A myelin-imitating three-dimensional peg-modified tetrahedral framework nucleic acid and application thereof to achieving long circulation and rapid kidney clearance

By periodically introducing PEG units on each edge of the DNA tetrahedral framework to form a three-dimensional PEG network structure, the contradiction between long circulation and rapid renal clearance of PEGylated nucleic acid delivery carriers is resolved. This enables long circulation and rapid clearance of nanoparticles in the blood, reduces enzyme degradation and protein adsorption, and exhibits good biocompatibility.

CN122168598APending Publication Date: 2026-06-09SHANGHAI JIAOTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI JIAOTONG UNIV
Filing Date
2026-04-03
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing PEGylated nucleic acid delivery vectors struggle to balance long circulation and rapid renal clearance, and PEG modification results in excessively large sizes that are difficult to filter through the glomerulus.

Method used

A three-dimensional PEG-modified tetrahedral framework nucleic acid, which mimics myelin, is constructed by periodically introducing PEG units on each edge of a DNA tetrahedral framework to form a three-dimensional PEG network coating structure. This structure independently regulates spatial conformation and hydrodynamic dimensions, thereby reducing surface negative charge and protein adsorption.

Benefits of technology

It achieves a significant increase in blood circulation half-life and improves renal clearance efficiency without significantly increasing the size of nanoparticles, while reducing enzyme degradation and protein adsorption, and has good biocompatibility and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168598A_ABST
    Figure CN122168598A_ABST
Patent Text Reader

Abstract

This invention discloses a myelin-inspired three-dimensional PEG-modified tetrahedral framework nucleic acid and its application in achieving long circulation and rapid renal clearance. Using a DNA tetrahedral framework as a programmable backbone, PEG units are periodically introduced onto each edge of the DNA tetrahedron. The PEG chains are used as active structural components rather than passive surface modifiers to construct a myelin-inspired three-dimensional topological PEG network coating structure. Without significantly increasing the size of small molecules, a dense steric barrier is formed, significantly reducing serum protein adsorption and nuclease degradation. Simultaneously, it efficiently crosses the glomerular filtration barrier, achieving a synergistic effect in mice with approximately a two-fold increase in blood circulation half-life and over 90% renal clearance within 4 hours. Furthermore, it exhibits good biocompatibility and in vivo safety, providing a novel, efficient, and safe nucleic acid drug delivery strategy for diseases related to the accumulation of target substances, such as hyperbiliary acidosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of nanomedicine, biomaterials and nucleic acid drug delivery, and more specifically to a three-dimensional PEG-modified tetrahedral framework nucleic acid that mimics myelin sheath and its application in achieving long circulation and rapid renal clearance. Background Technology

[0002] The translation of nanomedicines into clinical applications has long faced a fundamental pharmacokinetic paradox: design strategies that prolong in vivo circulation time often simultaneously block clearance pathways crucial for safety. This problem stems from limitations at the interface design level, namely the difficulty in independently controlling steric hindrance effects and hydrodynamic dimensions at the molecular scale.

[0003] PEGylation, currently the most mature cloaking strategy, is primarily optimized at the chemical parameter level, such as adjusting the molecular weight or grafting density of PEG. While such methods can alter the interfacial "barrier density," they cannot precisely control the three-dimensional spatial conformation of polymer chains at the bio-nano interface. Ultimately, this inevitably couples the cloaking effect with size increase, thereby hindering renal clearance.

[0004] To overcome this limitation, a platform that simultaneously possesses atomic-level structural precision and spatial addressability is urgently needed to achieve programmable control over interface conformations. DNA nanotechnology, with its high structural rigidity and precise sequence programmability, naturally meets this requirement and provides an ideal framework for construction. For example, the tetrahedral geometry of DNA provides a well-defined spatial coordinate system for interface conformation engineering.

[0005] Therefore, there is an urgent need for a new nanocarrier design strategy that can achieve rapid and efficient renal clearance while ensuring good blood circulation performance. Summary of the Invention

[0006] The purpose of this invention is to provide a tetrahedral framework nucleic acid with myelin-like three-dimensional PEG modification and its application in achieving long circulation and rapid renal clearance, thereby solving the contradiction between long circulation and rapid renal clearance in existing PEGylated nucleic acid delivery vectors, as well as the problem that PEG modification leads to excessive size and difficulty in glomerular filtration.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0008] According to a first aspect of the present invention, a myelin-inspired three-dimensional PEG-modified tetrahedral framework nucleic acid is provided. Using a DNA tetrahedral framework as the backbone, PEG units are periodically introduced into the four single-stranded DNA sequences constituting the DNA tetrahedral framework. Through DNA self-assembly technology and base pairing principles, PEG molecules are assembled in a single-step annealing process, resulting in a periodic distribution of PEG molecules on each edge of the DNA tetrahedral framework, forming a myelin-inspired three-dimensional PEG network coating structure. This three-dimensional PEG network coating structure allows for independent control of spatial conformation and hydrodynamic dimensions, forming a dense steric barrier without significantly increasing the size of small molecules.

[0009] According to the present invention, the hydrodynamic diameter of the myelin-like three-dimensional PEG-modified tetrahedral framework nucleic acid is maintained at 7 nm ± 0.5 nm, the surface negative charge is significantly reduced, the serum protein adsorption is reduced by more than 60%, and it can significantly inhibit the degradation of DNA framework by DNase I.

[0010] According to a preferred embodiment of the present invention, the four DNA single strands of the DNA tetrahedral framework can be designed such that each strand contains multiple triethylene glycol units (-3PEG-). It should be understood that "-3PEG-" refers to the insertion of three ethylene glycol molecules between the phosphate backbones of two nucleotides on the left and right sides of the DNA strand, and the purpose of this design is to assemble this series of DNA strands with inserted 3PEG into a structure in which PEG is spatially distributed on the tetrahedron.

[0011] According to a preferred embodiment of the present invention, each strand of the DNA tetrahedral framework contains 6 "-3PEG-" units, and the total number of PEG modification sites can reach 24, forming a three-dimensional distribution structure of ethylene glycol molecules within a confined space.

[0012] The research presented in this invention reveals that as the dimensionality of PEG modification on the tetrahedron increases, it has different effects on the physicochemical and physiological properties of the tetrahedron, leading to different metabolic characteristics in vivo. At the same molecular weight, the three-dimensional dispersion of PEG can reduce the nanoparticle size while maintaining its molecular function, and simultaneously shield the charge.

[0013] According to a second aspect of the present invention, a method for preparing the myelin-inspired three-dimensional PEG-modified tetrahedral framework nucleic acid is provided, comprising the following steps:

[0014] S1. Synthesize DNA single strands containing 3PEG molecules: Synthesize 4 DNA single strands, each with periodically arranged 3PEG insertion sites, and directly insert 3PEG molecules at each insertion site.

