Use of load-engineered miR-124-3p exosome hydrogel in preparation of drugs for treating traumatic brain injury
By constructing an engineered miR-124-3p exosome hydrogel, the problems of poor in vivo stability and short exosome retention time of miR-124-3p were solved, achieving stable delivery and continuous release of miR-124-3p, effectively regulating the inflammatory response of traumatic brain injury and promoting the recovery of neurological function.
Patent Information
- Application Number
- CN202610469465.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-10
- Publication Date
- 2026-06-05
AI Technical Summary
In existing technologies, miR-124-3p has poor stability in vivo and is easily degraded, making it difficult to effectively deliver to the site of brain injury. Exosomes have a limited retention time in vivo, and traditional drug delivery methods cannot achieve stable and continuous local treatment. Traditional hydrogels have limited function in regulating neuroinflammation and oxidative stress.
We constructed an engineered miR-124-3p exosome hydrogel. By encapsulating miR-124-3p in exosome vesicles and combining it with the injectable hydrogel carrier QCC/OHM hydrogel, we achieved stable delivery and sustained release of miR-124-3p, thereby modulating the inflammatory response and oxidative stress in traumatic brain injury.
It improved the stability and delivery efficiency of miR-124-3p, prolonged the residence time of therapeutic factors in the damaged area, provided structural support and improved the local microenvironment, synergistically regulated the neuroinflammatory response, and promoted the recovery of neurological function.
Smart Images

Figure CN122140616A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological carrier drug delivery technology, and more specifically to carrier engineering. miR-124-3p Application of exosome hydrogels in the preparation of drugs for treating traumatic brain injury. Background Technology
[0002] Traumatic brain injury (TBI) is damage to the structure and function of brain tissue caused by external force. It is one of the most common and disabling diseases of the nervous system. TBI not only causes primary mechanical damage but also induces a series of complex secondary pathological processes after the injury, including persistent activation of neuroinflammatory responses, excessive production of reactive oxygen species (ROS), disruption of the blood-brain barrier, and neuronal apoptosis. These secondary damaging factors interact to further aggravate brain tissue damage and affect the recovery of neurological function.
[0003] Currently, clinical treatment for TBI primarily focuses on symptomatic and supportive care. This includes reducing intracranial pressure with mannitol or hypertonic saline, controlling symptoms with sedatives, analgesics, and antiepileptic drugs, and promoting neurotrophic drugs to aid in neurological recovery. However, these treatments mainly alleviate symptoms and have limited ability to intervene in key pathological processes such as secondary neuroinflammation and oxidative stress, thus overall efficacy remains limited. For patients with severe traumatic brain injury, surgical treatment, such as craniotomy for decompression or hematoma evacuation, can be used to reduce intracranial pressure and improve cerebral perfusion. However, these surgical treatments mainly relieve mechanical compression and lack direct regulatory effects on the inflammatory microenvironment and neurorepair process of the injured brain tissue, potentially leading to persistent secondary neurological damage post-surgery.
[0004] In recent years, stem cell therapy and exosome therapy have received widespread attention in the field of nervous system injury repair. Among them, mesenchymal stem cell-derived exosomes (Exos) possess good biocompatibility and low immunogenicity, and can carry various proteins, lipids, and nucleic acid molecules to participate in intercellular communication, thus being considered a promising cell-free therapeutic strategy. Furthermore, neurally-associated microRNAs (microRNAs) play an important role in regulating microglial polarization, inhibiting neuroinflammatory responses, and promoting neural repair.
[0005] However, current research still faces several technical bottlenecks. For example, free miRNAs are unstable in vivo, easily degraded by nucleases, and struggle to effectively cross the blood-brain barrier and achieve sustained accumulation in the damaged area. Exosomes have limited retention time in vivo and are easily cleared rapidly after local administration, thus affecting their therapeutic efficacy. Furthermore, in brain injury tissues, due to the presence of irregular lesion cavities and complex microenvironments, traditional drug delivery methods struggle to achieve stable and continuous local treatment.
[0006] Injectable hydrogels are widely used in tissue engineering and drug delivery due to their excellent biocompatibility, injectability, and in-situ gelation properties. Hydrogels can encapsulate bioactive factors through a three-dimensional network structure to achieve sustained release, while also providing structural support for damaged tissue. However, most hydrogel systems are currently used primarily as physical scaffolds, and their functions in regulating neuroinflammation and improving the oxidative stress microenvironment remain limited.
[0007] Therefore, how to construct a multifunctional therapeutic system that can achieve stable delivery and sustained local release of therapeutic factors, while simultaneously regulating inflammatory responses and oxidative stress, is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0008] In view of this, the present invention provides a load engineering method. miR-124-3p Application of exosome hydrogels in the preparation of drugs for treating traumatic brain injury.
[0009] The purpose of this invention is to provide a multifunctional nanodelivery system based on engineered exosomes to achieve comprehensive regulation of the local microenvironment of traumatic brain injury, thereby reducing neuroinflammatory response, lowering oxidative stress levels and promoting neurological function recovery.
[0010] Specifically, the present invention aims to solve the following technical problems:
[0011] (1) Solution miR-124-3p It suffers from poor stability in vivo, is easily degraded, and is difficult to deliver effectively to the site of brain injury.
[0012] (2) Provide a delivery platform that can effectively encapsulate exosomes and achieve sustained release, so as to prolong the residence time of therapeutic factors in the damaged area and improve bioavailability.
[0013] (3) Construct a treatment system that combines anti-inflammatory regulation to regulate the inflammatory response process after traumatic brain injury.
[0014] (4) Provide a hydrogel scaffold material with good injectability and biocompatibility, which can fill irregular brain injury cavities and provide a favorable microenvironment for nerve repair.
[0015] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: Carrier engineering miR-124-3p Application of exosome hydrogels in the preparation of drugs for treating traumatic brain injury, wherein the engineered carrier miR-124-3p Exosome hydrogels include engineered exosomes Exos miR-124 and injectable hydrogel carriers; The engineered exosomes Exos miR-124 For load miR-124-3p Exosomes.
[0016] Furthermore, the engineered exosomes Exos miR-124 By miR-124-3p After transfecting BV2 microglia with the mimicry, the cell culture supernatant was collected and purified by differential centrifugation.
[0017] Furthermore, the injectable hydrogel carrier is a QCC / OHM hydrogel formed by crosslinking quaternized carboxymethyl chitosan and oxymethacrylamide hyaluronic acid.
[0018] Furthermore, it is used for antibacterial and anti-inflammatory purposes.
[0019] Furthermore, the antibacterial activity is the inhibition of Escherichia coli and Staphylococcus aureus.
[0020] Furthermore, the anti-inflammatory effect is downregulation. iNOS , TNF-α , IL-6 and IL-1β The expression levels of pro-inflammatory genes were upregulated. Arg1 The expression.
[0021] Furthermore, it can be used to improve neuromotor function and cognitive memory, inhibit neuroinflammatory responses, reduce pathological damage to brain tissue, inhibit glial cell activation, promote microglia polarization to the M2 anti-inflammatory phenotype, promote neuronal survival, and regulate the PDE4B-mTOR / P70S6K signaling pathway.
[0022] 1. miR-124-3p Its role in neuroinflammation regulation and nerve repair miR-124-3p It is one of the most abundant neuron-specific microRNAs expressed in the central nervous system, playing a crucial role in maintaining neuronal homeostasis and regulating neuroinflammatory responses. Numerous studies have shown that... miR-124-3p It plays a key role in the phenotypic regulation of microglia, inhibiting pro-inflammatory (M1) polarization and promoting anti-inflammatory (M2) phenotypic transformation, thereby reducing inflammatory response and creating a favorable microenvironment for neural repair.
[0023] In the process of traumatic brain injury, abnormal activation of microglia is one of the important driving factors of secondary injury. Post-injury miR-124-3p Expression levels often decrease significantly, leading to uncontrolled inflammatory responses, excessive release of pro-inflammatory factors, and exacerbated neuronal damage. This can be addressed through supplementation or delivery. miR-124-3p It can effectively inhibit inflammation-related signaling pathways, reduce the expression of inflammatory factors such as TNF-α, IL-1β, and IL-6, alleviate neuronal apoptosis, and promote axonal regeneration.
