A primer combination for lung cancer detection and application thereof in lung cancer diagnosis
By designing specific primer and probe combinations, combined with the internal reference gene B2M and blocker sequences, accurate detection of CIZ1b RNA was achieved, solving the problem of insufficient sensitivity and specificity of existing lung cancer detection methods in early diagnosis, and realizing non-invasive and accurate early screening for lung cancer.
Patent Information
- Application Number
- CN202411756866.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-03
- Publication Date
- 2026-06-05
AI Technical Summary
Existing lung cancer detection methods lack sensitivity and specificity in early diagnosis, especially imaging examinations and traditional tumor marker detection, which have limitations and cannot effectively distinguish between early-stage lung cancer and healthy individuals.
We designed specific primer and probe combinations to detect CIZ1b RNA using real-time quantitative PCR. We then performed standardized correction using the internal reference gene B2M and used a blocker sequence to suppress interference from CIZ1a, thus achieving accurate detection of CIZ1b RNA.
It improves the specificity and sensitivity of early lung cancer diagnosis, enables non-invasive early screening, reduces patient harm, and enhances the accuracy and repeatability of detection, showing promising clinical application prospects.
Smart Images

Figure CN122146879A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular biology and medical diagnostics, and in particular to a primer combination for detecting lung cancer and its application in the diagnosis of lung cancer. Background Technology
[0002] Lung cancer is one of the most common and deadliest malignant tumors worldwide, with a five-year survival rate of only 10-20%. The high mortality rate of lung cancer is mainly attributed to the lack of obvious clinical symptoms and effective screening methods in its early stages, leading to most patients being diagnosed at an advanced stage. Existing lung cancer screening methods, such as low-dose spiral CT (LDCT), can detect some lung cancer cases at an early stage, but their high false-positive rate and radiation risks limit their widespread application. Therefore, developing high-performance tumor markers for the early screening and diagnosis of lung cancer is of significant clinical importance.
[0003] CIZ1 protein (CDKN1A-interacting zinc finger protein 1) is a nuclear protein involved in DNA replication and cell cycle regulation. Its different splice variants exhibit varying expression patterns in various diseases, particularly cancer. Studies have shown that the CIZ1b splice variant is significantly upregulated in lung cancer, while the CIZ1a variant is primarily expressed in normal tissues. This characteristic makes CIZ1b a promising biomarker for lung cancer detection. A study on CIZ1b protein demonstrated that when used as a biomarker for lung cancer detection, it exhibits high sensitivity and specificity in distinguishing early-stage lung cancer patients from healthy individuals (Proceedings of the National Academy of Sciences, 2012, 109(45):E3128-E3135). In this study, by detecting serum CIZ1b protein levels, researchers were able to identify stage I non-small cell lung cancer patients with 95% sensitivity and 74% specificity.
[0004] This invention aims to provide a highly efficient lung cancer diagnostic method based on CIZ1b RNA detection. By optimizing the detection technology and method, its feasibility and reliability in clinical applications are improved to meet the clinical diagnostic needs of lung cancer. Summary of the Invention
[0005] This invention relates to a method for detecting specific CIZ1b RNA molecular markers for lung cancer detection, specifically a technique for early lung cancer diagnosis that uses real-time quantitative PCR (RT-qPCR) to detect CIZ1b RNA and standardizes the detection results using an internal reference gene. Based on the difference in specific expression levels of CIZ1b RNA in lung cancer tissue and blood samples, this invention develops a sensitive and highly specific diagnostic method that can effectively distinguish between lung cancer patients, healthy individuals, and patients with benign lung lesions, providing a simple and non-invasive detection method for early lung cancer screening.
[0006] On one hand, the present invention provides a primer and probe combination for detecting lung cancer, including a primer and probe combination for specifically amplifying the CIZ1b sequence. The forward primer includes one or more nucleotide sequences selected from Seq ID NO.1 to Seq ID NO.5 or their complete complementary sequences, the reverse primer includes one or more nucleotide sequences selected from Seq ID NO.6 to Seq ID NO.10 or their complete complementary sequences, and the probe sequence is shown in Seq ID NO.11.
[0007] Existing lung cancer detection methods, such as imaging examinations and traditional tumor marker tests, while aiding in diagnosis to some extent, often suffer from insufficient sensitivity and specificity, particularly in the early detection of lung cancer. Therefore, identifying new molecular markers to improve the accuracy of early lung cancer diagnosis is of great significance. Studies have shown that different splice variants of the CIZ1 gene exhibit differential expression in lung cancer tissues, especially the CIZ1b splice variant, which is significantly upregulated in lung cancer patients. Therefore, this invention designs highly specific primers and probes for the detection of CIZ1b RNA. A set of primers specifically amplifying the CIZ1b sequence without amplifying the CIZ1a sequence was designed for the different subtypes of the CIZ1 gene, CIZ1a and CIZ1b. Through primer screening and optimization, the specificity and sensitivity of the detection are ensured.