[0015] S2, Annealing Assembly: The four DNA single strands containing 3PEG molecules obtained in step S1 are mixed in an equimolar ratio to achieve a final concentration of 4-6 μM for each strand, and then placed in a 1×TAE / Mg solution. 2+ After incubating at 95°C for 4-6 minutes in a buffer solution, the sample was rapidly cooled to 4°C and then annealed in one step to obtain the myelin-like three-dimensional PEG-modified tetrahedral framework nucleic acid.

[0016] Preferably, the method further includes step S3: setting a capture strand at the vertices of the tetrahedral framework nucleic acid, hybridizing it with the Capture-Clone 9 strand at room temperature for 0.5~1.5h, thereby achieving coupling with bile acid-specific nucleic acid aptamers.

[0017] Preferably, in step S2, the 1×TAE / Mg 2+ The buffer solution consists of: 40 mM Tris, 2 mM EDTA·2Na·2H2O, 20 mM acetic acid, 12.5 mM magnesium acetate, and pH 8.2.

[0018] According to a third aspect of the present invention, the application of the aforementioned myelin-inspired three-dimensional PEG-modified tetrahedral framework nucleic acid in the preparation of a nucleic acid drug delivery vector that achieves long in vivo circulation and rapid renal clearance is provided.

[0019] According to the research of this invention, when the myelin-like three-dimensional PEG-modified tetrahedral framework nucleic acid is used as a nucleic acid drug delivery carrier, its blood circulation half-life in mice is about twice that of the unmodified TDF, the renal clearance rate exceeds 90% within 4 hours, the cumulative renal excretion rate reaches more than 90% within 24 hours, and there is no obvious tissue damage in the major organs of the animal, demonstrating good biocompatibility and in vivo safety.

[0020] According to the present invention, the tetrahedral framework nucleic acid modified with three-dimensional PEG to mimic myelin sheath is coupled with a functional nucleic acid aptamer as a nucleic acid drug delivery carrier loaded with the functional nucleic acid aptamer. While achieving long circulation and rapid renal clearance, the nucleic acid aptamer enables specific recognition and binding of the target substance, and the target substance is rapidly excreted from the body through the kidney.

[0021] According to a preferred embodiment of the present invention, the functional nucleic acid aptamer is the bile acid-specific nucleic acid aptamer Clone 9, whose nucleotide sequence is: GCAGGGTCAATGGAATTAATGATCAATTGACAGACGCAAGTCT; coupling with Clone 9 is achieved by hybridization of the capture strand set at the vertices of the three-dimensional PEG-modified DNA tetrahedral framework with the Capture-Clone 9 strand, the nucleotide sequence of which is: AAAAAAAAAAAAAAAAAAAAGCAGGGTCAATGGAATTAATGATCAATTGACAGACGCAAGTCT.

[0022] According to one application provided by the present invention, the nucleic acid drug delivery carrier is used to prepare nucleic acid drugs for treating diseases caused by the accumulation of target substances in the body, and is particularly suitable for preparing nucleic acid drugs for treating hyperbiliary acidemia. It can efficiently capture free bile acids in the blood and rapidly excrete them through the urine via single or multiple administration modes, significantly reducing serum bile acid levels.

[0023] According to a preferred embodiment of the present invention, a tetrahedral framework nucleic acid with a myelin-like three-dimensional PEG modification and its application in achieving long circulation and rapid renal clearance is provided, comprising the following steps:

[0024] 1) Preparation of tetrahedral framework nucleic acids: TDF was synthesized using DNA self-assembly technology and the principle of complementary base pairing, and PEG molecules were modified in different dimensions using DNA single strands with specific sequences. The structure was characterized by gel electrophoresis and atomic force microscopy (AFM).

[0025] 2) Qualitative and quantitative analyses of PEG-modified sites were performed using fluorescence molecular quantification and fluorescence resonance energy transfer (FRET) techniques, respectively, to verify the assembly structure of different TDFs modified with PEG.

[0026] 3) The structure of the designed and assembled TDF was dynamically simulated by molecular dynamics simulation, and its surface electrostatic potential was simulated. The particle size and ζ potential of each TDF in the PBS environment were detected and compared with the simulated structure.

[0027] 4) The protein levels adsorbed on the TDF surface were detected by magnetic bead sorting, protein quantification and quartz crystal microbalance, and the degradation rate of each TDF in the DNase I environment was also detected.

[0028] 5) Using the fluorescent molecular label PEG-modified TDF, the blood concentration changes and urine content of the total TDF were dynamically monitored in mice. The blood circulation time and cumulative renal clearance under physiological conditions were calculated, and the distribution level of TDF in various organs was statistically analyzed.

[0029] 6) A mouse model of hyperbiliary acidosis was constructed. The bile acid-specific nucleic acid aptamer Clone 9 was loaded onto TDF-PEG3 and its clearance effect on bile acids was evaluated by single and multiple injections. The clearance pathway of bile acids carried by TDF-PEG3 was also explored.

[0030] According to the present invention, a method for achieving long circulation and rapid renal clearance by myelin-inspired three-dimensional PEG modification of FNA is provided, and its synergistic regulation is illustrated in the diagram below. Figure 1 As shown, inspired by the periodic structure of the myelin sheath enveloping axons, PEG units were periodically introduced onto each edge of a DNA tetrahedral nanostructure to construct a three-dimensional PEG-modified framework nucleic acid (FNA). This three-dimensional PEGylation provides an effective protective barrier within blood vessels, significantly reducing its sensitivity to enzymatic degradation and phagocytic uptake. Simultaneously, this three-dimensional PEG-modified FNA exhibits smaller hydrodynamic size and lower surface charge, enabling efficient and rapid clearance from the glomerular filtration barrier into the bloodstream.

[0031] Inspired by the structure of myelin sheaths, this invention achieves efficient axial isolation through a tight, multi-layered helical configuration without significantly increasing radial volume. Therefore, this invention redefines the role of PEG chains, transforming them from passive surface modifiers into active structural components. By precisely specifying the three-dimensional arrangement of PEG chains on the DNA framework, the "topological compression" principle of myelin sheaths is simulated, thereby achieving decoupling of stealth and size at the interface level.

[0032] The key inventive points of this invention are mainly reflected in the following aspects: Innovative structural design: Breaking away from the traditional passive surface modification approach of PEG, this invention uses PEG chains as active structural components. Through a myelin-like three-dimensional topological design, PEG units are periodically introduced onto the edges of the DNA tetrahedral framework (TDF) to construct a three-dimensional networked PEG-coated structure, rather than a simple linear or planar modification. Performance decoupling breakthrough: Through the principle of "topological compression," independent control of spatial steric hindrance and hydrodynamic dimensions is achieved. Without significantly increasing the carrier size (maintaining it at approximately 7 nm), a dense spatial steric barrier is formed, successfully decoupling the contradictory performance requirements of long circulation and rapid renal clearance in traditional PEGylated carriers. Precise application scenarios: By coupling this three-dimensional PEG-modified TDF with bile acid-specific nucleic acid aptamers, a delivery carrier capable of efficiently capturing and rapidly clearing free bile acids from the blood has been developed, providing a novel treatment strategy for diseases related to the accumulation of target substances, such as hyperbiliary acidosis.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] 1) Significantly reduces protein adsorption and enzyme degradation: The three-dimensional PEG network can form a dense and continuous steric barrier on the surface of DNA tetrahedrons, reducing serum protein adsorption by more than 60% and significantly inhibiting the degradation of DNA framework by nucleases such as DNase.

