O” represents the negative control group using ddH2O as a template.
[0060] Comparative Example 2 The total volume of the PCR detection system was 10 µL, which included 5.0 µL of 2×SsoRobust Green Taq PCR ProMix (Guangzhou Yingzan Biotechnology Co., Ltd., product number: T111A), 0.2 µL of primer Sorghum-F2 (GCATAAACTCACTCATTTGATTTCC, SEQ ID NO.9) (concentration of 10 μM / L), 0.2 µL of primer Sorghum-R2 (CGAGTCTGTTGTCATTCTACTGC, SEQ ID NO.10) (concentration of 10 μM / L), 3.6 µL of ddH2O, and 1.0 µL of sorghum (Zhongke Tian 968) or sorghum-sweet grass (sorghum-sweet grass-SX19) DNA template (50 ng / µL).
[0061] The amplification conditions were: (1) 98℃ pre-denaturation for 2 min; (2) 98℃ denaturation for 10 s; (3) 56℃ annealing for 30 s; (4) 68℃ extension for 30 s; (5) 35 cycles of steps 2-4; (6) 68℃ extension for 5 min. PCR products of sorghum and sorghum-sulphur grass were electrophoresed on the same 3.5% agarose gel. Nucleic acid dye was applied at 1 µL / 50 mL, the electrophoresis voltage was 100 V, and the gel was run for 55 min. The gel was then photographed under UV light. Both products amplified as single bands, each 185 bp in size, making it impossible to distinguish between sorghum and sorghum-sulphur grass. Figure 7 ).
[0062] The numbers 1-5 for sorghum represent 5 different sorghum germplasms, and the numbers 1-5 for sorghum-dandelion germplasm represent 5 different sorghum-dandelion germplasms. “M” represents DNA Marker, and “H2O” represents the negative control group using ddH2O as a template.
[0063] Comparative Example 3 The total volume of the PCR detection system was 10 µL, which included 5.0 µL of 2×SsoRobust Green Taq PCR ProMix (Guangzhou Yingzan Biotechnology Co., Ltd., product number: T111A), 0.2 µL of primer Sorghum-F3 (GTTCTGCCATACATAAGTACCCCC, SEQ ID NO.11) (concentration of 10 μM / L), 0.2 µL of primer Sorghum-R3 (GATTGAGATTGAGGAAAGGGAG, SEQ ID NO.12) (concentration of 10 μM / L), 3.6 µL of ddH2O, and 1.0 µL of sorghum (Zhongke Tian 968) or sorghum-sweet grass (sorghum-sweet grass-SX19) DNA template (50 ng / µL).
[0064] The amplification conditions were: (1) 98℃ pre-denaturation for 2 min; (2) 98℃ denaturation for 10 s; (3) 57℃ annealing for 30 s; (4) 68℃ extension for 30 s; (5) 35 cycles of steps 2-4; (6) 68℃ extension for 5 min. PCR products of sorghum and sorghum-sulphur grass were electrophoresed on the same 3.5% agarose gel. Nucleic acid dye was applied at 1 µL / 50 mL, the electrophoresis voltage was 100 V, and the gel was run for 40 min. The gel was then photographed under UV light. Both products amplified as single bands, each 157 bp in size, making it impossible to distinguish between sorghum and sorghum-sulphur grass. Figure 8 ).
[0065] The numbers 1-5 for sorghum represent 5 different sorghum germplasms, and the numbers 1-5 for sorghum-dandelion germplasm represent 5 different sorghum-dandelion germplasms. “M” represents DNA Marker, and “H2O” represents the negative control group using ddH2O as a template.
[0066] Example 5 To further verify whether the primer pairs in Example 1 could distinguish between sorghum and sorghum seeds of any variety, this example selected 12 types of sorghum seeds and 10 types of sorghum seeds as test materials (as shown in Tables 2 and 3). The single-layer filter paper germination method was used at 25℃ for 6-8 days until the seedlings were relatively robust. Genomic DNA was extracted from 15 individual seedlings from each germplasm sample. The DNA was diluted to 50 ng / µL and used as a template for PCR amplification using the primers from Example 1.
[0067] Table 2. Information description of the 12 sorghum seed germplasms tested
[0068] Table 3. Information description of 10 tested Sorghum sorghum seed germplasm samples
[0069] The PCR amplification method was the same as in Example 3. The PCR products of 22 sorghum and sorghum grass were electrophoresed on the same 3.5% agarose gel. The nucleic acid dye was 1 µL / 50 mL, the electrophoresis voltage was 100 V, the gel was run for 45 min, and the gel was photographed under ultraviolet light.
[0070] The results are as follows Figure 3 As shown, using genomic DNA from 12 sorghum germplasms and 10 Sorghum-Sudan grass germplasms as templates, two types of electrophoretic amplification bands were observed. The electrophoretic amplification result of sorghum was a single band with a size of 126 bp, while the electrophoretic amplification result of Sorghum-Sudan grass was a double band with sizes of 126 bp and 99 bp, respectively.