[0008] Furthermore, the primer combination is selected from any one or more groups shown in Table 1:
[0009] Table 1 Primer Combinations
[0010]
[0011] Furthermore, the primer-probe combination is selected from the two primer-probe combinations shown in the table below:
[0012] Table 2. Two sets of primer-probe combinations
[0013]
[0014] Furthermore, the primer and probe combination also includes an internal reference gene B2M, which has a nucleotide sequence as shown in Seq ID NO. 14.
[0015] Furthermore, by comparing the A and B splice variant sequences of the CIZ1 gene, specific primers and probes capable of distinguishing between CIZ1b and CIZ1a were designed. Based on the sequence comparison results of CIZ1a and CIZ1b, CIZ1b lacks 24 bases in its nucleotide sequence compared to CIZ1a, resulting in a lack of 8 amino acids after transcription and translation. Therefore, this invention designs primers and probes targeting a portion of the CIZ1b sequence (AAGAAGAGGAAGAGGATGATGAGGATGAAGAAGAGATCGAGGTGAGGTCCAGAGATATATCCAGAGAGGAGTGGAAGG) to accurately amplify CIZ1b without amplifying CIZ1a. The probe (TCGAGGTGAGGTCCAGA) is located at the differential site on CIZ1b after the 24-base deficiency compared to CIZ1a, and the primers are located at both ends near this differential site. Although the probe is designed to specifically bind to the amplified CIZ1b sequence at differentially located positions, the high sequence similarity between CIZ1a and CIZ1b means that some primers are not specific enough. This results in the amplification of a large amount of CIZ1a along with CIZ1b, leading to non-specific binding of the probe to CIZ1a and the simultaneous detection of both CIZ1a and CIZ1b. Furthermore, the degeneracy in the primer design further affects its specificity. Therefore, we conducted a rigorous screening and optimization process for the primers to ensure accurate amplification and detection of only the CIZ1b sequence, effectively avoiding interference from CIZ1a. This invention demonstrates through screening that only the products amplified using primer sets F4+R1 and F5+R4, when bound to the probe, will only detect CIZ1b and not CIZ1a, ensuring both specificity and sensitivity.
[0016] In some methods, plasmids bearing CIZ1a and CIZ1b sequences are synthesized separately and used as templates, wherein the CIZ1a sequence is shown in Seq ID NO.12 and the CIZ1b sequence is shown in Seq ID NO.13.
[0017] In some embodiments, the vectors include, but are not limited to, pBR322 plasmid, pUC19 and pUC series vectors, T vectors and shuttle vectors.
[0018] In some methods, to further improve detection specificity, this invention designs an internal reference gene B2M as a correction gene. Simultaneous detection of the internal reference gene and the CIZ1b gene can effectively correct for variations between samples, improving the accuracy of quantitative analysis.
[0019] In some embodiments, the internal reference gene B2M has a nucleotide sequence as shown in Seq ID NO.14, its forward primer has a sequence as shown in Seq ID NO.15, its reverse primer has a sequence as shown in Seq ID NO.16, and its probe has a sequence as shown in Seq ID NO.17.
[0020] Furthermore, the primer-probe combination also includes a blocker sequence having a nucleotide sequence or its complete complement as shown in any one or more of SeqID NO.18 or Seq ID NO.19.
[0021] In some methods, to improve the detection specificity of CIZ1b, this invention designs a blocker sequence. After screening different blocker sequences, they are combined with primers, and finally the optimal primer and probe combination is selected. This set of primers can sensitively detect CIZ1b RNA at low concentrations without amplifying high concentrations of CIZ1a.
[0022] On the other hand, the present invention provides a kit for detecting lung cancer, comprising the primer and probe combination as described above.
[0023] In another aspect, the present invention provides a biomarker combination for detecting lung cancer, comprising a primer combination, a probe combination, and a blocker sequence. The primer combination comprises a primer and probe combination for specifically amplifying the CIZ1b sequence. The forward primer comprises a nucleotide sequence selected from any one or more of Seq ID NO.1 to Seq ID NO.5 or its complete complementary sequence. The reverse primer comprises a nucleotide sequence selected from any one or more of Seq ID NO.6 to Seq ID NO.10 or its complete complementary sequence. The probe sequence is shown in Seq ID NO.11. The blocker sequence has a nucleotide sequence selected from any one or more of Seq ID NO.18 to Seq ID NO.19 or its complete complementary sequence.
[0024] In another aspect, the present invention provides a biomarker combination for detecting lung cancer, comprising two primer and probe combinations selected from those shown in Table 2.
[0025] In another aspect, the present invention provides a method for detecting lung cancer, which involves designing and synthesizing a primer and probe combination that specifically amplifies the CIZ1b sequence, and detecting the CIZ1b splice RNA by specifically amplifying it; the forward primer includes one or more nucleotide sequences selected from Seq ID NO.1 to Seq ID NO.5 or their complete complementary sequences, the reverse primer includes one or more nucleotide sequences selected from Seq ID NO.6 to Seq ID NO.10 or their complete complementary sequences, and the probe sequence is shown in Seq ID NO.11.