[0035] 2) Simultaneously achieving long circulation and rapid clearance: The three-dimensional PEG-modified framework nucleic acid of the present invention can prolong the blood circulation half-life by about 2 times in mice, and at the same time, the clearance rate through the kidneys exceeds 90% within 4 hours, effectively solving the traditional contradiction between long circulation and clearance efficiency.

[0036] 3) Maintaining a small hydrodynamic size and low surface charge: Since PEG is confined in three-dimensional space to form a "topologically compressed" conformation, the hydrodynamic diameter of the system of the present invention is maintained at about 7.2 nm, and the surface negative charge is significantly reduced, thus making it easier to pass through the glomerular filtration barrier.

[0037] 4) Good biocompatibility and safety: Animal experiments show that the PEG-modified DNA framework described in this invention did not cause significant tissue damage in major organs and has good in vivo safety.

[0038] In summary, this invention uses the DNA tetrahedral framework (TDF) as a programmable backbone and periodically introduces PEG units on each edge, treating the PEG chain as an active structural component rather than a passive surface modifier to construct a myelin-like three-dimensional topological PEG network coating structure. This technical solution overcomes the bottleneck of traditional PEGylated nucleic acid delivery carriers, which struggle to balance long circulation and rapid renal clearance. Without significantly increasing the size of small molecules (maintaining a hydrodynamic diameter of approximately 7 nm), it forms a dense steric barrier, significantly reducing serum protein adsorption and nuclease degradation. Simultaneously, it efficiently crosses the glomerular filtration barrier, achieving a synergistic effect in mice with approximately a two-fold extension of the circulating half-life and over 90% renal clearance within 4 hours. Furthermore, it exhibits good biocompatibility and in vivo safety, making it particularly suitable for loading functional molecules such as bile acid-specific nucleic acid aptamers. This provides a new, efficient, and safe nucleic acid drug delivery strategy for diseases related to the accumulation of target substances, such as hyperbiliary acidosis. Attached Figure Description

[0039] Figure 1This is a schematic diagram illustrating the synergistic regulation of long circulation and rapid renal clearance achieved by myelin-inspired three-dimensional PEGylation of FNA in this invention; wherein, a) shows that, inspired by the periodic structure of the myelin sheath encapsulating axons, PEG units are periodically introduced on each edge of the DNA tetrahedral nanostructure to construct a three-dimensional PEG-modified framework nucleic acid (FNA); b) shows that three-dimensional PEGylation provides an effective protective barrier in blood vessels, significantly reducing their sensitivity to enzymatic degradation and phagocytic uptake;

[0040] Figure 2 This diagram illustrates the structure of DNA tetrahedral frameworks (TDF-PEG) with different PEG modification dimensions, visually demonstrating the PEG topology modification design from one-dimensional linear to three-dimensional tetrahedral, corresponding to the construction idea of ​​myelin-like PEG network structure; where a represents no modification (A0 / B0 / C0 / D0), b represents one-dimensional linear (A1 / B1 / C1 / D1), c represents two-dimensional planar (A2 / B2 / C2 / D2), and d represents three-dimensional tetrahedral (A3 / B3 / C3 / D3).

[0041] Figure 3 The chemical principle of the Capture-PEG coupling reaction is as follows: it involves the covalent coupling of two PEG active esters of different molecular weights with an amino-modified DNA strand. The upper figure shows the reaction of NHS-PEG3400 (N-hydroxysuccinimide-activated PEG3400) with Capture DNA-NH2 (amino-modified capture DNA strand) to generate Capture-PEG3400; the lower figure shows the reaction of NHS-PEG1000 (N-hydroxysuccinimide-activated PEG1000) with Capture DNA-NH2 to generate Capture-PEG1000.

[0042] Figure 4 This is a schematic diagram of DNA tetrahedral frameworks (TDFs) with different PEG modification modes in Example 1; where a is a schematic diagram of the topological modification of ethylene glycol molecules on the DNA tetrahedral scaffold; b is a schematic diagram of different spatial distribution modes of ethylene glycol molecules on the TDF; it demonstrates how the programmable characteristics of the DNA tetrahedral framework can be used to introduce one-dimensional, two-dimensional and three-dimensional ethylene glycol molecules to modify its structure, thereby constructing TDF structures with different PEG modification modes;

[0043] Figure 5This document presents the structural characterization results of PEG-modified TDF in Example 1 of this invention. Specifically, a) shows the 6% polyacrylamide gel electrophoresis (PAGE) results of different TDF samples, where lane 1 represents unmodified TDF, lane 2 represents TDF-PEG1, lane 3 represents TDF-PEG2, lane 4 represents TDF-PEG3, and lane 5 represents the DNA molecular weight standard; b) shows atomic force microscopy (AFM) images of different TDF samples; c) shows the quantitative characterization of the number of PEG modification sites, where Cy3 fluorescent molecules were modified at sites 0, 1, 3, 6, 12, 18, and 24 on the DNA tetrahedral scaffold, and the correlation between fluorescence intensity and the number of modification sites was analyzed; d) shows the spatial localization characterization of the ethylene glycol modification sites in TDF-PEG3, where different modification sites on the three-dimensional PEG-modified TDF were selected, labeled with Cy3 and Cy5 fluorescent molecules, and the fluorescence emission intensity at 670 nm was measured, and the correlation between fluorescence intensity and the theoretical distance between sites was analyzed.

