Construction method of escherichia coli for producing nmn and application thereof
By modifying Escherichia coli using gene editing technology, a high-yield engineered E. coli strain for NMN production was constructed, solving the problems of high cost and low yield in enzymatic and biological methods for NMN preparation, and achieving highly efficient catalysis of NAM to NMN.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SYNCOZYMES SHANGHAI
- Filing Date
- 2024-12-06
- Publication Date
- 2026-06-09
AI Technical Summary
Existing technologies for preparing NMN using enzymatic methods are costly and difficult to scale up, while biological methods have low yields and are difficult to achieve efficient catalysis of NAM to NMN.
Gene editing technology was used to modify Escherichia coli by knocking out and introducing specific genes to construct engineered E. coli strains that produce high levels of NMN. This included knocking out the purR, ushA, pncA, pncC, edd, and eda genes, enhancing the expression of related enzymes, and optimizing inducers and temperature conditions.
It significantly increased the yield of NMN to 20.6 g/L, reduced the production cost of NMN by biological methods, and achieved the ability to efficiently catalyze the conversion of NAM into NMN.
Smart Images

Figure BDA0005173912750000021 
Figure BDA0005173912750000091 
Figure BDA0005173912750000101
Abstract
Description
Technical Field
[0001] This invention belongs to the field of metabolic engineering technology, specifically relating to a method for constructing NMN-producing Escherichia coli and its application. Background Technology
[0002] Nicotinamide mononucleotide (NMN) is widely found in various organisms and is a coenzyme for the synthesis of nicotinamide adenine dinucleotide (NAD). + Precursors of ) participate in a variety of biochemical reactions and have an important impact on physiological functions such as cellular energy metabolism, DNA repair, cell growth and reproduction.
[0003] NMN is closely related to aging and the occurrence of various chronic diseases. With the increasing demand for health and anti-aging products, NMN supplementation can effectively increase NAD+ levels in the body. + NMN can improve cellular energy metabolism and the normal functioning of various biological processes, potentially slowing down the aging process and improving health. Furthermore, NMN can enhance the body's immune system and also offers numerous benefits such as protecting cardiovascular health, improving sleep quality, and enhancing cognitive function. NMN is gradually becoming a "new favorite" among consumers seeking health products and has enormous potential in the health and pharmaceutical markets.
[0004] The enzymatic preparation of NMN mainly utilizes in vitro enzyme catalysis. Nicotinamide ribose (NR) can be converted to NMN via nicotinamide nucleoside kinase (NRK) (PLoS Biology, 2007, 5(10):2220-2230); or NMN can be obtained by cascading catalysis of enzymes such as nicotinamide (NAM) and ribose through nicotinamide phosphoribosyltransferase (NAMPT), ribose phosphoryl pyrophosphate kinase (PRPPase), and ribokinase (RK) using nicotinamide (NAM) and ribose as raw materials (CN110195089A). The enzymatic route described is shown in Scheme 1. However, the total enzymatic synthesis involves multiple enzymes with high catalytic performance, has many inhibitory factors affecting the reaction, and has high production costs, making large-scale production difficult.
[0005]
[0006] Currently, most methods for synthesizing NMN in vivo via metabolic pathways employ synthetic biology techniques. Recently, the Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, through systematic engineering of *E. coli* and the use of gene editing technology to knock out the pncC and nadR genes, while simultaneously introducing transport proteins to enhance NMN uptake and efflux, achieved the synthesis of 1 g / L of NMN in a shake flask, albeit at a low yield (ACS Synth. Biol. 2024, 13, 2425-2435).
[0007] Therefore, this invention utilizes gene editing and multiple copy gene technology to knock out and introduce relevant genes into the Escherichia coli genome, constructing a high-NMN-producing Escherichia coli strain, enhancing the ability of Escherichia coli to directly catalyze NAM to NMN, and further reducing production costs. Summary of the Invention
[0008] The purpose of this invention is to address the shortcomings of existing technologies by providing an engineered Escherichia coli strain capable of efficiently catalyzing the conversion of NAM to NMN.