[0071] Example 6 To further verify the effectiveness of the designed primers, the amplification results of sorghum and sorghum sorghum were sequenced in this embodiment.
[0072] 1. Using 50 ng / µL genomic DNA of sorghum (Zhongke Tian 968) as a template, PCR amplification was performed using Sorghum-F and Sorghum-R primers. PCR system and method: The total volume of the PCR detection system was 50 µL, which included 25.0 µL of 2×SsoRobust Green Taq PCR ProMix (Guangzhou Yingzan Biotechnology Co., Ltd., product number: T111A), 1.0 µL of primer Sorghum-F (concentration of 10 μM), 1.0 µL of primer Sorghum-R (concentration of 10 μM), 18.0 µL of ddH2O, and 5.0 µL of DNA template (50 ng / µL).
[0073] The amplification conditions were as follows: (1) 98℃ pre-denaturation for 2 min; (2) 98℃ denaturation for 10 s; (3) 58℃ annealing for 30 s; (4) 68℃ extension for 30 s; (5) 35 cycles of steps 2-4; (6) 68℃ extension for 5 min. The above system was divided into three replicates, and the three replicates were mixed together for electrophoresis detection after amplification.
[0074] The PCR amplification products were detected by 3.5% agarose gel electrophoresis, and then the gel was cut under ultraviolet light and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.
[0075] 2. Using 50 ng / µL Sorghum-SX19 genomic DNA as a template, PCR amplification was performed using Sorghum-F and Sorghum-R primers. PCR system and method: The total volume of the PCR detection system was 50 µL, including 25.0 µL of 2×SsoRobust Green Taq PCR ProMix (Guangzhou Yingzan Biotechnology Co., Ltd., product number: T111A), 1.0 µL of primer Sorghum-F (concentration of 10 µM), 1.0 µL of primer Sorghum-R (concentration of 10 µM), 18.0 µL of ddH2O, and 5.0 µL of DNA template (50 ng / µL).
[0076] The amplification conditions were as follows: (1) 98℃ pre-denaturation for 2 min; (2) 98℃ denaturation for 10 s; (3) 58℃ annealing for 30 s; (4) 68℃ extension for 30 s; (5) 35 cycles of steps 2-4; (6) 68℃ extension for 5 min. The above system was divided into three replicates, and the three replicates were mixed together for electrophoresis detection after amplification.
[0077] The PCR amplification products were detected by 3.5% agarose gel electrophoresis, and then the gel was cut under ultraviolet light and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.
[0078] from Figure 4 As can be seen, the sequencing results are in line with expectations.
[0079] Example 7 To verify the specificity and reliability of the primer pair in Example 1, it was used for melting curve (qRT-PCR amplicon melting) analysis: DNA was extracted from each of 12 sorghum and 10 sorghum-sudangra species as template DNA for qRT-PCR. The qRT-PCR system and method are as follows: The total volume of the qRT-PCR detection system was 10 µL, which included 5 µL of 2×Realab Green PCR Fastmixture (Lambolid Biotechnology, product number: R0202-02), 0.2 µL of primer Sorghum-F (concentration of 10 μM), 3.6 µL of ddH2O, and 1 µL of DNA template (50 ng / µL).
[0080] The amplification conditions were: (1) 95℃ pre-denaturation for 30 s; (2) 95℃ denaturation for 5 s; (3) 60℃ annealing and extension for 30 s; (4) 2-3 steps cycled 40 times; (5) melting curve analysis: 95℃ for 30 s; 40℃ for 30 s, the temperature change rate from 95℃ to 40℃ was 1.5℃ / s; 65℃ for 15 s, the temperature change rate from 40℃ to 65℃ was 4.4℃ / s, the temperature change rate from 65℃ to 95℃ was 0.02℃ / s, fluorescence was collected 25 times per degree, and finally 37℃ for 30 s, with a temperature change rate of 1.5℃ / s.
[0081] The results are as follows Figure 5 As shown in the melting curves, it can be seen that 12 and 10 samples of sorghum and sorghum-sudan grass respectively can be amplified, and no other curves were generated, proving that the amplification products obtained by the primers provided in this invention have specificity and uniformity. The melting curve of sorghum-sudan grass is single-peaked rather than double-peaked, which is speculated to be because the two fragment sequences are quite similar, and the melting peak merges into one.
[0082] Experimental Example 1 This experimental example tests the resolution of trace amounts of sorghum dopant in a sorghum sample. The specific test methods and results are as follows: To verify whether the primer pair in Example 1 could identify mixed seeds, in this example, the DNA of sorghum and sorghum sorghum was mixed in mass ratios of 100:0, 90:10, 75:25, 50:50, 25:75, 10:90 and 0:100, respectively, with ddH2O as a template as a control, and PCR amplification was performed using the primer pair in Example 1.