[0044] Figure 6 The following are the physicochemical property characterization results of PEG-modified TDF based on molecular simulation and experiments in Example 2 of this invention; where a is the molecular structure model of different TDFs obtained by molecular simulation and its surface electrostatic potential distribution diagram, where red represents low electronegativity region and blue represents high electronegativity region; b is the hydrodynamic particle size and zeta potential of different TDFs measured in PBS solution; c is the simulation of the motion trajectory of PEG chain terminal atoms in different PEG-modified TDFs within a 100 ns time scale based on the molecular simulation structure, where red lines represent atomic motion trajectories; d is the distribution density of the distance between PEG chain terminal atoms and different TDF vertices during the 100 ns molecular dynamics simulation; e is the spatial probability distribution of PEG terminal atoms located in the tetrahedral geometric space of DNA in the 100 ns molecular dynamics trajectory, *p < 0.05, **p < 0.01;

[0045] Figure 7This invention relates to Example 3, which illustrates the physiological stability and serum protein adsorption characteristics of PEG-modified TDF. Specifically, a) shows the grayscale analysis of gel bands of different PEG-modified TDFs in 10% fetal bovine serum (FBS) at different incubation times (10, 20, 30, 40, 60, 90, and 120 min); b) shows the fitting curves of the structural integrity of different TDFs in 10% FBS over time; c) shows the degradation half-life of different TDFs in 10% FBS; d) shows the change in structural integrity of different TDFs over time in the presence of DNase I; e) shows the real-time monitoring of serum protein adsorption on different PEG-TDF surfaces using a quartz crystal microbalance (QCM) technique: thiol-modified PEG-TDF was immobilized on a gold film surface, and 30% FBS solution (15 min) and PBS solution (15 min) were sequentially introduced via a microfluidic device, with the protein adsorption amount calculated in real-time based on changes in the gold film resonant frequency; f) shows the degradation half-life of different TDFs in 10% FBS. Protein adsorption on different PEG-TDF surfaces under FBS flow conditions; g shows protein adsorption on different PEG-TDF surfaces under PBS elution conditions, *p < 0.05, **p < 0.01, ns, no statistically significant difference;

[0046] Figure 8 This document describes the pharmacokinetic characteristics of different PEG-modified TDFs in Example 4 of the present invention. Specifically: a) Evaluation of blood circulation of different PEG-modified TDFs in mice: Cy3-labeled TDFs were injected into mice via the tail vein (n = 3), and blood samples were collected at 5, 10, 20, 40, 60, 100, 150, 200, and 300 min after injection. Serum fluorescence intensity was measured to assess blood circulation characteristics. b) The blood clearance curve fitting results (150 μL, 1 μM) of different PEG-modified TDFs within 300 min after injection. c) The clearance half-life of different TDFs in blood is shown. d) A schematic diagram of the renal clearance rate detection process of PEG-modified TDFs in mice: Different Cy3-labeled TDFs were injected via the tail vein (150 μL, 1 μM, n = 3), and blood samples were collected at 1, 2, 3, 4, 6, 9, and 24 min after injection. h. Urine samples were collected, and fluorescence intensity and urine volume were measured to assess renal clearance efficiency; e. The renal clearance efficiency of different PEG-modified TDFs in mice was shown; f. The excretion pathway distribution of different PEG-modified TDFs within 24 h was shown; g. The distribution of different PEG-modified TDFs in major organs 24 h after administration was shown.

[0047] Figure 9This is Example 5 of the present invention, illustrating the TDF-PEG3-mediated clearance of bile acids in hyperbiliary hyperacidity. In Example 5, a is a schematic diagram of TDF-PEG3-mediated treatment of hyperbiliary hyperacidity. Under α-anthyl isothiocyanate (ANIT)-induced hepatotoxicity, a large amount of bile acids are released into the bloodstream. TDF-PEG3, loaded with the bile acid-specific aptamer Clone 9, prolongs blood circulation time, efficiently capturing free bile acids in the circulatory system and delivering them to the kidneys for excretion via urine. Example 6 is a schematic diagram of a single-dose treatment for hyperbiliary hyperacidity. Mice were gavaged with ANIT after an 8-hour fast (n=6) to model bile acid levels. A single dose was administered 48 hours after modeling. Blood samples were collected before and 0.5 hours after administration. Urine and feces were collected within 2.5 hours after administration for bile acid quantification. Example 7 shows the changes in blood bile acid levels in mice in different treatment groups before and after a single dose. Purple indicates before administration, blue indicates after administration, and the dashed line represents ANIT. The bile acid levels in the control group were shown; d shows the total excretion of bile acids after a single dose; e shows the distribution of bile acid excretion via feces and urine after a single dose, with blue representing fecal excretion and purple representing urinary excretion; f is a schematic diagram of the experimental procedure for treating hyperbileemia with multiple doses, in which mice were treated with TDF-PEG3 at 24, 30, 36, 42, and 48 h after modeling (n=5); g shows the dynamic changes in blood bile acid levels in mice during multiple doses; h shows the blood bile acid concentration in mice at the end of multiple doses; i shows the time when blood bile acid levels reached their peak after multiple doses; j shows the peak concentration of blood bile acids after multiple doses. Detailed Implementation

[0048] The present invention will be further described below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the techniques used in the embodiments are conventional practices in the art, or experimental methods recommended by the reagent kit and instrument manufacturers. Unless otherwise specified, the reagents and materials used in the embodiments are commercially available.

[0049] Example 1

[0050] Synthesis and structural characterization of PEG-modified tetrahedral framework nucleic acids (TDF-PEG):

[0051] Synthetic routes such as Figure 2As shown, A0~A3, B0~B3, C0~C3, and D0~D3 represent the PEG modification states of the four DNA strands (A, B, C, D) that make up the TDF under different modification dimensions. Larger numbers indicate higher PEG modification dimensions and density. From a to d, PEG modification progresses from none to something, from one-dimensional linear (A1 / B1 / C1 / D1), two-dimensional planar (A2 / B2 / C2 / D2), and finally to three-dimensional tetrahedral (A3 / B3 / C3 / D3), achieving precise programmable control of the PEG modification dimensions. In the three-dimensional modification state (A3 / B3 / C3 / D3), PEG units are periodically distributed on each edge of the TDF, forming a three-dimensional network covering structure similar to myelin sheath. This is key to achieving "topological compression" and decoupling stealth from size.

[0052] (1) The assembly process of TDF is described below. It should be understood that the preparation process of TDF-Cy3 is used to help illustrate the technical effect of the TDF prepared in this invention, and is not intended to limit the invention.

[0053] All DNA oligonucleotides were purchased from Sangon Biotech (Shanghai) Co., Ltd. Unless otherwise specified, all reagents and analytical grade solvents were purchased from Sigma-Aldrich. UV-Vis absorption spectra were measured using a UV-1800 UV spectrophotometer (Shimadzu Corporation); fluorescence spectra were measured using a FluoroMax-4 fluorescence spectrophotometer (HORIBA). Atomic force microscopy (AFM) images were obtained using a MultiMode 8 AFM (Bruker). Dynamic light scattering (DLS) measurements were performed on a Zetasizer Nano ZS (Malvern Instruments). In vivo and ex vivo fluorescence imaging was performed using an IVIS Spectrum imaging system (PerkinElmer, USA).