[0024] However, free miRNAs exhibit poor stability in vivo, are easily degraded by nucleases, and struggle to effectively cross the blood-brain barrier and accumulate at injury sites, severely limiting their clinical application potential. Therefore, utilizing natural delivery vectors such as exosomes for... miR- 124-3p Protective and targeted delivery are key strategies for realizing its therapeutic value.
[0025] 2. The scaffolding effect of injectable hydrogels in the local treatment of brain injury In recent years, hydrogel materials have received widespread attention in the fields of tissue engineering and regenerative medicine. Injectable hydrogels have good fluidity and in-situ gelation properties, and can be injected into irregular damaged cavities through minimally invasive methods. They can rapidly form in vivo and adhere closely to surrounding tissues, making them particularly suitable for the repair of brain tissue injuries with complex structures and irregular shapes.
[0026] Hydrogels are typically composed of a three-dimensional network structure of hydrophilic polymers, possessing high water content and soft mechanical properties. Their elastic modulus can be tuned to match that of brain tissue, thereby reducing mechanical stimulation and foreign body reactions. Furthermore, hydrogels can serve as sustained-release platforms for drugs, bioactive factors, or cells. By controlling their pore structure and cross-linking mechanisms, continuous and stable local release can be achieved, significantly improving the retention time and bioavailability of therapeutic factors in the damaged area.
[0027] In the treatment of brain injury, hydrogels not only provide physical support to prevent tissue collapse, but also improve the local microenvironment, providing a scaffold basis for nerve cell migration, growth, and synaptic remodeling. Therefore, combining exosomes with injectable hydrogels holds promise for achieving synergistic therapeutic effects of structural support and functional regulation.
[0028] 3. Design concept of the invention Secondary brain injury is characterized by pathological features centered on neuroinflammatory imbalance, excessive activation of oxidative stress, and neuronal damage. Engineered exosomes, with their excellent biocompatibility and ability to cross the blood-brain barrier, provide an ideal carrier for the precise delivery of inflammatory regulatory molecules. miR-124-3pIt has clear advantages in regulating microglial phenotypic transformation and inhibiting neuroinflammation; injectable hydrogels can provide structural support for the injured site and achieve local sustained release of therapeutic factors. However, among these, miR-124-3p Although exosomes play an important role in regulating microglial cell polarization and inhibiting neuroinflammation, they are unstable in vivo as nucleic acid molecules, easily degraded by nucleases, and lack effective delivery carriers, making it difficult to achieve stable expression at the site of brain injury. Furthermore, exosomes and other bioactive factors have a short retention time in vivo, easily diffusing or being cleared, thus affecting therapeutic efficacy. In addition, irregular lesions often form in the brain tissue after TBI, making it difficult for traditional drugs or materials to achieve good local adaptation and sustained treatment. Moreover, the secondary pathological process of brain injury involves multiple stages such as inflammatory response, oxidative stress, and neuronal damage, making it difficult to achieve ideal therapeutic effects with a single treatment strategy. To address these technical challenges, this invention constructs an engineered exosome delivery system to deliver... miR-124-3p Encapsulating exosomes within vesicles enhances their stability and delivery efficiency. Furthermore, combining them with a QCC / OHM hydrogel carrier—which possesses excellent injectability, in-situ gelation capability, and sustained-release properties—achieves stable encapsulation and sustained release of exosomes at the injury site. Simultaneously, the hydrogel's tissue scaffold function effectively fills irregular injury cavities, thereby synergistically regulating neuroinflammatory responses and promoting neurological function recovery. Through this technical solution, the present invention effectively overcomes the problems of poor miRNA delivery stability, short therapeutic factor retention time, and difficulty in achieving multi-mechanism synergistic therapy in existing technologies, constructing a traumatic brain injury treatment system with targeted delivery, sustained release, and inflammatory regulation effects.
[0029] Based on this, this invention designs and constructs an engineered system focusing on the pathological features of TBI, namely inflammatory imbalance and neuronal damage. miR-124-3p A local delivery platform with exosome-loaded hydrogel as its core is used to regulate the neuroinflammatory microenvironment after TBI and promote the recovery of neurological function.
[0030] First, construct the enrichment dataset. miR-124-3p Engineered exosomes were produced. BV2 microglia were selected as exosome donor cells and seeded in culture dishes containing complete culture medium. After the cells reached a suitable confluence, Omifection-R transfection reagent was used to transfect the cells. miR-124-3p The mimic was used to transfect BV2 cells, and the cells were cultured for another 24 hours to allow the cells to mature. miR- 124-3p The exosomes are highly expressed intracellularly and secreted into the culture supernatant via exosomes. After collecting the cell culture supernatant, the exosomes are purified by differential centrifugation to obtain enriched exosomes. miR-124-3p engineered exosomes Exos miR-124The obtained exosomes were further examined using transmission electron microscopy to observe their morphology, and nanoparticle tracking analysis was used to detect their particle size distribution and concentration. Western blot was used to detect exosome marker proteins such as CD9, CD81, and HSP70. RT-qPCR was also used to detect... miR- 124-3p The expression level was determined to verify its successful enrichment.
[0031] Subsequently, an injectable hydrogel carrier was constructed. Using carboxymethyl chitosan and hyaluronic acid as base materials, carboxymethyl chitosan was first quaternized with 2,3-epoxypropyltrimethylammonium chloride to prepare quaternized carboxymethyl chitosan (QCC). Hyaluronic acid was then oxidized with sodium periodate to introduce aldehyde groups, resulting in oxidized hyaluronic acid, which was further modified with methacrylic anhydride to prepare oxidized methacryloyl hyaluronic acid (OHM). When the QCC and OHM solutions were mixed in a predetermined ratio, they formed an initial dynamic cross-linked network through a Schiff base reaction, and further formed a stable double network under photoinitiation conditions, thus obtaining a QCC / OHM hydrogel with injectability, self-healing properties, and certain mechanical strength. The resulting hydrogel was characterized by vial inversion experiments, injection experiments, rheological tests, compression experiments, swelling experiments, and degradation experiments to confirm that it possesses the physicochemical properties required for in-situ gelation, tissue adaptation, and sustained-release carrier.
[0032] Based on this, a local delivery platform for exosome-loaded hydrogels was constructed. The pre-prepared Exos... miR-124 The engineered exosomes were dispersed in OHM solution or a QCC / OHM mixed precursor solution to ensure uniform distribution within the system. Subsequently, they were mixed with QCC solution and subjected to in-situ gelation to obtain QCC / OHM@Exos. miR-124 Composite hydrogel. Exosomes are embedded and immobilized within the three-dimensional network structure of the hydrogel, preventing rapid local diffusion and allowing for sustained release at the injury site. To verify the distribution of exosomes within the hydrogel, DiI fluorescent dye was used to detect the exosomes. miR-124 The exosomes were labeled and their distribution within the hydrogel was observed using a confocal microscope. Simultaneously, the release behavior of exosomes could be detected using the BCA protein quantification method to evaluate the sustained-release performance of the composite system.
[0033] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects: This invention utilizes exosomes as a natural delivery carrier to deliver... miR-124-3pEncapsulating exosomes within vesicle structures effectively enhances the stability of miRNAs in vivo, preventing rapid degradation by nucleases and improving their delivery efficiency into nerve cells, thereby increasing the bioavailability of therapeutic molecules. By constructing a QCC / OHM hydrogel system with good injectability and in-situ gelling capabilities, engineered exosomes are embedded, forming a stable local delivery platform at the injury site. This enables sustained release and local accumulation of exosomes, prolonging the duration of action of therapeutic factors and improving therapeutic efficacy. Furthermore, this hydrogel material exhibits good tissue adaptability, allowing it to be injected into irregular brain injury cavities via minimally invasive methods to form a scaffold structure, providing a favorable microenvironment for neural repair. Based on this, this invention, through the synergistic design of engineered exosomes, miRNA therapeutic molecules, and hydrogel materials, effectively regulates the secondary inflammatory response to traumatic brain injury, inhibiting excessive activation of microglia and promoting their conversion to an anti-inflammatory phenotype, thereby reducing neuroinflammatory responses, protecting neuronal structure, and promoting the recovery of neurological function. Therefore, this invention can effectively overcome the problems of poor molecular stability, short local retention time and difficulty in achieving multi-mechanism synergistic treatment in the prior art, and provides a new technical solution for the treatment of traumatic brain injury. Attached Figure Description
[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0035] Figure 1 This is a technical roadmap for the present invention.