[0026] Furthermore, the method uses a blocker sequence to block the non-specific amplification of CIZ1a during the amplification of CIZ1b RNA. The blocker sequence has one or more nucleotide sequences as shown in Seq ID NO.18 to Seq ID NO.19 or their complete complementary sequences.
[0027] The method for in vitro detection of lung cancer using primers provided by this invention includes the following steps:
[0028] (1) Use a kit to extract total RNA from tissue or plasma samples;
[0029] (2) The extracted RNA was reverse transcribed to generate cDNA;
[0030] (3) Detection by fluorescence quantitative PCR using specific primers and probes.
[0031] This invention validates the feasibility of CIZ1b RNA as a molecular marker for lung cancer through the detection of clinical samples. First, RNA was extracted from 10 pairs of lung cancer and benign lung tissue samples, and the expression of CIZ1b RNA in the tissue samples was further detected by reverse transcription PCR. The results showed that the expression level of CIZ1b RNA in lung cancer tissue was significantly higher than that in benign lung tissue. Then, this invention further validated the detection performance in blood samples. By detecting plasma samples from lung cancer patients, patients with benign lung lesions, and healthy individuals, it was found that CIZ1b RNA in the plasma of lung cancer patients was significantly higher than that in the control group, and the AUC value of the ROC curve after internal reference gene correction was as high as 0.950, indicating that the detection method has good lung cancer discrimination ability.
[0032] In another aspect, the present invention provides the use of a biomarker for preparing reagents for detecting lung cancer, characterized in that the biomarker comprises a primer and probe combination for specifically amplifying the CIZ1b sequence, the forward primer comprising any one or more nucleotide sequences selected from Seq ID NO.1 to Seq ID NO.5 or their completely complementary sequences, the reverse primer comprising any one or more nucleotide sequences selected from Seq ID NO.6 to Seq ID NO.10 or their completely complementary sequences, and the probe sequence as shown in Seq ID NO.11.
[0033] Compared with existing methods for detecting lung cancer biomarkers, this invention has the following technical advantages:
[0034] (1) High specificity and sensitivity: Through the design of specific primers and probes, combined with blocker sequences, interference from CIZ1a is effectively suppressed, ensuring accurate detection of CIZ1b RNA;
[0035] (2) Non-invasive detection: Detection using CIZ1b RNA in plasma enables non-invasive early screening of lung cancer, reducing harm to patients;
[0036] (3) Standardization system: By introducing the internal reference gene B2M, the detection results can be standardized and corrected, which further improves the accuracy and repeatability of the detection.
[0037] (4) Strong clinical feasibility: This invention has been validated by clinical samples and can sensitively detect CIZ1b RNA in tissue and plasma samples, showing good clinical application prospects; Attached Figure Description
[0038] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of the present invention and should not be considered as a limitation of the scope. For those skilled in the art, other related drawings can be obtained from these drawings without creative effort.
[0039] Figure 1 This invention employs primer combination F4+R1 and sets an internal reference gene to detect ΔCt in lung cancer and benign lung tissue samples. (CIZ1b-B2M) Box plot;
[0040] Figure 2 This invention employs primer combination F5+R4 and sets an internal control gene to detect ΔCt in lung cancer and benign lung tissue samples. (CIZ1b-B2M) Box plot;
[0041] Figure 3This invention employs primer combination F4+R1 and sets an internal reference gene to bind to a blocker sequence to detect ΔCt in lung cancer and benign lung tissue samples. (CIZ1b+blocker-B2M) Box plot;
[0042] Figure 4 This invention employs primer combination F5+R4 and sets an internal reference gene to bind blocker sequence to detect ΔCt in lung cancer and benign lung tissue samples. (CIZ1b+blocker-B2M) Box plot;
[0043] Figure 5 This invention employs primer combination F4+R1 and sets an internal control gene to detect ΔCt in blood samples from lung cancer and benign lung cancer. (CIZ1b-B2M) Box plot;
[0044] Figure 6 This invention employs primer combination F5+R4 and sets an internal control gene to detect ΔCt in blood samples from lung cancer and benign lung cancer. (CIZ1b-B2M) Box plot;
[0045] Figure 7 This invention employs primer combination F4+R1 and sets an internal reference gene to bind to a blocker sequence to detect ΔCt in blood samples from lung cancer and benign lung cancer. (CIZ1b+blocker-B2M) Box plot;
[0046] Figure 8 This invention employs primer combination F5+R4 and sets an internal reference gene to bind to a blocker sequence to detect ΔCt in blood samples from lung cancer and benign lung cancer. (CIZ1b+blocker-B2M) Box plot;
[0047] Figure 9 This invention utilizes Ct CIZ1b Plot the ROC curve using the values;
[0048] Figure 10 This invention utilizes ΔCt (CIZ1b+blocker-B2M) Plot the ROC curve. Figure 11 This is a schematic diagram of the PCR reaction system and procedure of the present invention. Detailed Implementation
[0049] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. It should be noted that the embodiments described below are intended to facilitate understanding of the present invention and are not intended to limit it in any way. The reagents used in this embodiment are all known products and were obtained by purchasing commercially available products.