[0054] All TDF constituent chains were mixed in equimolar proportions, with a final concentration of 5 μM for each chain, at a concentration of 1 × TAE / Mg. 2+ The solution was prepared in a buffer solution (40 mM Tris, 2 mM EDTA·2Na·2H2O, 20 mM acetic acid, 12.5 mM magnesium acetate, pH 8.2, adjusted with acetic acid). The solution was heated to 95 °C and held for 5 min, then rapidly cooled to 4 °C. TDF and TDF-PEG3 were synthesized via a one-step annealing process. Specific annealing steps are shown in Table 1, and the DNA strand sequences corresponding to different TDFs are shown in Table 2 (SEQ ID No. 1-67).

[0055] Table 1. TDF Synthesis and Annealing Steps

[0056]

[0057] Table 2 DNA strand sequences

[0058] The "-3PEG-" label indicates that a 3PEG molecule was artificially added between the two bases during the synthesis of the DNA strand, so that the synthesized DNA strand contains 4 x 3PEG, a total of 12 ethylene glycol molecules.

[0059] (2) Synthesis of DNA-PEG chains.

[0060] Amino-modified DNA (DNA-NH2, sequence shown in Table 3) was prepared into a 1 μM PBS solution and mixed with N-hydroxysuccinimide-modified PEG (PEG-NHS, molecular weight 1000 or 3400 Da, final concentration 150 μM) dissolved in DMSO. After reacting with shaking at 50 °C for 24 h, DMSO was removed by dialysis and excess PEG was removed by ultrafiltration. The coupling efficiency of DNA-PEG was quantified by UV absorption at 260 nm. Subsequently, DNA-PEG was characterized by 6% polyacrylamide gel electrophoresis (PAGE) with a sample loading of approximately 0.1 OD.

[0061] Synthetic routes such as Figure 3 As shown. The core of this reaction is the nucleophilic substitution of the N-hydroxysuccinimide ester group on PEG-NHS with the amino group (-NH2) on the DNA chain, forming a stable amide bond (-CONH-), thereby covalently linking the PEG chain to the DNA. It should be understood that the PEG molecular weight is not limited to these two values, but in this embodiment, these two molecular weights were selected as examples after comparing the PEG distribution patterns to control for similar overall molecular weights.

[0062] (3) Preparation of TDF-PEG and functional TDF. It should be understood that the preparation process of TDF-Cy3 is used to help illustrate the technical effect of the TDF-PEG prepared in this invention, and is not intended to limit the invention.

[0063] A capture strand was placed at each of the four vertices of the TDF, complementary to the DNA sequence of the Capture-PEG chain / Clone 9 aptamer / Cy5. The synthesized TDF (1.125 μM) hybridized with the Capture-PEG chain / Clone 9 aptamer / Cy5 chain (100 μM, in excess of 2 / 1.2 / 1.2 times, respectively) at room temperature for 1 hour. The DNA strand sequences are shown in Table 3 below (SEQ ID No. 68-77).

[0064] Table 3 Hybrid DNA strand sequences

[0065]

[0066] (3) Polyacrylamide gel electrophoresis (PAGE) analysis

[0067] At 1× TAE / Mg 2+ 40% acrylamide solution (acrylamide / bisacrylamide = 29:1) was added to the buffer solution, and 75 μL of ammonium persulfate and 7.5 μL of tetramethylethylenediamine (TEMED) were added as initiator and promoter, respectively. After mixing the sample with an equal volume of loading buffer, electrophoresis was performed at room temperature and a constant voltage of 100 V. After electrophoresis, the gel was stained with GelRed, and images were taken and recorded under 254 nm UV light.

[0068] (4) AFM image scanning

[0069] 3 μL of sample solution (TDF / TDF-PEG1 / TDF-PEG2 / TDF-PEG3) was dropped onto the freshly exfoliated mica surface and allowed to stand for 10 s to promote sample adsorption. The sample was then rinsed with 30 μL of 2 mM magnesium acetate solution and dried with compressed air. Imaging was performed on an FM-Nanoview 1000 AFM in air using tapping mode.

[0070] (5) Fluorescence analysis of the number of TDF-PEG modifications and modification sites

[0071] To investigate the regulatory effect of the number of modifications, 0, 1, 3, 6, 12, 18, and 24 Cy3 modification sites were introduced into TDF according to the sequences listed in Table 2. In the modification site experiment, Cy5 was fixedly modified at specific sites on TDF, while Cy3 was modified at different sites. The relative spatial distance between different modification sites was verified by measuring the intensity changes of FRET fluorescence pairs.

[0072] The schematic diagram of the tetrahedral framework nucleic acid structure obtained in steps (1) and (2) of this embodiment is shown below. Figure 4As shown, ethylene glycol molecules are modified at different distribution sites on a tetrahedral framework. Based on the distribution of EG molecules in tetrahedral space, they are approximated as one-dimensional linear, two-dimensional planar, and three-dimensional tetrahedral structures.

[0073] like Figure 4 As shown in Figure a, the basic method of topological modification of ethylene glycol (EG) molecules on tetrahedral framework nucleic acids (TDF) embodies the core of this invention. It utilizes the programmable site design characteristics of the DNA tetrahedral framework to use EG molecules as the basic unit of PEG modification, precisely grafting them onto specific backbone sites of TDF. This provides a structural basis for subsequent PEG modifications of different dimensions and is also the starting point for molecular design to simulate the periodic structure of myelin sheath.

[0074] like Figure 4 As shown in Figure b, the TDF structures (TDF-PEG1, TDF-PEG2, TDF-PEG3) of the three PEG modification modes—one-dimensional (linear), two-dimensional (planar), and three-dimensional (tetrahedral)—are described below:

[0075] TDF-PEG1 (one-dimensional linear modification): This is a single long-chain modification form. PEG modification is introduced only in a single linear backbone region of TDF. EG molecules are arranged linearly, with few modification sites and limited spatial coverage.

[0076] TDF-PEG2 (two-dimensional planar modification): This is a three-short-chain modification form. PEG is introduced at multiple points in the planar region of TDF, and the EG molecules are distributed in a planar manner, with improved spatial coverage compared to one-dimensional modification, but no three-dimensional network is formed.

[0077] TDF-PEG3 (3D Tetrahedral Modification): This is a 3D network modification that mimics myelin sheathing. PEG molecules are periodically modified on each edge of the TDF tetrahedron, setting 24 EG insertion points. It contains 72 ethylene glycol molecules and forms a 3D distribution within a confined space. It is a key structure for achieving "topological compression" conformation and decoupling stealth from size.

[0078] The gel electrophoresis image obtained in step (3) of this embodiment is as follows: Figure 5 As shown in Figure a, the rightmost part of the electrophoresis diagram is the DNA reference, and the target DNAs from left to right are TDF, TDF-PEG1, TDF-PEG2, and TDF-PEG3. The gel electrophoresis diagram confirms that the DNA nanodevice was successfully synthesized.

[0079] The AFM image obtained in step (4) of this embodiment is as follows: Figure 5 As shown in Figure b, the figure displays the structural information of TDF, TDF-PEG1, TDF-PEG2, and TDF-PEG3, which are consistent with the original design.