[0036] Figure 2 Exos and Exos in Embodiment 1 of the present invention miR-124 middle miR-124-3p Relative expression level, P <0.001 (n=3).
[0037] Figure 3 Exos and Exos in Embodiment 1 of the present invention miR-124 Transmission electron microscope image.
[0038] Figure 4 Exos and Exos in Embodiment 1 of the present invention miR-124 Nanoparticle tracking analysis.
[0039] Figure 5Exos and Exos in Embodiment 1 of the present invention miR-124 Specific protein expression.
[0040] Figure 6 For the synthesis and identification of QCC and OHM in Example 2 of this invention, where A is the FTIR spectrum of QCC and B is the FTIR spectrum of QCC. 1 H NMR spectra, C is the FTIR spectrum of OHA and OHM, and D is the FTIR spectrum of OHA and OHM. 1 H NMR spectrum.
[0041] Figure 7 The following are the characteristics of the QCC / OHM hydrogel in Example 2 of this invention, where A is the vial inversion experiment, B is the QCC / OHM injectability analysis, the letters "BJ" are the abbreviation for Beijing, C is the self-healing performance of the QCC / OHM hydrogel, and D is a representative SEM image of the lyophilized hydrogel.
[0042] Figure 8 The rheological and mechanical properties of the hydrogel in Example 2 of the present invention are shown, wherein A represents the rheological properties of the hydrogel under small-amplitude oscillatory shear conditions, B represents the rheological properties of the amplitude scanning experiment, C represents the rheological properties of the time scanning experiment, and D represents the mechanical properties.
[0043] Figure 9 A represents the swelling rate and remaining weight percentage of the hydrogel in Example 2 of this invention, where A is the swelling rate of the hydrogel and B is the remaining weight percentage of the hydrogel (n=3).
[0044] Figure 10 In Embodiment 3 of the present invention, QCC / OHM@Exos miR-124 The construction and release of, where A is DiI-Exos miR -124 Imaging in a hydrogel, where B is Exos miR-124 Release in hydrogel (n=3).
[0045] Figure 11 In Embodiment 4 of the present invention, QCC / OHM@Exos miR-124 The results of contact inhibition are shown in Figure A, which is a photograph of surviving bacterial clones on an agar plate after contact with the hydrogel, and Figure B is a quantitative analysis of bacterial activity (n=3).
[0046] Figure 12 In Embodiment 4 of the present invention, QCC / OHM@Exos miR-124 Results of live and dead bacterial staining, where A is a representative image of live and dead bacteria staining in each group, and B is a quantitative analysis of live and dead bacterial staining (n=3).
[0047] Figure 13In Embodiment 4 of the present invention, QCC / OHM@Exos miR-124 The effect on BV2 cell phenotype, where A shows the flow cytometry plots for each group, and B shows the ratio of CD86 to CD206 in each group. P <0.001 (n=3).
[0048] Figure 14 In Embodiment 4 of the present invention, QCC / OHM@Exos miR-124 Effects on the secretion of inflammatory factors by BV2 cells, where A is... iNOS As a result, B is Arg1 As a result, C is TNF-α As a result, D is IL-6 As a result, E is IL-1β result, P <0.01, P <0.001 (n=3).
[0049] Figure 15 In Example 5 of this invention, an open field experiment was conducted to examine the exploratory ability of mice. In the diagram, A represents the mouse trajectory, B represents the total distance, C represents the distance within the central region, and D represents the number of times the mouse entered the central region. P <0.05, P <0.001 (n=7).
[0050] Figure 16 This is an example of the experimental behavioral indicators and trajectory diagrams of a new object in Embodiment 5 of the present invention, where A is the trajectory diagram of the new object recognition behavior, and B is the quantitative analysis of the behavioral indicators. P <0.001 (n=7).
[0051] Figure 17 In Example 5 of this invention, the Morris water maze was used to assess the learning and memory abilities of TBI mice. In this diagram, A represents the trajectory during the spatial exploration phase, B represents the time to reach the platform during the learning phase, C represents the percentage of latency in the platform quadrant during the spatial exploration phase, and D represents the number of times the mouse traversed the platform during the spatial exploration phase. P <0.05, P <0.001 (n=7).
[0052] Figure 18 The mNSS scores of different groups after TBI in Example 5 of this invention.
[0053] Figure 19 The figures show the expression results of inflammatory factors in different groups of TBI mice in Example 5 of this invention, where A represents IL-1β, B represents IL-6, and C represents TNF-α. P <0.05, P <0.05, P <0.001 (n=7).
[0054] Figure 20 This is an H&E section of the brain tissue damage area of a TBI mouse in Example 5 of the present invention.
[0055] Figure 21 These are immunofluorescent sections of Iba-1 / GFAP in the brain tissue injury area of TBI mice in Example 5 of this invention. In these sections, A represents representative images from each group, B represents the quantitative results of Iba-1, and C represents the quantitative results of GFAP. P <0.001 (n=3).
[0056] Figure 22 These are iNOS / Arg1 immunofluorescence sections of the brain tissue injury area in TBI mice from Example 5 of this invention. In these sections, A represents representative images from each group, B represents the iNOS quantification results, and C represents the Arg1 quantification results. P <0.05, P <0.001 (n=3).
[0057] Figure 23 These are immunofluorescence sections of NeuN in the brain tissue injury area of TBI mice in Example 5 of this invention. In these sections, A represents representative images from each group, and B represents the NeuN quantification results. P <0.001 (n=3).
[0058] Figure 24This is a Western blot analysis of the PDE4B–mTOR / P70S6K pathway in the brain tissue of TBI mice in Example 5 of this invention. Detailed Implementation
[0059] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0060] Example 1 Engineering Exos miR-124 Construction and representation 1. RT-qPCR proof miR-124-3p Exosome enrichment BV2 microglia were cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin / streptomycin at 37 °C in a 5% CO2 incubator. When the cells reached 70%–80% confluence, they were transfected according to the Omifection transfection reagent instructions (Omc-02, Beijing Aomijia Pharmaceutical Technology Co., Ltd.). miR-124-3p The mimicry (Forward: TGAGGGCCCCTCTGCGTGTTCA, SEQ ID No. 13; Reverse: GGAGGCGCCTCTCTTGGCATTC, SEQ ID No. 14) was mixed with the transfection reagent and added to the cell culture medium for transfection. After 6 h of transfection, the medium was replaced with fresh complete medium, and the cells were cultured for another 24 h.
[0061] Collect the culture supernatant of transfected BV2 cells and perform sequential 300 × g Centrifuge for 10 min to remove cells, then centrifuge at 2000 × 1000 rpm. g Centrifuge for 20 min to remove cell debris, 10000 × g Centrifuge for 30 min to remove large particulate impurities, and finally centrifuge at 4 ℃ with 100,000 × 10⁻⁶ rpm. g Centrifuge for 70 min to precipitate exosomes. Discard the supernatant, resuspend the precipitate in PBS, and wash once more by ultracentrifugation to construct Exos. miR-124 Finally, the exosomes were suspended in PBS. Store at 80 ℃ for later use. Untransfected BV2 cells were used as a control by extracting ordinary exosomes using the same method; these were named Exos.
[0062] miR-124-3pThe expression level in exosomes was quantitatively analyzed using RT-qPCR. RT-qPCR results are shown below. Figure 2 As shown, compared with untransfected exosomes (Exos), Exos miR-124 middle miR-124-3p The expression level was significantly increased, approximately 4.6 times that of the control group, indicating that... miR-124-3p These substances can be effectively enriched and encapsulated into exosome vesicles. This result demonstrates that the contents of exosomes can be controllably regulated through cell transfection strategies, providing a reliable foundation for subsequent functionalized delivery.