[0050] Example 1: Screening of CIZ1b-specific primers
[0051] In this embodiment, 10 primers were designed for different subtypes of CIZ1a and CIZ1b. Different primer combinations were used to screen for primer pairs that could only amplify the CIZ1b subtype but not the CIZ1a subtype. The specific screening process is as follows:
[0052] I. Primer Design
[0053] As shown in the sequences of CIZ1a and CIZ1b, the sequence difference between the different subtypes of the CIZ1 gene, CIZ1a and CIZ1b, is that CIZ1b has a nucleotide sequence deletion of 24 bases compared to CIZ1a. Therefore, this invention targets the sequence difference between CIZ1a and CIZ1b. Based on a partial sequence of CIZ1b (AAGAAGAGGAAGAGGATGATGAGGATGAAGAAGAGATCGAGGTGAGGTCCAGAGATATATCCAGAGAGGAGTGGAAGG), primers and probes were designed using Primer 5.0 software. The amplification primer sequences are shown in Seq ID NO.1 to Seq ID NO.10 of the sequence listing, and the probe sequences are shown in Seq ID NO.11 of the sequence listing.
[0054] However, since CIZ1a and CIZ1b have largely identical sequences, some of the designed primers have poor specificity and will detect both CIZ1a and CIZ1b simultaneously. In addition, the degeneracy of primers can also lead to poor primer specificity. Therefore, primers need to be screened and optimized to distinguish between CIZ1a and CIZ1b sequences in the PCR reaction, ensuring that only the CIZ1b sequence is amplified and detected, thus avoiding interference from CIZ1a.
[0055] II. Primer Screening
[0056] First, plasmids containing CIZ1a and CIZ1b sequences were synthesized by Beijing Qingke Biotechnology Co., Ltd., and used as templates. The CIZ1a sequence is shown in Seq ID NO.12, and the CIZ1b sequence is shown in Seq ID NO.13.
[0057] To evaluate the sensitivity and specificity of each primer combination, plasmid A containing 1,000,000 copies / μl CIZ1a and plasmid B containing 100 copies / μl CIZ1b were used as PCR templates to screen the primer combinations. The PCR reaction system and procedure are as follows: Figure 11 As shown.
[0059] The following are the Ct values for each primer combination when detecting CIZ1a and CIZ1b:
[0060] Table 3. Ct values of CIZ1a and CIZ1b detected by different primer combinations.
[0061]
[0062]
[0063] This invention designs probes (TCGAGGTGAGGTCCAGA) and primers based on the differential sequence of CIZ1b (AAGAAGAGGAAGAGGATGATGAGGATGAAGAAGAGATCGAGGTGAGGTCCAGAG ATATATCCAGAGAGGAGTGGAAGG). The probes are located at the differential sites on CIZ1b that are 24 bases shorter than those on CIZ1a, and the primers are located at both ends near the differential sites. Although the probes are designed to specifically bind to the amplified CIZ1b sequence at the differential sites, due to the high sequence similarity between CIZ1a and CIZ1b, the specificity of some primers is not ideal. This results in the amplification of a large amount of CIZ1a while amplifying CIZ1b, leading to non-specific binding of the probes to CIZ1a and the simultaneous detection of both CIZ1a and CIZ1b. Furthermore, the degeneracy in the primer design further affects its specificity. Therefore, we have conducted a rigorous screening and optimization process for the primers to ensure accurate amplification and detection of only the CIZ1b sequence, thereby effectively avoiding interference from CIZ1a. As shown in Table 3, only primer combinations F4+R1 and F5+R4, after amplification, effectively detected the CIZ1b sequence under low concentration conditions when combined with the probe, while preventing the detection of CIZ1a in high concentrations of CIZ1a template. These combinations demonstrated good sensitivity and specificity, making them suitable for further CIZ1b detection applications. The advantage of this detection method lies in its improved specificity for CIZ1b detection, ensuring detection only of the CIZ1b sequence and avoiding interference from the CIZ1a sequence.
[0064] Example 2: Filtering of blocker sequences
[0065] I. Design of blocker sequences
[0066] To further improve the detection specificity of CIZ1b and further block the non-specific binding of wild-type CIZ1a, this invention designs different blocker sequences combined with different primer combinations and probes for comparison, and screens out the blocker sequence with the best detection performance. The nucleotide sequence of Blocker1 (B1) designed in this invention is shown in Seq ID NO.18, and the nucleotide sequence of Blocker2 (B2) is shown in Seq ID NO.19.
[0067] II. Blocker Sequence Filtering
[0068] To evaluate the sensitivity and specificity of each primer and probe combination after binding to the blocker sequence, plasmid A containing 10,000,000 copies / μl CIZ1a and plasmid B containing 100 copies / μl CIZ1b were used as PCR templates to screen each primer combination.