[0080] The quantitative analysis of the PEG modification sites on TDF obtained in step (5) of this embodiment is as follows: Figure 5 As shown in c, by gradually increasing the number of modification sites for the Cy3 fluorescent molecular label, a good linear correlation was detected between fluorescence intensity and the number of modification sites, demonstrating the high controllability of functionalization stoichiometry.

[0081] The localization analysis of the PEG modification sites on the TDF obtained in step (5) of this embodiment is as follows: Figure 5 As shown in Figure d, modification site pairs with different theoretical distances were selected, and donor-acceptor fluorescence pairs Cy3 / Cy5 were labeled, and their fluorescence emission spectra were analyzed. The results showed that the acceptor fluorescence intensity was significantly negatively correlated with the theoretical distance between sites, confirming that the geometric position of modification sites on the TDF backbone can be precisely programmed.

[0082] Example 2

[0083] Molecular simulations and experiments were used to jointly detect the physicochemical properties of PEG-modified TDF:

[0084] (1) Structural simulation of TDF

[0085] To investigate the protective effect of PEG modification on TDF, three all-atom systems were constructed and named TDF-PEG1, TDF-PEG2, and TDF-PEG3, respectively. All molecular dynamics simulations were performed using GROMACS 2021 software. The CHARMM36 force field was used to describe bonding and non-bonding interactions, and the TIP3P water model was used for explicit solvation.

[0086] (2) Electrostatic potential simulation

[0087] The structures of all simulated systems were calculated using Multiwfn 3.8. First, molecular density grid data was generated based on atomic coordinates. Then, electrostatic potential grid data was calculated using atomic charges in the CHARMM36 force field, with a grid spacing of 0.8 Bohr. The final results were imported into VMD to plot the electrostatic potential distribution on the molecular surface.

[0088] (3) Dynamic light scattering measurement

[0089] Hydrated particle size and zeta potential of TDF and PEG-modified TDF were determined using a Zetasizer Nano ZS in PBS buffer. Each sample was measured four times.

[0090] (4) Molecular dynamics simulation of TDF

[0091] The system is placed under periodic boundary conditions, and Na is added. +To achieve electrical neutrality, simulations were conducted in an NVT ensemble at 300 K, with temperature controlled by a velocity rescale thermostat. The van der Waals interaction cutoff radius was 1.2 nm, and long-range electrostatic interactions were handled using the PME method. Hydrogen-containing covalent bonds were constrained using the LINCS algorithm, allowing for a time step of 2 fs. After equilibrium, a 100 ns production simulation was performed, with the trajectory saved every 2 ps for subsequent analysis.

[0092] (5) Quantitative analysis of the trajectory points of the terminal atoms of the PEG chain on TDF

[0093] VMD was used to visualize the temporal evolution and spatial distribution of PEG end atoms, and the gmx_mpi distance tool in GROMACS was used to calculate the distance between PEG end atoms and the farthest vertex atom of TDF.

[0094] The molecular simulation structure and surface electrostatic potential obtained in steps (1) and (2) of this embodiment are as follows: Figure 6 As shown in Figure a, the surface electrostatic potential of TDF-PEG3 is significantly lower than that of other configurations.

[0095] The TDF hydration particle size and negative potential obtained in step (3) of this embodiment are as follows: Figure 6 As shown in Figure b, the hydrodynamic particle size and zeta potential of each structure were measured. The particle size of unmodified TDF was approximately 8 nm; TDF-PEG1 and TDF-PEG2 increased to 9.3 nm and 9.7 nm, respectively, mainly due to the contribution of the extended PEG chains to the hydrodynamic size. In contrast, the particle size of TDF-PEG3 decreased to approximately 7.2 nm, indicating that the embedded, short-chain ethylene glycol units can form a more dense, uniform, and compact overall configuration. At the same time, the negative zeta potential of TDF-PEG3 was significantly reduced, while no similar change was observed in TDF-PEG1 and TDF-PEG2, indicating that isolated and flexible PEG chains are difficult to effectively shield the negative charge of the DNA backbone, while three-dimensional networked PEG can achieve multi-point synergistic electrostatic shielding.

[0096] The molecular dynamics simulation of TDF obtained in step (4) of this embodiment is as follows: Figure 6 As shown in Figure c, the trajectories of PEG terminal atoms within 100 ns were simulated to evaluate their coverage of the TDF surface. In TDF-PEG1 and TDF-PEG2, surface coverage is limited due to the spatial spacing between the PEG chains and the backbone. In contrast, although the trajectories of individual triethylene glycol units in TDF-PEG3 are smaller, their three-dimensional distribution on each edge of the tetrahedron causes the trajectories of different PEGs to overlap.

[0097] The quantitative analysis of the trajectory of the PEG chain terminus atom on TDF obtained in step (5) of this embodiment is as follows: Figure 6 As shown in d and e. Spatial probability analysis shows that the joint motion of the PEG end atoms within 100 ns achieves almost complete encapsulation of TDF, approaching 100% three-dimensional coverage.

[0098] Example 3

[0099] Characterization of PEG-modified TDF in physiological environments:

[0100] (1) Detection of physiological stability of PEG-modified TDF

[0101] TDF, TDF-PEG1, TDF-PEG2 and TDF-PEG3 (1 μM) were incubated with 10% (v / v) fetal bovine serum at 37 °C for 0–2 h, and their structural integrity was analyzed by 10% PAGE.

[0102] (2) Degradation kinetics of PEG-modified TDF

[0103] Cy3 / Cy5 donor-acceptor fluorescent pairs were introduced onto TDF, TDF-PEG1, TDF-PEG2, and TDF-PEG3, respectively, to prepare TDF-FRET probes (1 μM). These probes were then incubated with DNase I (0.01 U / μL) at 37 °C for 3 h. The fluorescence intensity change at 666 nm (excitation wavelength 550 nm) was continuously monitored using a microplate reader.

[0104] (3) Measurement of the amount of protein adsorbed on the TDF surface using a quartz crystal microbalance (QCM)

[0105] All quartz crystal microbalance (QCM) experiments were conducted at 25 °C. The adsorption amount of protein on TDF on TCEP-modified gold surfaces was quantitatively analyzed using a Q-Sense analyzer (Biolin Scientific AB, Sweden). TCEP-modified TDF (1 μM) was prepared according to the sequences listed in Table 2 and dissolved in 1× TAE / Mg... 2+ In a buffer solution, the gold film was automatically deposited on the surface of the gold membrane for 3 h at room temperature to form a well-oriented biomolecular layer. The gold membrane was then placed in the QCM measurement chamber, and PBS solution was injected sequentially for 1 min, 30% FBS solution for 15 min, and PBS solution for 15 min, maintaining a flow rate of 100 μL / min throughout the process. Experimental data were analyzed using QSenseDfind software.