[0063] 2. Morphological characterization of exosomes using transmission electron microscopy The morphology and structure of exosomes were observed using transmission electron microscopy (TEM), and the results are as follows: Figure 3 As shown, Exos and Exos miR-124 Both groups of exosomes exhibited typical spherical or cup-shaped vesicle structures with clear boundaries and visible complete bilayer membrane structures, with particle sizes mainly concentrated around 100 nm. No significant differences were observed in morphology and structure between the two groups of exosomes, indicating... miR-124-3p The enrichment process did not adversely affect the basic structural integrity of exosomes.
[0064] 3. Nanoparticle tracking analysis to characterize the particle size and concentration of exosomes. The particle size distribution and concentration of exosomes were further quantitatively characterized using nanoparticle tracking analysis (NTA). The results are as follows: Figure 4 As shown, Exos and Exos miR-124 The particle size distributions of both groups of exosomes were relatively concentrated, with average particle sizes of 110.7 nm and 126.2 nm, respectively. Meanwhile, the particle concentrations of both groups of exosomes remained stable at 10-1. 10 The particle / mL scale indicates miR-124-3p The transfection and enrichment process did not significantly affect the secretory capacity and yield of BV2 cell exosomes. This result further demonstrates from a quantitative perspective that engineering treatment does not interfere with the biogenesis of exosomes.
[0065] 4. Western blot analysis of characteristic proteins of exosomes Exos and Exos miR-124 Protein concentration was determined using the BCA protein quantification kit, and the concentration of each sample was standardized using lysis buffer. Equal volumes of protein were added to 5×SDS loading buffer and denatured in a 95°C metal bath for 5 min before use.
[0066] Protein samples were separated by SDS-PAGE electrophoresis, and then transferred to a PVDF membrane. After transfer, the membrane was blocked with 5% skim milk powder at room temperature for 2 h. After blocking, it was incubated with primary antibody overnight at 4 °C. The main detection indicators included CD9, CD81, HSP70, and Calnexin. The next day, the membrane was washed three times with TBST, incubated with HRP-labeled secondary antibody at room temperature for 2 h, and then washed three more times with TBST. ECL chemiluminescence reagent was used for color development, and the band signals were acquired using a gel imaging system.
[0067] Western blot analysis results are as follows: Figure 5 As shown, Exos and Exos miR-124 All exosomes expressed the characteristic exosome marker proteins CD9, CD81, and HSP70, while the cell marker protein Calnexin was not detected, further verifying that the extracted exosomes had high purity and were not contaminated with obvious intracellular membrane structural contaminants.
[0068] Example 2 Synthesis and characterization of QCC / OHM hydrogel 1. Synthesis and structural characterization of QCC and OHM Quaternized carboxymethyl chitosan (QCC) was prepared by grafting 2,3-epoxypropyltrimethylammonium chloride (GTA) onto carboxymethyl chitosan (CMCS). First, CMCS (2.000 g, 3.68 mmol) was dissolved in 100 mL of deionized water. Then, GTA (2.789 g, 18.4 mmol) was added to 30 mL of deionized water and dissolved completely. The GTA solution was then slowly added to the CMCS solution, and the mixture was stirred at 80 °C for 24 h. After the reaction was complete, the solution was dialyzed against deionized water (molecular weight cutoff 7000 Da) for 2 days, changing the water 3 times daily. The precipitate was removed by centrifugation, and the QCC was obtained by lyophilization.
[0069] Quaternary ammonium salt groups were successfully introduced into the CMCS backbone via grafting reaction of 2,3-epoxypropyltrimethylammonium chloride (GTA) with CMCS, thus preparing QCC. Fourier transform infrared spectroscopy (FITR) results showed... Figure 6 A), compared to CMCS, the QCC spectrum shows new quaternary ammonium salt characteristic absorption peaks, and the intensities of the –OH and –NH stretching vibration peaks change, indicating that GTA has been successfully grafted onto the CMCS molecular chain. (Nuclear magnetic resonance) 1 In the H NMR spectrum ( Figure 6 B) Further observation revealed a novel methyl proton signal, attributed to –N(CH3)3 in the quaternary ammonium salt structure. +The presence of functional groups confirms the success of the quaternization modification reaction of CMCS at the molecular structure level.
[0070] Oxidized hyaluronic acid (OHA) was synthesized using the sodium periodate oxidation method. Briefly, HA (1.000 g, 2.5 mmol) was placed in a beaker, and 100 mL of deionized water was added. The mixture was dissolved and stirred at room temperature. NaIO4 (0.535 g, 2.5 mmol) was weighed and dissolved in 10 mL of deionized water until fully dissolved. The NaIO4 solution was added dropwise to the HA solution, and the reaction was carried out at room temperature in the dark for 12 h. After the reaction was complete, 1 mL of ethylene glycol was added to the reaction system, and stirring was continued for 1 h to consume the remaining NaIO4. The solution was dialyzed against deionized water (molecular weight cutoff 7000 Da) for 2 days, with the water changed 3 times daily. After lyophilization, OHA was obtained.
[0071] The synthetic route for oxidized methacrylic acid (OHM) is as follows: OHA is modified by introducing double bonds through a reaction with methacrylic anhydride. In short, 1 g of OHA is dissolved in 100 mL of deionized water and stirred until completely dissolved. Then, 1 mL of methacrylic anhydride is added, and the pH of the mixture obtained during the reaction is adjusted to 8–8.5 using 1 M NaOH. The entire reaction is carried out on ice. After 12 h of reaction, the mixture is dialyzed for two days at room temperature using a dialysis membrane with a molecular weight cutoff of 3500–7000 Da, with the deionized water changed three times daily. Subsequently, lyophilization is performed to obtain OHM.
[0072] In the synthesis of OHM, hyaluronic acid is first selectively oxidized with NaIO4 to introduce aldehyde groups onto the molecular chain, yielding oxidized hyaluronic acid (OHA). FTIR spectra show (...) Figure 6 C) The presence of C=O related absorption peaks is evident. 1 In H NMR ( Figure 6 D) Characteristic signals corresponding to the aldehyde group can also be observed, indicating that the oxidation reaction proceeds smoothly. Subsequently, OHA reacts with methacrylic anhydride to introduce a methacryloyl double bond structure, yielding OHM. In the FTIR spectrum ( Figure 6 C) A characteristic absorption peak of C=C further appears. 1 In H NMR spectrum ( Figure 6 D) The detection of olefin proton-related signals in the methacryloyl group indicates that the methacrylation modification was successful.
[0073] 2. Characteristics of QCC / OHM hydrogel First, 60 mg of QCC was dissolved in 1 mL of phosphate-buffered saline (PBS) to prepare a 6% (w / v) QCC solution. Simultaneously, 40 mg of OHM was dissolved in 1 mL of 0.25% (w / v) LAP solution to prepare a 4% (w / v) OHM solution. The QCC (6%, w / t) and OHM (4%, w / t) solutions were mixed in equal volumes and irradiated with 405 nm UV light for 1 min to obtain the QCC / OHM hydrogel.
[0074] The preparation of QCC / OHA hydrogels involves replacing OHM with OHA, with the remaining operations being the same as above.
[0075] The inverted vial experiment demonstrated that the QCC / OHM hydrogel formed a gel. Figure 7 A).
[0076] The hydrogel was pre-loaded into a syringe and squeezed through a 24G needle to check its injectability and moldability. The results showed ( Figure 7 (B) When the QCC / OHM hydrogel pre-loaded in the syringe is extruded through a 24G needle, the gel is successfully extruded under shear stress and quickly recovers to a continuous and intact gel morphology after extrusion, without obvious breakage or spillage, indicating that the hydrogel has good injectability and molding ability. This characteristic enables it to be injected into irregular damaged cavities via minimally invasive methods, achieving in-situ gelation and precise filling in vivo.
[0077] The self-healing behavior of QCC / OHM hydrogels was further investigated. Two circular QCC / OHM hydrogels were prepared, one stained with methylene blue and the other left transparent. The two hydrogels were cut open and placed in contact with the cut surfaces for 30 min under no pressure. The formation of an integrated gel was observed by suspending the gel. The results showed ( Figure 7 (C) After two cut pieces of QCC / OHM hydrogel were placed in contact for 30 minutes without external force, the two parts of the gel could re-fuse into a single structure and remained stable without breaking under suspension, indicating that the hydrogel has excellent self-healing ability. This property mainly comes from the reversible reconstruction characteristics of dynamic Schiff base bonds in the system, which enables the hydrogel to spontaneously repair itself through dynamic intermolecular cross-linking after mechanical damage or shear stress, thereby maintaining the continuity and stability of the overall network structure.