[0009] The specific technical solution adopted in this invention is as follows: using Escherichia coli BL21(DE3) as the original strain, by introducing the genes nampt, prs, Bcniap and zwf, and weakening the related genes purR, ushA, pncC and pncA that have degradation functions of 5-phosphoribose-1-pyrophosphate (PRPP), NMN and NAM, as well as the genes edd and eda related to the ED pathway, the genetically engineered strain SZ-T08 (E.coli BL21(DE3):ΔpurRΔushAΔpncAΔpncCΔeddΔeda) is constructed.
[0010] Furthermore, the gene nampt encoding nicotinamide phosphoribosyltransferase is derived from Vibriobacteriophage, and its nucleotide sequence is shown in SEQ ID NO:1.
[0011] Furthermore, the nucleotide sequence of the gene prs encoding 5-phosphoribose-1-pyrophosphate (PRPP) synthase is shown in SEQ ID NO:2.
[0012] Furthermore, the nucleotide sequence of the gene encoding the NMN transporter Bcniap (GenBank: AJH20194.1) is shown in SEQ ID NO:3.
[0013] Furthermore, the pET28a-nampt recombinant plasmid was first constructed into the pET28a vector using nampt, and then the nampt and prs genes were linked together using a linker to achieve gene fusion expression. Simultaneously, the NMN transporter gene Bcniap was constructed into pCDFDuet-1, resulting in the pCDFDuet-1-Bcniap recombinant plasmid. Both the pET-28a-prs-nampt and pCDFDuet-1-Bcniap plasmids were co-transformed into BL21(DE3) competent cells to obtain the engineered E. coli strain SZ-T01.
[0014] Furthermore, using CRISPR / Cas9 gene editing technology, the gene purR, which degrades PRPP, was knocked out. The nucleotide sequence of purR is shown in SEQ ID NO:5. purR was knocked out in strain SZ-T01. After screening for positive clones, strain SZ-T02 (E. coli BL21:ΔpurR) was obtained.
[0015] Furthermore, using CRISPR / Cas9 gene editing technology, the gene ushA, which can degrade NMN into nicotinamide ribose (NR), was knocked out. The nucleotide sequence of ushA is shown in SEQ ID NO:6. After screening for positive clones, the engineered strain SZ-T03 (E. coli BL21:ΔpurRΔushA) was obtained.
[0016] Furthermore, using CRISPR / Cas9 gene editing technology, the pncA gene, which can convert NAM into the byproduct nicotinic acid (NA), was knocked out. The nucleotide sequence of pncA is shown in SEQ ID NO:8. After screening for positive clones, the engineered strain SZ-T04 (E. coli BL21(DE3):ΔpurRΔushAΔpncA) was obtained.
[0017] Furthermore, multiple copies of the gene prs for synthesizing PRPP were constructed. The prs gene was inserted into the MCS2 region of pCDFDuet-Bnciap to obtain the recombinant plasmid pCDFDuet-Bnciap-prs. This recombinant plasmid was then transformed into competent cells of strain SZ-T04. After resistance selection, the engineered strain SZ-T05 (SZ-T04-pCDFDuet-Bnciap-prs) was obtained.
[0018] Furthermore, the gene zwf in the P-6-GDL synthesis pathway was enhanced. zwf encodes NADP. + The gene for glucose-6-phosphate dehydrogenase-dependent enzyme (G6PD-D) has the nucleotide sequence shown in SEQ ID NO:4. The zwf gene was cloned separately into the vector pACYCDuet-1 to obtain the recombinant plasmid pACYCDuet-1-zwf. This recombinant plasmid was then transformed into SZ-T05 competent cells, and after resistance selection, the engineered strain SZ-T06 (SZ-T05-pACYCDuet-1-zwf) was obtained.