[0069] Table 4. Ct values of CIZ1a and CIZ1b detected by different blockers.
[0070] Primer combination blocker CIZ1a CIZ1b F4+R1 No addition 37.59 33.10 F4+R1 B1 40.32 32.87 F4+R1 B2 Not detected 32.96 F5+R4 No addition 36.55 34.22 F5+R4 B1 38.19 33.92 F5+R4 B2 Not detected 33.75
[0071] According to the screening results (Table 4), wild-type CIZ1a could still be detected at 10,000,000 copies / μl without or with the addition of the B1 blocker; however, the addition of the B2 blocker effectively reduced non-specific amplification of CIZ1a while maintaining good sensitivity for CIZ1b detection. Therefore, the Blocker2 sequence is preferred.
[0072] Example 3: Detection of Clinical Tissue Samples
[0073] This embodiment uses the two primer combinations screened in Example 1 and the blocker sequence screened in Example 2 to detect the expression of CIZ1b RNA from clinical tissue samples, and employs two methods for detection: 1. Detection using two primer combinations; 2. Detection using two primer combinations combined with the blocker sequence.
[0074] I. The method for detecting lung cancer using a two-primer combination includes the following steps:
[0075] (1) RNA extraction from clinical tissue samples:
[0076] Ten clinical lung cancer postoperative tissue samples and ten benign lung tissue samples were selected. RNA was extracted from these samples using the QR210 Total RNA Extraction Kit for Cells / Tissues / Plasma / Serium produced by Aorui Biotechnology. The steps are as follows:
[0077] 1. Animal tissues were homogenized using a homogenizer. 1 ml of lysis buffer RLS was added for every 20-50 mg of tissue, and the mixture was vortexed and allowed to stand at room temperature for 10 min.
[0078] 2. Add 200 μL of chloroform, vortex to mix, let stand at room temperature for 5 minutes, and centrifuge at 12000g for 15 minutes.
[0079] 3. After centrifugation, the sample separated into three layers: a lower purple-red organic phase, a white middle layer, and an upper colorless aqueous phase. RNA was located in the aqueous phase. Transfer the upper aqueous phase to a new centrifuge tube, add an equal volume of 70% ethanol, vortex to mix, and let stand at room temperature for 10 minutes.
[0080] 4. Transfer the liquid in the centrifuge tube to the adsorption column R201, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column R201 back into the collection tube.
[0081] 5. Add 600 μL of RWB buffer to the adsorption column, centrifuge at 12000 rpm for 30-60 s, and discard the eluent.
[0082] 6. Add 500 μL of washing solution RWA to the adsorption column, centrifuge at 12000 rpm for 30-60 s, and discard the effluent.
[0083] 7. Repeat step 6, then centrifuge at 12000 rpm for 2 min and discard the effluent.
[0084] 8. Allow the adsorption column to air dry completely for 2-3 minutes to prevent residual cleaning solution from affecting subsequent experiments.
[0085] 9. Add 30-60 μL of RNase-Free ddH2O to the adsorption column, centrifuge at 12000 rpm for 2 min, and collect the RNA.
[0086] (2) Construction of the reverse transcription PCR system:
[0087] To further standardize the reverse transcription PCR system, an internal reference gene was designed for control. The primer and probe design sequences of the internal reference gene are shown in the sequence listing Seq ID NO.15-Seq ID NO.17.
[0088] Using Vazyme's reverse transcription PCR enzyme system ( Amplification was performed using the III U+One Step qRT-PCR ProbeKit (Q225), with the specific reaction system as follows:
[0089] Table 5 Reverse Transcription PCR System 1
[0090] reaction system Volume (ul) CIZ1b-F(10uM) 0.5 CIZ1b-R(10uM) 0.5 CIZ1b-P1(10uM) 0.5 B2M-F(10uM) 0.5 B2M-R (10µM) 0.5 B2M-P(10uM) 0.5 5×One Step U+Mix 6 One Step U+Enzyme Mix 1.5 RNA extracted from tissue 10 <![CDATA[RNase-free ddH2O]]> 9.5 total 30
[0091] The RT-PCR reaction procedure is as follows:
[0092] Table 6 Reverse Transcription PCR Procedure
[0093]
[0094] (3) Detection of CIZ1b RNA in tissue samples:
[0095] Based on the reverse transcription system constructed above, two primer combinations were used to detect 10 pairs of lung cancer and benign lung samples, respectively, to evaluate the detection capability of the CIZ1b RNA detection system for tumor tissues. The results are shown below:
[0096] Table 7. Detection of CIZ1b RNA expression in tissue samples using two primer combinations.
[0097]
[0098] Note: C represents lung cancer tissue, and N represents benign lung tissue.