[0078] At the microstructural level, 500 µL of QCC / OHA and QCC / OHM hydrogels were prepared using a 10 mm diameter mold and then freeze-dried. A thin layer of gold was deposited on the cross-section of the freeze-dried hydrogel slices, and the results were observed under a scanning electron microscope (SEM). Figure 7(D) The freeze-dried QCC / OHM hydrogel exhibits a typical three-dimensional porous network structure with uniform pore distribution and relatively consistent pore size. This porous structure provides excellent channels for material exchange within the hydrogel, facilitating the diffusion of nutrients, metabolites, and bioactive factors. It also provides ample physical space for exosome encapsulation and subsequent release. The uniform and interconnected pore structure helps exosomes distribute evenly within the hydrogel and forms stable and controllable diffusion pathways during release.
[0079] 3. Rheological and mechanical properties of QCC / OHM hydrogel The rheological properties of QCC / OHA and QCC / OHM hydrogels were measured using a stress-controlled rheometer and a parallel plate (PP50, D=50 mm, gap set to 1 mm). Dynamic frequency scanning was performed using strain values (1% strain) in the linear viscoelastic region of the hydrogels, with a frequency scanning range of 0.1–10 Hz. To determine the gel failure point of the hydrogels, amplitude-scanning strain (frequency 1 Hz) was performed, with a strain scanning range of 0.1%–100%. A 100-s time scan was performed at a fixed strain value (1% strain) and a fixed scanning frequency (1 Hz). The test temperature was 25℃.
[0080] First, the viscoelastic characteristics of the hydrogel under small-amplitude oscillatory shear conditions were investigated by dynamic frequency scanning, and the results are as follows: Figure 8 As shown in Figure A, within the frequency range of 0.1–10 Hz, the storage modulus (G') of both QCC / OHA and QCC / OHM hydrogels was consistently significantly higher than their loss modulus (G'') throughout the entire test frequency band, and the variation of both with frequency was relatively small, exhibiting typical elastic-dominant gel characteristics. This indicates that the hydrogel system formed a stable three-dimensional cross-linked network structure, maintaining good structural integrity and mechanical stability over a wide frequency range. The overall G' value of QCC / OHM further increased after photocrosslinking treatment, indicating that the introduction of the photocrosslinked network significantly enhanced the crosslinking density and elastic modulus of the gel system.
[0081] Amplitude scanning experiment results are as follows Figure 8 As shown in Figure B, as the applied strain gradually increases, the G' of the hydrogel remains relatively stable in the low strain range, then decreases significantly near the critical strain and gradually falls below G'', indicating that the gel network structure is disrupted and enters the sol state. Compared with the non-photocrosslinked group, the yield strain of QCC / OHM is significantly increased, indicating that the dual-network structure endows the hydrogel with stronger shear failure resistance and higher structural stability.
[0082] Time scan results as follows Figure 8As shown in Figure C, under constant strain (1%) and constant frequency (1 Hz), the G' and G'' of the QCC / OHM hydrogel remained essentially stable over time without significant decay, indicating good structural stability under continuous shear conditions. This property is of great significance for the material to maintain its scaffold structure and withstand localized minor mechanical disturbances in vivo over a long period of time.
[0083] Regarding macroscopic mechanical properties, the compressive strength of the hydrogels was quantitatively evaluated through uniaxial compression tests. QCC / OHM and QCC / OHA hydrogels were prepared into cylinders (15 mm in diameter × 15 mm in height) for compression testing. The mechanical properties of the hydrogels were measured using a general-purpose experimental apparatus with a load cell up to 500 N. The loading rate was 0.3 mm / min, and the load was stopped when the compressive strain reached 70%.
[0084] The results are as follows Figure 8 As shown in Figure D, both QCC / OHM and QCC / OHA hydrogels exhibited good elastic deformation capacity during compression, showing no significant structural collapse or fracture even when the strain reached 70%, demonstrating excellent compressive toughness. Compared to the single-network structure, the QCC / OHM dual-network hydrogel withstood significantly higher compressive stress and a significantly improved compressive modulus under the same strain conditions, indicating that the synergistic effect of dynamic Schiff base crosslinking and photocrosslinking networks effectively enhanced the overall mechanical strength of the hydrogel.
[0085] 4. Swelling rate and remaining weight percentage of QCC / OHM hydrogel The newly prepared hydrogels (n=3) were subjected to swelling experiments in PBS (pH=7.4) at 37℃. The initial weight of the hydrogels was recorded as W0. At different time points, the hydrogels were removed and their surface moisture was removed with filter paper; the weights of the hydrogels at these times were recorded as W. t Expansion equilibrium was reached until the weight was almost constant. All samples were analyzed three times. The swelling ratio (SR) was calculated in the equation: SR (%) = [(W) t -W0) / W0]×100%.
[0086] In the in vitro degradation experiment, the initial weight of the freshly prepared hydrogel was recorded as W0. The hydrogel was then placed in PBS at 37°C. After removing the hydrogel and wiping off the surface water with filter paper, its weight at that point was recorded as W. t All samples were analyzed in triplicate. The formula for calculating the percentage of remaining hydrogel weight is as follows: Remaining weight percentage (%) = (W t / W0)×100%.
[0087] The swelling experiment results are as follows Figure 9 As shown in Figure A, the QCC / OHM hydrogel swells rapidly in the initial stage, with the swelling rate increasing rapidly in the first few hours, then gradually stabilizing and reaching a swelling equilibrium after a certain period. Once in equilibrium, the hydrogel mass remains essentially constant, without significant further water absorption or structural disintegration. This swelling behavior indicates that the QCC / OHM hydrogel possesses good water absorption and a stable network structure. On one hand, the abundant hydrophilic groups (–OH, –COOH, –NH2) on the carboxymethyl chitosan and hyaluronic acid molecular chains provide favorable conditions for water molecule entry; on the other hand, the dynamic Schiff base crosslinking and photocrosslinking network formed between QCC and OHM effectively limits the excessive expansion of the polymer chains, thus avoiding structural loosening or rapid decline in mechanical properties caused by excessive swelling.
[0088] In the in vitro degradation experiment, the hydrogel was cultured in PBS at 37 ℃, and its residual mass change was measured periodically. The results are as follows: Figure 9 As shown in Figure B, the QCC / OHM hydrogel exhibits a slow and gradual degradation trend. With prolonged incubation, the hydrogel mass gradually decreases, but no rapid disintegration or structural collapse occurs throughout the observation period, indicating that this hydrogel system possesses good structural stability and controllable degradation characteristics.
[0089] Example 3 QCC / OHM@Exos miR-124 Construction and exosome release behavior Use PBS to extract Exos miR-124 The final concentration was diluted to 1 mg / mL, and then 60 mg of QCC was dissolved in 1 mL of 1 mg / mL Exos. miR-124 In the solution, 40 mg of OHM was dissolved in 1 mL of PBS containing 0.25% (w / v) LAP at a concentration of 1 mg / mL in Exos. miR-124 In the solution. Then, the two solutions were mixed in equal volumes to form a hydrogel, and then irradiated with 405 nm ultraviolet light for 1 min to obtain QCC / OHM@Exos miR-124 .
[0090] To visualize Exos loaded with hydrogel miR-124 Exos was labeled with the red fluorescent dye DiI. miR-124 Then the Exos marked DiI miR-124 The exosomes were loaded into a hydrogel and imaged using a confocal microscope to observe their spatial distribution within the hydrogel.
[0091] The results are as follows Figure 10 A, DiI marked ExosmiR-124 The exosomes were uniformly distributed within the hydrogel matrix, without significant aggregation or localized enrichment, indicating that the three-dimensional network structure of the hydrogel can effectively encapsulate and stably immobilize them. This uniform distribution helps maintain a relatively stable delivery throughput during release, thus avoiding problems of excessively high or low local doses.