[0019] Furthermore, using CRISPR / Cas9 gene editing technology, the gene pncC, which catalyzes the production of the byproduct nicotinic acid mononucleotide (NaMN) from NMN, was knocked out. The nucleotide sequence of pncC is shown in SEQ ID NO:7. After screening for positive clones, the engineered strain SZ-T07 (E.coli BL21(DE3):ΔpurRΔushAΔpncAΔpncC) was obtained.
[0020] Furthermore, using CRISPR / Cas9 gene editing technology, the genes edd and eda, which affect the synthesis of the intermediate product ribose-5-phosphate (R-5-P), were knocked out, ultimately resulting in the engineered strain SZ-T08 (E.coli BL21(DE3):ΔpurRΔushAΔpncAΔpncCΔeddΔeda).
[0021] Furthermore, the engineered strain SZ-T08 was fermented and induced with IPTG at a temperature of 30℃.
[0022] Furthermore, the IPTG concentration is 0.05-0.2 mM, preferably 0.1 mM.
[0023] Furthermore, the substrate NAM was transformed using strain SZ-T08 to generate NMN.
[0024] The beneficial effects of this invention are that it modifies E. coli BL21(DE3) by knocking out and knocking in multiple genes to construct an engineered strain SZ-T08 that can produce high levels of NMN. The NMN yield can reach 20.6 g / L, significantly reducing the production cost of NMN prepared by biological methods. Attached Figure Description
[0025] Figure 1 Roadmap of NMN synthesis in E. coli via metabolic pathway
[0026] Figure 2 HPLC chromatogram of NMN synthesized by engineered bacteria SZ-T01 in Example 1
[0027] Figure 3 LC-MS spectrum of NMN synthesized by engineered bacteria SZ-T01 in Example 1
[0028] Figure 4 HPLC chromatogram of the product synthesized by engineered bacteria SZ-T03 in Example 5
[0029] Figure 5 HPLC chromatogram of the product synthesized by engineered bacteria SZ-T04 in Example 6
[0030] Figure 6HPLC chromatogram of the product synthesized by engineered bacteria SZ-T06 in Example 8
[0031] Figure 7 HPLC chromatogram of the product synthesized by engineered bacteria SZ-T07 in Example 9
[0032] Figure 8 HPLC chromatogram of the products from the shake-flask fermentation broth of engineered strain SZ-T08 in Example 10 Detailed Implementation
[0033] The technical content of the present invention will be further described below with reference to specific embodiments, in order to better understand the content of the present invention, but the scope of protection of the present invention is not limited thereto.
[0034] Example 1: Construction of a novel in vivo NMN synthesis pathway in Escherichia coli
[0035] First, the nampt gene (nucleotide sequence SEQ ID NO:1) from Vibrio bacteriophage was constructed into the vector pET28a to obtain the pET28a-nampt recombinant plasmid. Then, the prs gene was ligated to the nampt gene using a linker to achieve fusion expression of the two genes. The nucleotide sequence of prs is shown in SEQ ID NO:2. The linker sequence between the two genes is: GGCAGCAGCTTTGTTTAACTTTAAGAAGGA GATATACC. Simultaneously, the NMN transporter gene Bcniap (GenBank: AJH20194.1) was constructed into pCDFDuet-1 to obtain the recombinant plasmid pCDFDuet-1-Bcniap, the sequence of which is shown in SEQ ID NO:3. The recombinant plasmids pET-28a-prs-nampt and pCDFDuet-1-Bcniap were co-transformed into BL21(DE3) competent cells to obtain the engineered strain SZ-T01.
[0036] The engineered strain SZ-T01 was fermented and cultured. The seed culture obtained at 37℃ was inoculated into 50 mL of 2YT medium at a 2% inoculum and cultured at 37℃ for 5 h (OD). 600 =0.6), then add IPTG to a final concentration of 0.05 mM and NAM, and induce culture at 25℃ for 26 h. The analytical results of HPLC and LC-MS are as follows: Figure 2 and Figure 3 As shown.
[0037] HPLC and LC-MS chromatographic analysis showed that the fermentation of engineered strain SZ-T01 produced NMN, indicating that the in vivo metabolic pathway is reasonable.