[0083] Using the primer pairs from Example 1, PCR detection was performed on genomic DNA mixed in different proportions. The total volume of the PCR detection system was 10 µL, which included 5.0 µL of 2×SsoRobust Green Taq PCR ProMix (Guangzhou Yingzan Biotechnology Co., Ltd., product number: T111A), 0.2 µL of primer Sorghum-F (concentration of 10 μM / L), 0.2 µL of primer Sorghum-R (concentration of 10 μM / L), 3.6 µL of ddH2O, and 1.0 µL of a mixed DNA template (50 ng / µL) of sorghum (Zhongke Tian 968) and sorghum sorghum (Sorghum sorghum-SX19).
[0084] The amplification conditions were: (1) 98℃ pre-denaturation for 2 min; (2) 98℃ denaturation for 10 s; (3) 58℃ annealing for 30 s; (4) 68℃ extension for 30 s; (5) 35 cycles of steps 2-4; (6) 68℃ extension for 5 min. The PCR products were electrophoresed on the same 3.5% agarose gel, with 1 µL of nucleic acid dye per 50 mL, at a voltage of 100 V for 55 min, and photographed under UV light.
[0085] like Figure 9 The results show that in the mixed template, the concentration of genomic DNA from sorghum seeds gradually decreases from left to right, with a consistent 126 bp electrophoresis band that is slightly darker. Conversely, the concentration of genomic DNA from *Sorghum sulphureus* seeds gradually increases from left to right, with the 99 bp electrophoresis band becoming increasingly brighter. The negative control group, using ddH2O as a template, showed no amplified bands on electrophoresis. These results demonstrate that the primers provided by this invention can accurately detect *Sorghum sulphureus* mixed with sorghum. Even when sorghum and *Sorghum sulphureus* DNA are mixed in a 90:10 ratio, the detection of *Sorghum sulphureus* DNA is still achieved.
[0086] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A primer pair for identifying sorghum and sorghum sorghum, characterized in that, It includes: A forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO.1 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.
2.
2. A PCR reaction system for identifying sorghum and sorghum sorghum, characterized in that, It includes the primer pair and reaction buffer as described in claim 1.
3. A reagent kit for identifying sorghum and sorghum sorghum, characterized in that, It includes the primer pair as described in claim 1 or the PCR reaction system as described in claim 2.
4. The kit for identifying sorghum and sorghum sorghum according to claim 3, characterized in that, The kit also includes Taq DNA polymerase, dNTPs, MgCl2, DNA template, and water; Preferably, the kit further includes a positive control and a negative control.
5. The application of the primer pair as described in claim 1, the PCR reaction system as described in claim 2, or the kit for identifying sorghum and sorghum salicornia as described in claim 3 in the identification of sorghum and sorghum salicornia.
6. A method for distinguishing between sorghum and sorghum sapstone, characterized in that, It includes the following steps: The genome of the sample to be tested was mixed with the primer pair described in claim 1, and PCR amplification was performed in a PCR reaction system; sorghum and sorghum sorghum were distinguished in at least one of the following ways: (1) The obtained PCR products are detected by electrophoresis. If the amplification product is a single band, the sample is identified as sorghum; if the amplification product is a double band, the sample is identified as sorghum. (2) Sequencing analysis of PCR products. If the sequencing results show that there are both 126bp and 99bp sequencing peaks, and the 99bp sequencing peak is missing 27bp of nucleotide sequence as shown in SEQ ID NO.6, then the sample is identified as Sorghum. If the sequencing results show that there is only 126bp sequencing peak, then the sample is identified as Sorghum. (3) Perform melting curve analysis on the PCR product. If the melting temperature Tm is 79℃, the sample is identified as sorghum. If the melting temperature Tm is 79.25℃, the sample is identified as sorghum.
7. The method for identifying sorghum and sorghum sorghum according to claim 6, characterized in that, The PCR amplification reaction program is as follows: 98±0.5℃ for 2-2.5 min, 98±0.5℃ for 10±2 s, 58±0.5℃ for 30±5 s, 68±0.5℃ for 30±5 s, 35-40 cycles, 68±0.5℃ for 5-5.5 min.
8. The method for identifying sorghum and sorghum sorghum according to claim 7, characterized in that, The final concentrations of both the forward and reverse primers in the reaction system were 0.2 ± 0.02 μM.
9. The method for identifying sorghum and sorghum sorghum according to claim 6, characterized in that, The procedure for analyzing the melting curve includes: 95℃ for 30 s; 40℃ for 30 s, with a temperature change rate of 1.5℃ / s from 95℃ to 40℃; 65℃ for 15 s, with a temperature change rate of 4.4℃ / s from 40℃ to 65℃, and a temperature change rate of 0.02℃ / s from 65℃ to 95℃, with 25 fluorescence acquisitions per degree. Preferably, when using melting curve analysis to determine sample type, the PCR reaction system also includes saturated dye; Preferably, the saturated dye is selected from any one of SYBRGreenI, EvaGreen, SytoxGreen, EtBr, SYBRGreenII, SYBRGold, SYBRSafe, LCGreen, GelGreen, GelRed, DAPI, Syto9, SytoxBlue, SytoxRed, SytoxOrange, and ThiazoleOrange.
10. The method for identifying sorghum and sorghum sorghum according to claim 6, characterized in that, The sample to be tested is the seed, leaf, stem or root of the plant to be tested.