[0092] Evaluation of Exos using the BCA kit miR-124 Release kinetics. Specifically, a product containing 1 mg Exos... miR-124 QCC / OHM@Exos miR-124 The hydrogels were incubated in PBS at 37°C for different durations (0, 1, 3, 5, 7, 10, and 14 days), with 100 µL of exosome suspension aspirated each time, followed by 100 µL of PBS. The obtained samples were then analyzed using the BCA assay.
[0093] The results are as follows Figure 10 B, Exos miR-124 From QCC / OHM@Exos miR-124 The hydrogel exhibits a continuous and slow release trend, gradually releasing exosomes over 14 days with a smooth overall release curve and no obvious burst release. This result indicates that the QCC / OHM hydrogel can serve as a stable sustained-release platform with good immobilization and controlled-release capabilities for exosomes.
[0094] Example 4 QCC / OHM@Exos miR-124 Analysis of antibacterial and anti-inflammatory properties 1. Antibacterial performance analysis With Escherichia coli ( Escherichia coli MG1655) and Staphylococcus aureus ( Staphylococcus aureus ATCC6538) was used as the type strain, representing Gram-negative and Gram-positive bacteria respectively, to support QCC / OHM@Exos miR-124 The in vitro antibacterial properties of the hydrogel were evaluated. First, two bacterial strains were inoculated into LB liquid medium and cultured at 37 °C with shaking until the logarithmic growth phase. The bacterial suspension concentration was then adjusted to an initial concentration of 1 × 10⁻⁶. 6 CFU / mL. Equal volumes of bacterial suspension and hydrogel samples from different treatment groups were incubated under sterile conditions for 24 h. The PBS treatment group served as a blank control.
[0095] After co-incubation, the bacterial suspensions from each group were serially diluted 10-fold. An appropriate amount of each dilution was evenly spread onto the surface of LB agar plates and incubated upside down overnight at 37 ℃. After incubation, the colonies formed on each plate were counted, and colony-forming units (CFUs) were calculated to reflect the inhibitory effect of different treatment groups on bacterial growth.
[0096] QCC / OHM@Exos was coated using a plate coating method. miR-124 The contact antibacterial properties of the hydrogels were quantitatively evaluated. Results showed that, compared with the PBS control group, QCC, QCC / OHM, and QCC / OHM@Exos... miR-124 All treatment groups significantly reduced E. coli and S. aureus The number of CFUs all exhibited certain antibacterial activity. Figure 11 A), while the OHM group showed no antibacterial effect. Among them, the treatment group containing QCC had the most significant antibacterial effect, with an inhibition rate of over 99% against both strains, demonstrating antibacterial properties. Figure 11 B). Notably, exosome loading did not diminish the antibacterial properties of the hydrogel, QCC / OHM@Exos miR-124 There was no significant difference in antibacterial rate between the Exos group and the QCC / OHM group, indicating that Exos... miR-124 The introduction of [the substance] will not interfere with the antibacterial function imparted by QCC.
[0097] 2. Evaluation of the antibacterial effect of hydrogel using SYTO-9 / PI live / dead staining To further evaluate the effect of hydrogels on bacterial survival, based on plate counts, SYTO-9 / PI double staining was used to observe bacterial viability. Bacteria from hydrogel samples treated with different groups were collected after co-incubation with bacterial suspension for 24 h, and the bacteria were precipitated (3000 × 10⁻⁶). g (5 min), discard the supernatant, resuspend in sterile PBS and wash to remove residual culture medium and hydrogel components.
[0098] Prepare SYTO-9 and PI working solutions according to the kit instructions, add them to the bacterial suspension, and incubate at room temperature in the dark for 15 min. After staining, add an appropriate amount of stained bacteria to a glass slide, gently cover with a coverslip, and observe and image under an inverted fluorescence microscope or confocal microscope. SYTO-9 can penetrate intact cell membranes and bind to bacterial DNA, causing surviving bacteria to show green fluorescence; while PI can only enter dead bacteria with damaged membrane integrity, causing them to show red fluorescence.
[0099] Fluorescence imaging results showed that bacteria in the PBS-treated group mainly exhibited green fluorescence, with intact bacterial membrane structure and good survival status. In contrast, bacteria treated with QCC, QCC / OHM, and QCC / OHM@Exos... miR-124 The treated bacteria showed a significant increase in red fluorescence and a marked decrease in green fluorescence, indicating that the bacterial membrane integrity was disrupted and a large number of bacteria died. Figure 12 A). Quantitative results showed that QCC, QCC / OHM, and QCC / OHM@Exos miR-124 Treatment resulted in an increase in the proportion of red fluorescence, demonstrating excellent antibacterial activity. Figure 12 B).
[0100] 3. Flow cytometry evaluation of QCC / OHM@Exos miR-124 Anti-inflammatory effects An in vitro inflammation model was constructed using lipopolysaccharide (LPS)-induced BV2 microglia to simulate the abnormal activation state of microglia after traumatic brain injury. BV2 cells were seeded in 6-well plates and, after cell adhesion and growth to 70%–80% confluence, were stimulated with complete culture medium containing a specific concentration of LPS (100 ng / mL) to induce microglia polarization towards a pro-inflammatory phenotype. A normal culture group served as a blank control, without LPS treatment.
[0101] After LPS pretreatment for a certain period of time, samples from different treatment groups (PBS, QCC / OHM hydrogel extract, Exos) were processed. miR -124 and QCC / OHM@Exos miR-124 Extracts, etc., were added to the culture system and co-incubated with BV2 cells for 24 h to evaluate the regulatory effects of each treatment on inflammatory response and microglial phenotypic transformation.
[0102] After incubation, cells from each group were collected and washed twice with pre-cooled PBS to remove residual culture medium and processing materials. Cells were then gently digested with cell digestion solution to prepare single-cell suspensions. After blocking the cells, fluorescently labeled anti-CD86 and anti-CD206 antibodies were added, and the cells were incubated at 4 °C in the dark for 30 min. After incubation, cells were washed with PBS to remove unbound antibodies, resuspended, and analyzed.
[0103] Flow cytometry results as follows Figure 13 As shown, the proportion of CD86-positive cells in the model group was significantly increased, while the proportion of CD206-positive cells was significantly decreased, suggesting that microglia are polarizing towards the M1 pro-inflammatory phenotype. (QCC / OHM@Exos) miR-124After treatment, the proportion of CD86 positivity decreased significantly, while the proportion of CD206 positivity increased significantly, suggesting a transformation of microglia from the M1 type to the M2 type anti-inflammatory phenotype. (This is in contrast to QCC / OHM or Exos.) miR-124 Compared to the treatment group alone, QCC / OHM@Exos miR-124 The group showed a more significant synergistic effect in inhibiting CD86 expression and upregulating CD206 expression.
[0104] 4. RT-qPCR validation of QCC / OHM@Exos miR-124 Anti-inflammatory molecular effects To further evaluate the regulatory effects of different treatment groups on the inflammatory response of BV2 microglia at the transcriptional level, real-time quantitative PCR (RT-qPCR) was used to detect... iNOS , Arg1 , TNF-α , IL-6 and IL-1β Expression levels of inflammation-related genes. After co-incubation for 12 h in each treatment group, BV2 cells were collected, total RNA was extracted using Trizol, and RNA concentration and purity (A260 / A280 ratio) were determined by UV spectrophotometer to ensure that RNA quality met the requirements of subsequent experiments.
[0105] An equal volume of total RNA was used for reverse transcription to convert the RNA into cDNA using a reverse transcription kit. The reaction system was prepared according to the kit instructions, and the reaction conditions were typically 42 °C for 60 min, followed by termination at 85 °C for 5 min. The resulting cDNA was used as a template for subsequent RT-qPCR amplification.
[0106] RT-qPCR reactions were performed using the SYBR Green fluorescent dye system on a real-time quantitative PCR instrument. Amplification conditions were generally set as follows: 95 °C pre-denaturation for 5 min; followed by 40 cycles of denaturation (95 °C, 10 s) and annealing / extension (60 °C, 30 s). GAPDH was used as an internal control gene, and the expression levels of each target gene were normalized. Each sample was tested in triplicate to ensure the reproducibility and reliability of the experimental results. Two replicates were used. ΔΔCt The method calculates the number of treatment groups. iNOS , Arg1 , TNF-α , IL-6 and IL-1β The relative expression levels were compared with those of the normal control group as a baseline.