[0038] SEQ ID NO:1
[0039]
[0040] SEQ ID NO:2
[0041] ATGCCGAACATCAAAATCTTCTCTGGTTCTTCTCACCAGGACCTGTCTCAGAAAATCGCTGACCGTCTGGGTCTGGAACTGGGTAAAGTTGTTACCAAAAAATTCTCTAACCAGGAAACCTGCGTTGAAATCGGTGAATCTGTTCGTGGTGAAGACGTTTACATCGTTCAGTCTGGTTGCGGTGAAATCAACGACAACCTGATGGAACTGCTGATCATGATCAACGCTTGCAAAATCGCTTCTGCTTCTCGTGTTACCGCTGTTATCCCGTGCTTCCCGTACGCTCGTCAGGACAAAAAAGACAAATCTCGTGCTCCGATCTCTGCTAAACTGGTTGCTAACATGCTGTCTGTTGCTGGTGCTGACCACATCATCACCATGGACCTGCACGCTTCTCAGATACAGGGCTTCTTCGACATCCCAGTTGACAACCTGTACGCTGAACCGGCTGTTCTGAAATGGATCCGTGAAAACATCTCTGAATGGCGTAACTGCACCATCGTTTCTCCGGACGCTGGTGGTGCTAAACGTGTTACCTCTATCGCTGACCGTCTGAACGTTGACTTCGCTCTGATCCACAAAGAACGTAAAAAAGCTAACGAAGTTGACCGTATGGTTCTGGTTGGTGACGTTAAAGACCGTGTTGCTATCCTGGTTGACGACATGGCTGACACCTGCGGTACCATCTGCCACGCTGCTGACAAACTGCTGTCTGCTGGTGCGACTCGTGTATACGCAATCCTGACCCACGGTATCTTCTCTGGTCCGGCTATCTCTCGTATCAACAACGCTTGCTTCGAAGCTGTTGTTGTTACCAACACCATCCCGCAGGAAGACAAAATGAAACACTGCTCTAAAATCCAGGTTATCGACATCTCTATGATCCTGGCTGAAGCTATCCGTCGTACCCACAACGGTGAATCTGTTTCTTACCTGTTCTCTCACGTTCCGCTGTAA
[0042] SEQ ID NO:3
[0043] ATGGGTGCGTAGCCCTCTGTTTCTGCTGATTAGCTCAATTATTTGTATCCTGGTTGGTTTTTATATCCGTAGCTCCTATATTGAAATCTTTGCCTCCGTTATGGGTATTATTAACGTTGGCTGCTGGCACGTGAAAAGGTTTCTAACTTTCTGTTTGGTATG ATTACTGTTGCAGTGTTTCTGTATATTTTCACCACCCAGGGTCTGTATGCAATGGCTGTTCTGGCAGCATTTCAGTTTTTTCAATGTGTATGGTTGGTATTATTGGATTGCGCGCAGCGGCGAAGAAAAGGTTAAAACCGACGGTTCGTCTGGATCTGAAAG GTTGGATTATTTATATTCTGTTTATCCTGGTGGCATGGATTGGTTGGGGTTATTATCAGGTTCGTTATCTGGAAAGTACGAATCCGTATCTGGATGCACTGAATGCAGTTCTGGGTCTGGTTGCTCAGTTTATGCTGTCTCGTAAAATTCTGGAAAACTGGCA TCTGTGGATTCTGTATAATATTGTTAGTATCGTGATCTATATCAGCACCGGTCTGTATGTTATGCTGGTTCTGGCGATTATTAATCTGTTTCTGTGTATCGATGGTCTGCTGGAATGGAAGAAGAACCATAAAAGAACGCGAACGCGTTAATAACTATATTTAA
[0044] Example 2: Optimization of inducer concentration for engineered strain SZ-T01
[0045] To improve the NMN synthesis concentration, the inducer concentration of the engineered strain SZ-T01 was first optimized. By using a suitable inducer concentration, different catalytic enzymes were expressed appropriately, thus effectively catalyzing the synthesis of NMN. The seed culture of strain SZ-T01 was inoculated at a rate of 2% into 50 mL of 2YT medium and cultured at 37℃ for 5 h (OD). 600≈0.6), and then different amounts of IPTG were added, with the final IPTG concentrations set to 0.05 mM, 0.075 mM, 0.1 mM, 0.2 mM, and 0.3 mM, respectively. Simultaneously, 1 g / L NAM was added to each shake flask, and induction was performed at 25°C for 26 h. The results of the optimized inducer concentration are shown in Table 1. As the results show, an NMN yield of 1.16 g / L can be obtained at an inducer concentration of 0.1 mM. Increasing or decreasing the inducer concentration inhibited the synthesis of NMN; therefore, the inducer concentration was chosen to be 0.1 mM.