[0106] The TDF physiological stability obtained in step (1) of this embodiment is as follows: Figure 7As shown in Figure ac, PEGylation can improve the serum stability of TDF to varying degrees, with TDF-PEG3 showing the most significant effect. Degradation kinetics fitting indicates that the half-life of TDF-PEG3 in serum is more than double that of unmodified TDF.

[0107] The anti-enzymatic degradation ability of TDF obtained in step (2) of this embodiment is as follows: Figure 7 As shown in d. DNase I digestion experiments showed that only TDF-PEG3 could significantly inhibit nuclease degradation, suggesting that its three-dimensional PEG configuration can effectively block DNase I from approaching the DNA backbone.

[0108] The amount of protein adsorbed on the TDF surface obtained in step (3) of this embodiment is as follows: Figure 7 As shown in Figure 1, under continuous serum flow and PBS elution conditions, TDF-PEG3 consistently exhibited the lowest protein adsorption level, demonstrating that the three-dimensionally distributed PEG network can form a highly efficient protective layer on the TDF surface, thereby significantly improving its physiological stability.

[0109] Example 4

[0110] Pharmacokinetic analysis of PEG-modified TDF in mice:

[0111] (1) Characterization of PEG-modified TDF in blood circulation

[0112] Cy3-labeled TDF, TDF-PEG1, TDF-PEG2, and TDF-PEG3 were injected into ICR mice via the tail vein (1 μM, 200 μL). Blood samples (20 μL) were collected via the orbital vein at 5, 10, 20, 40, 60, 100, 150, 200, and 300 min after administration, and the in vivo circulation characteristics of different PEG-modified TDFs were measured using an ELISA reader.

[0113] (2) Study on renal clearance characteristics of PEG-modified TDF

[0114] Cy3-labeled TDF, TDF-PEG1, TDF-PEG2, and TDF-PEG3 were injected into mice via the tail vein (1 μM, 200 μL), and the mice were placed in metabolic cages. Urine samples were collected at 1, 2, 3, 4, 6, 9, and 24 h after administration. After centrifugation at 3500 rpm for 15 min, the supernatant was collected and diluted with PBS. The fluorescence intensity of the urine was quantitatively detected by fluorescence spectroscopy. 24 h after administration, the mice were sacrificed, and major organs and feces were collected, weighed, homogenized in PBS buffer (10 mM, pH 7.4), and centrifuged at 15000 rpm for 10 min to remove insoluble components. The supernatant was collected for fluorescence analysis to evaluate the in vivo distribution and excretion pathways of different PEG-modified TDFs.

[0115] The hemodynamic characteristics of TDF obtained in step (1) of this embodiment are as follows: Figure 8 As shown in Figure ac, the blood clearance half-life (t1 / 2β) of unmodified TDF was 11.40 min. PEG modification prolonged the circulation time, with TDF-PEG3 showing the most significant effect, extending t1 / 2β to 23.80 min, more than twice that of the original TDF; the half-lives of TDF-PEG1 and TDF-PEG2 were 14.71 min and 16.44 min, respectively. These results indicate that the three-dimensional PEG network can significantly reduce nuclease degradation and non-specific protein adsorption, thereby improving overall pharmacokinetic behavior.

[0116] The hemodynamic characteristics of TDF obtained in step (1) of this embodiment are as follows: Figure 8 As shown in the figure, urinary analysis revealed that the urinary excretion rate of unmodified TDF within 24 hours was approximately 59.9%; TDF-PEG1 and TDF-PEG2 decreased to 48.8% and 46.8%, respectively. In contrast, the 24-hour urinary excretion rate of TDF-PEG3 was significantly increased to 86.7%. Simultaneously, its distribution in the liver, spleen, and intestines was significantly reduced, and its fecal excretion rate decreased significantly. Comprehensive analysis indicates that TDF-PEG3 exhibits a cumulative renal excretion rate of up to 90.2% within 24 hours, demonstrating excellent renal clearance properties.

[0117] Example 5

[0118] Detoxification effect of TDF-PEG3 on mice with hyperbiliary acidosis:

[0119] (1) Establishment of mouse α-naphthyl isothiocyanate (ANIT) model

[0120] Mice were fasted for 12 h before administration of the drug via gavage. α-Naphthyl isothiocyanate (ANIT, 0.9 mg / 10 g) was dissolved in corn oil and administered via gavage. Serum bile acid levels were measured 48 h after administration to verify the successful establishment of the hyperbiliary model.

[0121] (2) Single-dose treatment of ANIT injury model

[0122] Five groups were set up in the experiment: 1) Healthy control group (n=6), no treatment; 2) Model control group (PBS, n=6), 200 μL of 1×PBS was administered after ANIT injury; 3) TDF-Clone group 9 (n=6), 1 μM bile acid aptamer-modified TDF (200 μL, 1×PBS) was administered after ANIT injury; 4) TDF-PEG3-Clone group 9 (n=6), 1 μM bile acid aptamer-modified TDF-PEG3 (200 μL, 1×PBS) was administered after ANIT injury; 5) Clone group 9 (n=6), 4 nM free bile acid aptamer (200 μL, 1×PBS) was administered after ANIT injury. All the above preparations were synthesized using the sequences listed in Table 2 and were administered via tail vein injection 48 h after model establishment. Serum bile acid levels were measured 30 min after administration and compared with the healthy group and the PBS group.

[0123] (3) Multiple-dose treatment in the ANIT injury model

[0124] The grouping method was consistent with the single-dose experiment. Repeated administration via tail vein (1 μM, 100 μL / dose) was performed at 24, 30, 36, 42, and 48 h after model establishment. Serum bile acid levels were measured 30 min after each administration and compared with the healthy group and the PBS group.

[0125] (4) Quantitative analysis of bile acid content

[0126] Blood samples were collected via the orbital vein under anesthesia 30 min after each administration; urine and feces were collected via a metabolic cage 2.5 h after administration. Blood and urine samples were centrifuged at 4 ℃ and 3500 rpm for 15 min; feces were weighed, homogenized in PBS buffer (10 mM, pH 7.4), and centrifuged at 4 ℃ and 15000 rpm for 10 min. The supernatant of each sample was collected, and bile acid content was determined according to the instructions of the commercial kit (E003-2-1, Nanjing Jiancheng).

[0127] The establishment of the hyperbiliary mouse model in step (1) of this example is as follows: Figure 9As shown in Figure a. Mice were fasted for 8 hours before establishing the disease model. Severe hyperbiliary acidosis was induced within 48 hours after ANIT administration.