[0107] Table 1. Names and sequences of RT-qPCR primers
[0108] RT-qPCR results are as follows Figure 14 As shown, compared with the LPS model group, QCC / OHM@Exos miR-124 Significantly downgraded iNOS , TNF-α , IL-6 and IL-1β The expression levels of pro-inflammatory genes were significantly upregulated. Arg1 The expression. Compared to individual QCC / OHM or Exos. miR-124 Compared to the treatment group, QCC / OHM@Exos miR-124 It exhibits a more pronounced synergistic effect in inhibiting the expression of pro-inflammatory factors and enhancing the expression of anti-inflammatory factors.
[0109] Example 5 QCC / OHM@Exos miR-124 Pharmacodynamic evaluation 1. Improve the spontaneous activity ability of TBI mice A mouse CCI model was used to establish an animal model of traumatic brain injury. Mice were weighed before the experiment and anesthetized with tribromoethanol via intraperitoneal injection at a dose of 0.02 mL / g. After complete anesthesia, the hair on the top of the head was shaved. A scalp incision was then made along the midsagittal line to expose the skull. A circular bone window with a diameter of approximately 3 mm was prepared using a trephine drill, positioned 2 mm to the left of the sagittal suture and 2 mm anterior to the coronal suture. The mice were fixed in a stereotactic device, with their heads stabilized using ear rods. A single impact was then performed on the exposed cortical area using a precision impact device. The impact parameters were set as follows: impact velocity 3 m / s, dwell time 0.2 s, and impact depth 2 mm.
[0110] Thirty-five mice were randomly divided into five groups (n=7 per group): QCC / OHM and QCC / OHM@Exos. miR-124 After TBI modeling in mice, 50 μL of QCC / OHM and QCC / OHM@Exos were injected into the cavity, respectively. miR-124 (Each dose is equivalent to 50 μg / animal), Exos miR-124 Mice were injected with 50 μg / mouse via the tail vein. miR-124 Mice in the model group were injected with 0.2 mL of PBS via the tail vein after TBI modeling. Healthy mice received no treatment.
[0111] The open field test was used to assess the spontaneous movement ability of mice in a novel environment. On day 7 after treatment, each mouse was placed individually in the central area of the open field device and allowed to move freely for 5 minutes without interference. During the experiment, the movement trajectory of the mice was recorded in real time using a video acquisition system, and the total distance, distance in the central area, and number of times the mice entered the central area were quantitatively analyzed using the accompanying analysis software to evaluate the mice's movement ability and activity status.
[0112] The results are as follows Figure 15 As shown, compared with the healthy group, the total distance traveled by mice in the TBI model group was significantly reduced, indicating that motor ability and exploratory behavior were significantly inhibited after injury. After different treatments, the motor behavior of mice in each treatment group was improved compared with the model group. Among them, QCC / OHM@Exos miR-124 The total distance traveled by the group mice was significantly increased, and the improvement was better than that of Exos. miR-124 The monotherapy group and the QCC / OHM monotherapy group showed that QCC / OHM@Exos miR-124 Hydrogels can effectively promote the recovery of motor function after TBI.
[0113] 2. QCC / OHM@Exos miR-124 Improve mouse recognition and memory function A novel object recognition experiment was used to evaluate the recognition and memory abilities of mice. The experiment consisted of three phases: adaptation, training, and testing. During the adaptation phase, mice were allowed to move freely in a test box to familiarize themselves with the environment. During the training phase, two identical objects were placed symmetrically in the box, and the mice were guided to explore freely for 10 minutes. During the testing phase, one of the objects was replaced with a new object, and the mice were placed back in the box to explore for 5 minutes. The exploration time of the mice for the new and old objects was recorded and analyzed via video. A recognition index was calculated to reflect the mice's learning, memory, and cognitive function recovery.
[0114] In the novel object recognition experiment, healthy mice showed a clear preference for exploring new objects, while mice in the TBI model group showed a significantly reduced difference in exploration time between new and old objects, and a significantly lower recognition index, suggesting impaired recognition and memory abilities after injury. After treatment, Exos... miR-124 The recognition index of mice in the group and the QCC / OHM group was improved compared with that of the model group, while the QCC / OHM@Exos group mice showed improved recognition index. miR-124 The mice in the treatment group had a significantly longer exploration time for new objects and a significantly higher recognition index than other treatment groups, indicating that it had a more significant promoting effect on the recovery of cognitive function after injury. Figure 16 ).
[0115] 3. QCC / OHM@Exos miR-124 Improve spatial learning and memory abilities The Morris water maze test was used to evaluate the spatial learning and memory abilities of mice in each group. The experimental setup consisted of a circular pool filled with opaque water at a temperature maintained at 22 ± 1 ℃. Hidden platforms were placed in a fixed quadrant. The training phase lasted for 5 consecutive days. Each day, each mouse was placed into the water facing the pool wall from the same quadrant, and its latency to find the platform and its swimming path were recorded. When a mouse failed to find the platform within a specified time, it was guided to the platform and allowed to stay there for 10 seconds. During the testing phase, the platforms were removed, and the mice were allowed to swim freely in the pool for 60 seconds. A video tracking system was used to record indicators such as the time spent in the target quadrant and the number of times the mice crossed the platform's original position to comprehensively assess their spatial memory ability.
[0116] During the Morris water maze training phase, mice in the TBI model group exhibited significantly prolonged latency in finding platforms and markedly disordered swimming paths, suggesting impaired spatial learning ability. In contrast, the latency of mice in all treatment groups showed a shortening trend, with QCC / OHM@Exos showing the most significant improvement. miR-124 The decrease was most significant in the QCC / OHM@Exos group. During the spatial memory test, after the platform was removed, the model group mice showed a significant reduction in the time spent in the target quadrant and the number of times they crossed the platform's original location, while the QCC / OHM@Exos group showed a significantly reduced decrease. miR-124 The mice in the target quadrant spent significantly more time there and crossed it more times than those in other treatment groups, suggesting that their spatial memory recovery was the best. Figure 17 ).
[0117] 4. QCC / OHM@Exos miR-124 Promote comprehensive recovery of neurological function The modified neurological deficit score (mNSS) was used to comprehensively assess the recovery of neurological function in mice. The score included multiple aspects such as motor function, sensory response, balance, and reflex function. A blinded method was used, with two researchers assessing each mouse separately and the average score being taken. Higher scores indicated more severe neurological deficits. The degree of neurological function recovery in each group of mice was analyzed by comparing the scores at different time points and across different treatment groups.
[0118] The results showed that the mNSS score of mice in the TBI model group was significantly increased, indicating significant neurological deficits after injury. After treatment, the mNSS scores of all treatment groups showed a gradual decreasing trend, with QCC / OHM@Exos showing the highest decrease. miR-124 The scores of the treatment group at all time points were significantly lower than those of the model group and other treatment groups, demonstrating a clear advantage in promoting the comprehensive recovery of neurological function. Figure 18 ).
[0119] 5. QCC / OHM@Exos miR-124 Suppressing systemic inflammatory response Mice were sacrificed at predetermined time points, and whole blood was collected via orbital sampling. After coagulation was promoted by standing at room temperature for 30 min, the blood was centrifuged at 3000 rpm for 15 min at 4°C, and the supernatant serum was collected. The levels of inflammation-related cytokines (TNF-α, IL-1β, IL-6) in mouse serum were detected using an ELISA kit.
[0120] ELISA results showed that serum levels of TNF-α, IL-1β, and IL-6 were significantly elevated in mice in the TBI model group, indicating that TBI injury induced a significant systemic inflammatory response. After treatment, the levels of inflammatory factors decreased in all treatment groups, with QCC / OHM@Exos showing the highest levels. miR-124 The levels of TNF-α, IL-1β, and IL-6 in the treatment group were significantly lower than those in the model group and other treatment groups, indicating a stronger inhibitory effect on TBI-induced inflammatory responses. Figure 19 ).