[0046] Table 1. Yields of synthesized NMN at different inducer concentrations
[0047]
[0048] Example 3: Optimization of induction temperature for engineered strain SZ-T01
[0049] The cultured strain SZ-T01 seed culture was inoculated into 50 mL of 2YT medium at a 2% inoculum and cultured at 37℃ for 5 h (OD). 600 ≈0.6), then add 0.1 mM IPTG and 1 g / L NAM to a final concentration, and set the induction temperatures to 25℃, 30℃, and 37℃, respectively, and induce fermentation for 26 h. The results of the optimized induction temperature are shown in Table 2. As the results show, during the later induction culture of strain SZ-T01, the higher the temperature, the faster the degradation of the generated NMN. Induction fermentation at 30℃ for 26 h can synthesize 1.14 g / L NMN. Therefore, the final induction temperature was selected as 30℃.
[0050] Table 2. Yields of NMN synthesized at different induction temperatures
[0051]
[0052] Example 4: Construction and culture of engineered strain SZ-T02
[0053] To increase the synthesis of PRPP, an intermediate product in the metabolic pathway of E. coli, the gene purR (SEQ ID NO:5), which degrades PRPP, was knocked out using the CRISPR / Cas9 gene editing system in strain SZ-T01. After screening for positive clones, the engineered strain SZ-T02 (E. coli BL21(DE3):ΔpurR) was obtained.
[0054] The SZ-T02 strain was transformed into 50 mL of 2YT medium and cultured at 37 °C and 200 rpm for 5 h. Then, 0.1 mM IPTG and 1 g / L NAM were added, and the culture was continued at 30 °C for 26 h. The SZ-T02 strain achieved a NMN concentration of 1.4 g / L, representing a 40% increase in yield compared to the SZ-T01 strain.
[0055] SEQ ID NO:5
[0056]
[0057] Example 5: Construction and culture of engineered strain SZ-T03
[0058] To reduce NMN degradation, the gene ushA (SEQ ID NO:6), which degrades NMN to NR, was knocked out using the CRISPR / Cas9 gene editing system on strain SZ-T02. After screening for positive clones, the engineered strain SZ-T03 (E. coli BL21(DE3):ΔpurRΔushA) was obtained.
[0059] SZ-T03 was transformed and expressed in 50 mL of 2YT medium and cultured at 37 °C and 200 rpm for 5 h. Then, 0.1 mM IPTG and 1 g / L NAM were added, and the mixture was cultured at 30 °C for 26 h. The NMN concentration synthesized by strain SZ-T03 reached 2.1 g / L, representing a 50% increase in yield compared to SZ-T02. HPLC analysis results of the product are as follows: Figure 4 As shown.
[0060] SEQ ID NO:6
[0061]
[0062] Example 6: Construction and culture of engineered strain SZ-T04
[0063] To reduce the formation of nicotinic acid, a hydrolysis byproduct of NAM, the pncA gene (SEQ ID NO:8) was knocked out using the CRISPR / Cas9 gene editing system based on strain SZ-T03. After screening for positive clones, the engineered strain SZ-T04 (E. coli BL21(DE3):ΔpurRΔushAΔpncA) was obtained.