[0099] ΔCt was detected in lung cancer and benign lung tissue using primer combinations F4+R1 and F5+R4, respectively. (CIZ1b-B2M) Box plot as shown Figure 1 and Figure 2 As shown, the p-values for the U-test were 0.0185 and 0.0011, respectively. The above results indicate that using the above two primer combinations, CIZ1b RNA showed good differential expression and discrimination between lung cancer and benign lung tissues.
[0100] II. Detection using two primer combinations combined with blocker sequence
[0101] This embodiment also employs two primer combinations to detect lung cancer. The method for extracting RNA from clinical tissue samples and the reverse transcription PCR procedure are the same as those for detecting lung cancer using the two primer combinations. The reverse transcription PCR system is shown in the table below:
[0102] Table 8 Reverse Transcription PCR System 2
[0103] reaction system Volume (ul) CIZ1b-F(10uM) 0.5 CIZ1b-R(10uM) 0.5 CIZ1b-P1(10uM) 0.5 CIZ1b-Blocker (50uM) 1 B2M-F(10uM) 0.5 B2M-R (10µM) 0.5 B2M-P(10uM) 0.5 5×One Step U+Mix 6 One Step U+Enzyme Mix 1.5 RNA extracted from tissue 10 <![CDATA[RNase-free ddH2O]]> 8.5 total 30
[0104] Two primer combinations, combined with blocker sequences, were used to detect 10 pairs of lung cancer and benign lung samples, respectively. The results are shown below:
[0105] Table 9. Detection of CIZ1b RNA expression in tissue samples using two primer combinations combined with blocker sequences.
[0106]
[0107]
[0108] Note: C represents lung cancer tissue, and N represents benign lung tissue.
[0109] Two primer combinations combined with blocker sequences were used to detect ΔCt in lung cancer and benign lung tissues. (CIZ1b+blocker-B2M) Box plot as shown Figure 3 and Figure 4 As shown, the p-values for the U-test were 0.0015 and 0.0011, respectively. The above results indicate that using the above two primer combinations in combination with the blocker sequence for detection, CIZ1b RNA has good differential expression and discrimination between lung cancer and benign lung tissues.
[0110] Example 4: Detection of Clinical Blood Samples
[0111] This embodiment uses clinical blood samples to detect CIZ1b RNA expression. Two methods were employed: 1) using two primer combinations; 2) using a combination of two primers with a blocker sequence.
[0112] I. Detection using two primer combinations
[0113] The method for extracting RNA from clinical blood samples and the construction of the reverse transcription PCR system were the same as in Example 3. The performance of the CIZ1b RNA detection system in blood samples was evaluated using plasma samples from lung cancer patients, benign lung cancer patients, and healthy individuals. The detection results are as follows:
[0114] Table 10. Detection of CIZ1b RNA expression in blood samples using two primer combinations.
[0115]
[0116]
[0117]
[0118] Note: C represents blood from lung cancer patients, N represents blood from benign lung cancer patients, and H represents blood from healthy individuals.
[0119] ΔCt in blood samples from lung cancer patients, benign lung cancer patients, and healthy individuals was detected using primer combinations F4+R1 and F5+R4, respectively. (CIZ1b-B2M) Box plot as shown Figure 5 and Figure 6 As shown, ΔCt in the hematologic groups of lung cancer and benign lung cancer (CIZ1b-B2M) The p-values for the t-test of the mean were 1.48 × 10⁻⁶. 5 and 1.91×10- 5 ΔCt in blood samples from lung cancer patients and healthy individuals (CIZ1b-B2M) The p-values for the t-test of the mean were 4.37 × 10⁻⁶. 14 and 1.85×10- 7 The above results indicate that CIZ1b RNA has good differential expression and discrimination between lung cancer and benign lung cancer, as well as between lung cancer and healthy individuals.
[0120] II. Detection using two primer combinations combined with blocker sequence
[0121] The method for extracting RNA from clinical blood samples and the construction of the reverse transcription PCR system were the same as in Example 2. The performance of the CIZ1b RNA detection system in blood samples was evaluated using plasma samples from lung cancer patients, benign lung cancer patients, and healthy individuals. The detection results are as follows:
[0122] Table 11. Detection of CIZ1b RNA expression in tissue samples using two primer combinations combined with blocker sequences.
[0123]
[0124]
[0125]
[0126] Note: C represents blood from lung cancer patients, N represents blood from benign lung cancer patients, and H represents blood from healthy individuals.
[0127] ΔCt values in blood samples from lung cancer patients, benign lung cancer patients, and healthy individuals, using primer combinations F4+R1 and F5+R4, and detected by blocker sequences, respectively. (CIZ1b+blocker-B2M) Box wires, such as Figure 7 and Figure 8 As shown, ΔCt in the hematologic groups of lung cancer and benign lung cancer (CIZ1b-B2M) The p-values for the U-test of the mean were 6.18 × 10⁻⁶. 7 and 1.70×10- 5 ΔCt in blood samples from lung cancer patients and healthy individuals (CIZ1b-B2M) The p-values for the t-test of the mean were 9.72 × 10⁻⁶. 10 and 1.62×10- 7 The above results indicate that CIZ1b RNA has good differential expression and discrimination between lung cancer and benign lung cancer, as well as between lung cancer and healthy individuals.