[0121] 6. QCC / OHM@Exos miR-124 Reduce brain tissue pathological damage To observe the histological changes in mouse brain tissue after TBI, hematoxylin and eosin (H&E) staining was used for analysis. Mice were sacrificed on day 14, and brain tissue was rapidly harvested. The tissue was gently rinsed with pre-cooled PBS to remove surface blood residue and fixed overnight in 4% paraformaldehyde fixative. Specific procedures can be found in the instruction manual on the official website of Wuhan Sewell Biotechnology Co., Ltd.
[0122] H&E staining results showed that the brain tissue of healthy mice had intact structure and dense cell arrangement, while the TBI model group showed disordered cortical structure in the damaged area, a significant reduction in the number of neurons, accompanied by obvious cellular vacuolation and inflammatory cell infiltration. Compared with the model group, QCC / OHM and Exos miR-124 The degree of brain tissue damage was reduced in the treatment group, while QCC / OHM@Exos miR-124 The cortical structure was more intact, the neurons were arranged more regularly, and the infiltration of inflammatory cells was significantly reduced. QCC / OHM@Exos miR-124 It has a significant effect on improving the pathological damage to brain tissue after TBI (TBI). Figure 20 ).
[0123] 7. QCC / OHM@Exos miR-124 Inhibit glial cell activation Mice were sacrificed on day 14 after drug administration, and brain tissue was collected and fixed in 4% paraformaldehyde. For detailed procedures, please refer to the instruction manual on the official website of Wuhan Sewell Biotechnology Co., Ltd.
[0124] GFAP staining results showed that astrocytes in the TBI model group mice were significantly proliferating and activated, with a marked increase in the number of GFAP-positive cells and strong fluorescence signals. Meanwhile, in QCC / OHM@Exos... miR-124 In the treatment group, GFAP signaling in astrocytes was weaker, indicating a significant inhibition of excessive astrocyte response and a reduction in their role in neuroinflammation. Iba-1 staining results showed significantly increased microglial activation in the TBI group, a substantial increase in the number of Iba-1 positive cells, and a typical pro-inflammatory morphology. Meanwhile, QCC / OHM@Exos... miR-124 The number of Iba-1 positive cells in the treatment group was significantly reduced, indicating that the treatment group could effectively inhibit the excessive activation of microglia and alleviate the local inflammatory response. Figure 21 ).
[0125] 8. QCC / OHM@Exos miR-124 Inhibit microglia polarization Mice were sacrificed on day 14 after drug administration, and brain tissue was collected and fixed in 4% paraformaldehyde. For detailed procedures, please refer to the instruction manual on the official website of Wuhan Sewell Biotechnology Co., Ltd.
[0126] iNOS staining results showed that the large number of iNOS-positive cells in the TBI model group mice indicated an enhanced pro-inflammatory response in M1 microglia. In contrast, Arg1 staining results showed that QCC / OHM@Exos miR-124 The treatment group showed a significant increase in Arg1-positive cells, indicating that the treatment promoted the polarization of M2 microglia, enhanced the anti-inflammatory response, and reduced neuroinflammation. Figure 22 ).
[0127] 9. QCC / OHM@Exos miR-124 Promote neuronal survival Mice were sacrificed on day 14 after drug administration, and brain tissue was collected and fixed in 4% paraformaldehyde. For detailed procedures, please refer to the instruction manual on the official website of Wuhan Sewell Biotechnology Co., Ltd.
[0128] NeuN staining showed that neuronal survival was significantly reduced in the TBI model group mice, and the fluorescence intensity of NeuN labeling was significantly weaker than that in the control group. In contrast, QCC / OHM@Exos miR-124 Strong NeuN fluorescence signal was observed in the brain tissue of mice in the treatment group, QCC / OHM@Exos miR-124 Treatment can effectively protect neurons and reduce neuronal damage caused by TBI. Figure 23 ).
[0129] 10. QCC / OHM@Exos miR-124 Regulation of the PDE4B–mTOR / P70S6K signaling pathway To evaluate QCC / OHM@Exos miR-124 To investigate the regulatory effects of the PDE4B–mTOR / P70S6K signaling pathway in vivo, mice were sacrificed at predetermined time points, and brain tissue was rapidly harvested. The ipsilateral cortex and surrounding area were dissected on ice, ensuring uniform sampling sites and weights. The tissues were then quickly placed in pre-chilled EP tubes, and pre-chilled RIPA lysis buffer (containing 1% protease inhibitor and 1% phosphatase inhibitor) was added for tissue homogenization. After homogenization, the tissues were incubated on ice for 30 min, gently agitated during this period to ensure complete lysis.
[0130] After pyrolysis, the homogenate sample was subjected to 12000 × 10⁻⁶ rpm at 4 °C. g Centrifuge for 15 min and collect the supernatant as the total protein extract. Protein concentration was determined using a BCA protein quantification kit, and the concentration of each sample was standardized using lysis buffer. Equal volumes of protein were added to 5×SDS loading buffer and denatured in a 95 ℃ metal bath for 5 min before use.
[0131] Protein samples were separated by SDS-PAGE electrophoresis, and then transferred to a PVDF membrane. After transfer, the membrane was blocked with 5% skim milk powder at room temperature for 2 h. After blocking, it was incubated with primary antibody overnight at 4 °C. The main detection parameters included PDE4B, mTOR, p-mTOR, P70S6K, and p-P70S6K. The next day, after thawing, the membrane was washed three times with TBST, incubated with HRP-labeled secondary antibody at room temperature for 2 h, and then washed three more times with TBST. ECL chemiluminescence reagent was used for color development, and band signals were acquired using a gel imaging system.
[0132] Western blot results are as follows Figure 24 As shown, the expression level of PDE4B in the ipsilateral cortex of the TBI model group was significantly increased, and the p-mTOR / mTOR and p-P70S6K / P70S6K ratios were significantly increased, suggesting abnormal activation of the PDE4B–mTOR / P70S6K pathway. (QCC / OHM@Exos) miR-124 After treatment, PDE4B expression was significantly downregulated, while p-mTOR and p-P70S6K levels were significantly reduced, with the improvement being greater than that observed in Exos. miR-124 The monotherapy group and the QCC / OHM group.
[0133] PDE4B is a key regulatory molecule related to inflammation; its upregulation can promote cAMP degradation and enhance pro-inflammatory signaling. miR-124-3p It has been confirmed that it can directly target PDE4B. QCC / OHM@Exos miR-124 Through continuous release miR-124-3pInhibiting PDE4B expression indirectly suppresses abnormal activation of the mTOR / P70S6K signaling pathway, ultimately alleviating neuroinflammatory responses and promoting neuroprotection.
[0134] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.
[0135] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Engineering of loads miR-124-3p The application of exosome hydrogels in the preparation of drugs for treating traumatic brain injury, characterized in that, The engineering of the load miR-124-3p Exosome hydrogels include engineered exosomes Exos miR-124 and injectable hydrogel carriers; The engineered exosomes Exos miR-124 For load miR-124-3p Exosomes.
2. The application as described in claim 1, characterized in that, The engineered exosomes Exos miR-124 By miR-124- 3p After transfecting BV2 microglia with the mimicry, the cell culture supernatant was collected and purified by differential centrifugation.
3. The application as described in claim 1, characterized in that, The injectable hydrogel carrier is a QCC / OHM hydrogel formed by crosslinking quaternized carboxymethyl chitosan and oxymethacrylamide hyaluronic acid.
4. The application as described in claim 1, characterized in that, Used for antibacterial and anti-inflammatory purposes.
5. The application as described in claim 4, characterized in that, The antibacterial effect is to inhibit Escherichia coli and Staphylococcus aureus.
6. The application as described in claim 4, characterized in that, The anti-inflammatory effect is downregulated. iNOS , TNF-α , IL-6 and IL-1β The expression levels of pro-inflammatory genes were upregulated. Arg1 The expression.
7. The application as described in claim 1, characterized in that, It is used to improve neuromotor function and cognitive memory, inhibit neuroinflammatory response, reduce pathological damage to brain tissue, inhibit glial cell activation, promote microglia polarization to the M2 anti-inflammatory phenotype, promote neuronal survival, and regulate the PDE4B-mTOR / P70S6K signaling pathway.