[0128] The effect of a single treatment for hyperbiliary acidosis in step (2) of this example is as follows: Figure 9 As shown in Figure 2, bile acid levels were measured before and 30 min after administration, and urine and feces were collected over the following 2.5 h to analyze bile acid content in different excretion pathways. Blood bile acid detection results showed that both TDF-Clone 9 and TDF-PEG3–Clone 9 significantly reduced serum bile acid levels, with TDF-PEG3–Clone 9 showing a more significant reduction. The difference between the two groups was statistically significant, highlighting the advantage of the three-dimensional PEG platform in the rapid clearance of toxic small molecules. In contrast, the free Clone9 aptamer did not show a significant therapeutic effect due to its poor stability and short circulating half-life. Further analysis of bile acid content in urine and feces showed that the total bile acid excretion in the TDF-PEG3–Clone 9 treatment group was significantly higher than that in the damaged control group, and significantly better than that in the TDF-Clone 9 and free Clone 9 groups. Further analysis of excretion pathways revealed that TDF-PEG3–Clone 9 primarily promotes bile acid clearance via the urinary route, consistent with its highly efficient renal clearance characteristics, while other treatment groups primarily relied on intestinal excretion. These results collectively demonstrate that TDF-PEG3–Clone 9, possessing both long circulation and high renal clearance properties, can efficiently and specifically bind bile acids in the blood and rapidly transport them to the kidneys for excretion in the urine, thereby achieving effective treatment for hyperbiliary hyperacidity.

[0129] The effects of multiple treatments for hyperbiliary acidosis in step (3) of this example are as follows: Figure 9 As shown in Figure fj. Mice were intravenously injected with TDF-PEG3–Clone 9 at 24, 30, 36, 42, and 48 h after ANIT modeling, and bile acid levels were measured 30 min after each administration. The results showed that both TDF-Clone 9 and TDF-PEG3–Clone 9 exhibited more significant therapeutic effects compared to free Clone 9, with TDF-PEG3–Clone 9 showing the most prominent efficacy. At the treatment endpoint (48 h), serum bile acid levels in the TDF-PEG3–Clone 9-treated group almost returned to normal levels, showing no significant difference from the healthy control group. Furthermore, this treatment significantly advanced the time of bile acid peak and significantly reduced the peak concentration, effects that could not be achieved in the conventional TDF–Clone 9 system.

[0130] In summary, thanks to its optimized pharmacokinetic characteristics, the TDF-PEG3 platform, after loading the bile acid aptamer Clone9, has constructed a nano-detoxification system with high specificity and rapid clearance capabilities, demonstrating good therapeutic effects in both single-dose and multiple-dose administration modes.

[0131] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the invention. Various variations can be made to the above embodiments of the present invention. All simple and equivalent changes and modifications made in accordance with the claims and description of this application fall within the protection scope of the claims of this patent. All aspects not described in detail in this invention are conventional technical content.

Claims

1. A tetrahedral framework nucleic acid with three-dimensional PEG modification mimicking myelin sheath, characterized in that, Using a DNA tetrahedral framework as the backbone, PEG units are periodically introduced into the four single-stranded DNA sequences that make up the DNA tetrahedral framework. Through DNA self-assembly technology and the base complementary pairing principle, PEG molecules are assembled in one step by annealing, so that PEG molecules are periodically distributed on each edge of the DNA tetrahedral framework, forming a myelin-like three-dimensional PEG network coating structure. The three-dimensional PEG network coating structure achieves independent control of spatial conformation and hydrodynamic size, forming a dense steric barrier without significantly increasing the size of small molecules.

2. The myelin-like three-dimensional PEG-modified tetrahedral framework nucleic acid according to claim 1, characterized in that, The PEG molecule is a triethylene glycol molecule, which is a segment formed by three ethylene glycol molecules inserted between the phosphate backbones of adjacent nucleotides in a single DNA strand, forming an integrated structure with the single DNA strand.

3. The myelin-like three-dimensional PEG-modified tetrahedral framework nucleic acid according to claim 1, characterized in that, Each DNA single strand has six PEG linkage sites, which are distributed periodically at equal intervals on each single strand. After the four DNA single strands are assembled, six 3PEG molecules are distributed on each edge of the DNA tetrahedral framework, forming a three-dimensional PEG network covering structure with a total of 24 insertion sites.

4. A method for preparing a tetrahedral framework nucleic acid with a myelin-like three-dimensional PEG-modified structure as described in any one of claims 1-3, characterized in that, Includes the following steps: S1. Synthesize DNA single strands containing 3PEG molecules: Synthesize 4 DNA single strands, each with periodically arranged 3PEG insertion sites, and directly insert 3PEG molecules at each insertion site. S2, annealing assembly: mix the four single strands of DNA containing 3 PEG molecules obtained in step S1 in equal molar ratio, so that the final concentration of each strand is 4-6 μM, and place in 1 × TAE / Mg 2+ buffer at 95°C for 4-6 min, and then quickly cool to 4°C to obtain the myelin-imitating three-dimensional PEG-modified tetrahedral framework nucleic acid by one-step annealing assembly.

5. The preparation method according to claim 4, characterized in that, The method also includes step S3: setting a capture strand at the vertices of the tetrahedral framework nucleic acid, hybridizing it with the Capture-Clone 9 strand at room temperature for 0.5~1.5h, thereby achieving coupling with bile acid-specific nucleic acid aptamers.

6. The use of a tetrahedral framework nucleic acid with a myelin-like three-dimensional PEG-modified structure as described in any one of claims 1-3 in the preparation of a nucleic acid drug delivery vector that achieves long-term circulation and rapid renal clearance in vivo.

7. The application according to claim 6, characterized in that, The three-dimensional PEG-modified tetrahedral framework nucleic acid, which mimics myelin sheath, is coupled with a functional nucleic acid aptamer to serve as a nucleic acid drug delivery carrier loaded with the functional nucleic acid aptamer. This achieves long circulation and rapid renal clearance, while the nucleic acid aptamer enables specific recognition and binding of the target substance, allowing the target substance to be rapidly excreted from the body via the kidneys.

8. The application according to claim 7, characterized in that, The functional nucleic acid aptamer is the bile acid-specific nucleic acid aptamer Clone 9, whose nucleotide sequence is: GCAGGGTCAATGGAATTAATGATCAATTGACAGACGCAAGTCT; coupling with the Clone 9 chain is achieved by hybridization of the capture strand set at the vertices of the three-dimensional PEG-modified tetrahedral framework nucleic acid with the Capture-Clone 9 chain, the nucleotide sequence of which is: AAAAAAAAAAAAAAAAAAAAAAAGCAGGGTCAATGGAATTAATGATCAATTGACAGACGCAAGTCT.

9. The application according to any one of claims 6-8, characterized in that, The nucleic acid drug delivery carrier is used to prepare nucleic acid drugs for treating diseases caused by the accumulation of target substances in the body.

10. The application according to claim 9, characterized in that, The nucleic acid drug delivery carrier is used to prepare nucleic acid drugs for the treatment of hyperbiliary acidemia. It can efficiently capture free bile acids in the blood and rapidly excrete them through the urine via single or multiple administration, significantly reducing serum bile acid levels.