[0128] Example 5: Diagnosis of lung cancer by detecting CIZ1b RNA expression in clinical blood samples.
[0129] We use Ct CIZ1b The value and its corresponding ΔCt value (Ct) CIZ1b -Ct B2M ), and Ct CIZ1b+blocker The value and its corresponding ΔCt value (Ct) CIZ1b+blocker -Ct B2M ), and the Receiver Operating Characteristic Curve (ROC) was plotted, as follows: Figure 9 and Figure 10As shown in Table 12, these curves were plotted to evaluate the diagnostic performance of detecting CIZ1b RNA expression in lung cancer. In this evaluation, lung cancer patients were used as the disease group, while patients with benign lung lesions and healthy individuals served as the control group. Furthermore, we conducted an in-depth analysis of the diagnostic performance of different primer combinations and their combination with internal reference genes and blocker sequences; the specific results are shown in Table 12.
[0130] Table 12 Comparison of the diagnostic performance of different combined models for lung cancer
[0131]
[0132] Validating the above findings, by using endogenous reference B2M RNA as a normalizing factor to precisely calibrate CIZ1b expression levels, we found a significantly enhanced difference in CIZ1b RNA expression between lung cancer patients and the control group. This difference demonstrated extremely high efficacy in distinguishing lung cancer from the normal control group. Furthermore, using a blocker sequence to further block the non-specific binding of wild-type CIZ1a further improved the detection performance of the primer pair for CIZ1b. Specifically, using the F4+R1 primer combination with the blocker sequence, and after correction using the internal reference gene B2M, the AUC value reached 0.950, with a sensitivity of 95.0%, a specificity of 90.0%, and a Youden index of 0.850, showing better performance compared to other combinations. This fully demonstrates that this method, as a blood test, has excellent effectiveness and accuracy in lung cancer diagnosis and is a highly promising diagnostic technology. The F4+R1 primer and probe combination with the blocker sequence is preferred for lung cancer detection.
[0133] While the present invention has been disclosed above, it is not limited thereto. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the invention; therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.
[0134] sequence list
[0135] Seq ID NO.1:
[0136] CIZ-F1: AAGAGGATGATGAGGATGAAGA
[0137] Seq ID NO.2:
[0138] CIZ-F2: GGAAGAGGATGATGAGGATGA
[0139] Seq ID NO.3:
[0140] CIZ-F3:AGAGGAAGAGGATGATGAGGAT
[0141] Seq ID NO.4:
[0142] CIZ-F4:AAGAAGAGGAAGAGGATGATGA
[0143] Seq ID NO.5:
[0144] CIZ-F5:GGTTGCTTCGAGGGTGA
[0145] Seq ID NO.6:
[0146] CIZ-R1:CCTTCCACTCCTCTCTGGATAT
[0147] Seq ID NO.7:
[0148] CIZ-R2:GCCCTTCCACTCCTCTCT
[0149] Seq ID NO.8:
[0150] CIZ-R3:CTCCGAGCCCTTCCACT
[0151] Seq ID NO.9:
[0152] CIZ-R4:GTATTGGGGCTGTAGGTCT
[0153] Seq ID NO.10:
[0154] CIZ-R5:ATGCAGTATTGGGGCTGTA
[0155] Seq ID NO.11:
[0156] CIZ-P1:TCGAGGTGAGGTCCAGA
[0157] Seq ID NO.12:
[0158] CIZ1a:
[0159] TTGTGGAGCACGTGAAGTCCCAGGGGCATAAGGACAAAGCCAAGGAGCTGAAGTCG
[0160] CTTGAGAAAGAAATTGCTGGCCAAGATGAGGACCACTTCATTACAGTGGACGCTGTG
[0161] GGTTGCTTCGAGGGTGATGAAGAAGAGGAAGAGGATGATGAGGATGAAGAAGAGAT
[0162] CGAGGTTGAGGAGGAACTCTGCAAGCAGGTGAGGTCCAGAGATATATCCAGAGAGG
[0163] AGTGGAAGGGCTCGGAGACCTACAGCCCCAATACTGCATATGGTGTGGACTTCCTGG
[0164] TGCCCGTGATGGGCTATATCTGCCGCATCTGCCACAAGTTCTATCACAGCAACTCAGG
[0165] GGCACAGCTCTCCCACTGCAAGTCCCTGG
[0166] Seq ID NO.13:
[0167] CIZ1b:
[0168] TTGTGGAGCACGTGAAGTCCCAGGGGCATAAGGACAAAGCCAAGGAGCTGAAGTCG
[0169] CTTGAGAAAGAAATTGCTGGCCAAGATGAGGACCACTTCATTACAGTGGACGCTGTG
[0170] GGTTGCTTCGAGGGTGATGAAGAAGAGGAAGAGGATGATGAGGATGAAGAAGAGAT
[0171] CGAGGTGAGGTCCAGAGATATATCCAGAGAGGAGTGGAAGGGCTCGGAGACCTACA
[0172] GCCCCAATACTGCATATGGTGTGGACTTCCTGGTGCCCGTGATGGGCTATATCTGCCGC
[0173] ATCTGCCACAAGTTCTATCACAGCAACTCAGGGGCACAGCTCTCCCACTGCAAGTCC
[0174] CTGG
[0175] Seq ID NO.14:
[0176] B2M:
[0177] ATTCCTGAAGCTGACAGCATTCGGGCCGAGATGTCTCGCTCCGTGGCCTTAGCTGTGC
[0178] TCGCGCTACTCTCTCTTTCTGGCCTGGAGGCTATCCAGcgTACTCCAAAGATTCAGGTT
[0179] TACTCACGTCATCCAGCAGAGAATGGAAAGTCAAATTTCCTGAATTGCTATGTGTCTG
[0180] GGTTTCATCCATCCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAA
[0181] AAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTSeq IDNO.15:
[0182] B2M-F:CGCGCTACTCTCTCTTTCTG
[0183] Seq ID NO.16:
[0184] B2M-R:CTCTGCTGGATGACGTGAG
[0185] Seq ID NO.17:
[0186] B2M-P:AGCGTACTCCAAAGATTCAGG
[0187] Seq ID NO.18:
[0188] Blocker1 sequence:
[0189] 5’-ATCGAGGTTGAGGAGGAACTCTGCAAGCAGGTGAGGTCCAG-PHO-3’
[0190] Seq ID NO.19:
[0191] Blocker2 sequence:
[0192] 5’-TCGAGGTTGAGGAGGAACTCTGCAAGCAGGTGAGGTC-PHO-3’
Claims
1. A primer and probe combination for detecting lung cancer, characterized in that, The primer and probe combination specifically amplifies the CIZ1b sequence. The forward primer includes any one or more nucleotide sequences or their complete complements selected from Seq ID NO.1 to Seq ID NO.
5. The reverse primer includes any one or more nucleotide sequences or their complete complements selected from Seq ID NO.6 to Seq ID NO.
10. The probe sequence is shown in Seq ID NO.
11.
2. The primer and probe combination as described in claim 1, characterized in that, The primer and probe combination is selected from the two sets of primer and probe combinations shown in the table below:
3. The primer and probe combination as described in claim 2, characterized in that, It also includes the internal reference gene B2M, which has a nucleotide sequence as shown in Seq ID NO.
14.
4. The primer and probe combination as described in claim 4, characterized in that, It also includes a blocker sequence having one or more nucleotide sequences as shown in Seq ID NO.18 to Seq ID NO.19 or their complete complement.
5. A reagent kit for detecting lung cancer, characterized in that, Includes the primer and probe combination as described in any one of claims 1-4.
6. A biomarker combination for detecting lung cancer, characterized in that, The device includes primers, probe combinations, and a blocker sequence. The primers and probe combinations include primers and probe combinations specifically amplifying the CIZ1b sequence. The forward primers include nucleotide sequences selected from any one or more of Seq ID NO.1 to Seq ID NO.5, or their complete complementary sequences. The reverse primers include nucleotide sequences selected from any one or more of Seq ID NO.6 to Seq ID NO.10, or their complete complementary sequences. The probe sequence is shown in Seq ID NO.
11. The blocker sequence has nucleotide sequences selected from any one or more of Seq ID NO.18 or Seq ID NO.19, or their complete complementary sequences.
7. A biomarker combination for detecting lung cancer, characterized in that, This includes two primer and probe combinations selected from the table below:
8. A method for detecting lung cancer, characterized in that, The primer and probe combination specifically amplifies the CIZ1b sequence and is designed and synthesized. Detection is performed by specifically amplifying the RNA of the CIZ1b splice. The forward primer includes one or more nucleotide sequences selected from Seq ID NO.1 to Seq ID NO.5 or their complete complementary sequences, the reverse primer includes one or more nucleotide sequences selected from Seq ID NO.6 to Seq ID NO.10 or their complete complementary sequences, and the probe sequence is shown in Seq ID NO.
11.
9. The method as described in claim 8, characterized in that, During the amplification of CIZ1b RNA, a blocker sequence is used to block the non-specific amplification of CIZ1a. The blocker sequence has any one or more nucleotide sequences as shown in Seq ID NO.18 to Seq ID NO.19 or their complete complementary sequences.
10. The use of a biomarker in the preparation of a reagent for detecting lung cancer, characterized in that, The markers include primer and probe combinations for specifically amplifying the CIZ1b sequence. The forward primers include one or more nucleotide sequences selected from Seq ID NO.1 to Seq ID NO.5 or their complete complementary sequences. The reverse primers include one or more nucleotide sequences selected from Seq ID NO.6 to Seq ID NO.10 or their complete complementary sequences. The probe sequences are shown in Seq ID NO.11.