[0064] SZ-T04 was transformed into 50 mL of 2YT medium and cultured at 37 °C and 200 rpm for 5 h. Then, 0.1 mM IPTG and 1 g / L NAM were added, and the mixture was cultured at 30 °C for 26 h. The NMN concentration synthesized by strain SZ-T04 reached 1.47 g / L, a 30% decrease compared to SZ-T03, but the byproduct nicotinic acid also decreased significantly. HPLC analysis results of the product are shown below. Figure 5 As shown.
[0065] SEQ ID NO:8
[0066] ATGCCCCCTCGCGCCCTGTTACTGGTCGATTTACAAAATGATTTCTGTGCTGGTGGCGCGCTCGCCGTGCCGGAAGGTGACAGTACGGTGGATGTCGCTAACCGCCTGATTGACTGGTGCCAGTCGCGCGGTGAAGCGGTTATCGCCAGTCAGGACTGGC ACCCGGCGAATCACGGCAGTTTTGCCAGTCAGCACGGTGTAGAGCCTTATACGCCAGGCCAACTCGACGTTTGCCACAAACCTTCTGGCCAGATCACTGTGTGCAGAACAGTGAAGGCGCACAATTACATCCGTTACTGCACCAAAAAGCGATCGCAGCG GTGTTCCATAAAGGCGAAAATCCTTTAGTTGACAGTTACAGTGCCTTTTTTGATAACGGCCGTCGGCAGAAAACCTCTCTCGATGACTGGTTACCGATCATGAAATCGATGAATTGATCGTTATGGGCCTGGCTACTGACTATTGCGTGAAGTTTTACCG TGCTGGACGCGTTACAGTTAGGTTATAAGGTAAACGTGATTACCGATGGTTGTCGTGGCGTGAATATCCAGCCCCAGGACAGTGCGCACGCGTTTATGGAGATGTCAGCAGCTGGGGCAACGCTATATACGCTGGCAGACTGGGAAGAGACACAGGGGTAA
[0067] Example 7 Construction and culture of engineered strain SZ-T05
[0068] To further increase the concentration of the synthesized product by the engineered strain, multiple copies of the key gene prs in the synthesis step were constructed. The prs gene was inserted into the MCS2 region of pCDFDuet-Bnciap to obtain the recombinant plasmid pCDFDuet-Bnciap-prs. This recombinant plasmid was then transformed into competent cells of SZ-T04. After resistance selection, the engineered strain SZ-T05 (SZ-T04-pCDFDuet-Bnciap-prs) was obtained.
[0069] SZ-T05 was transformed and expressed in 50 mL of 2YT medium and cultured at 37 °C and 200 rpm for 5 h. Then, 0.1 mM IPTG and 1.5 g / L NAM were added, and the culture was continued at 30 °C for 26 h. The NMN concentration synthesized by strain SZ-T05 reached 2.81 g / L, representing a 90% increase in yield compared to SZ-T04, while the byproduct nicotinic acid was significantly reduced.
[0070] Example 8 Construction and culture of engineered strain SZ-T06
[0071] In metabolic processes, the synthesis of 6-phosphogluconolactone (P-6-GDL) is a crucial rate-limiting step. To improve the synthesis rate of subsequent products, the aim is to enhance the synthesis of NADP-encoding compounds. + Expression of the glucose-6-phosphate dehydrogenase-dependent gene zwf (SEQ ID NO:4). The zwf gene was cloned separately into the vector pACYCDuet-1 to obtain the recombinant plasmid pACYCDuet-1-zwf. The recombinant plasmid was then transformed into SZ-T05 competent cells. After resistance selection, the engineered strain SZ-T06 (SZ-T05-pACYCDuet-1-zwf) was obtained.
[0072] SZ-T06 was transformed into 50 mL of 2YT medium and cultured at 37℃ and 200 rpm for 5 h. Then, 0.1 mM IPTG and 2 g / L NAM were added, and the mixture was cultured at 30℃ for 26 h. The NMN concentration synthesized by strain SZ-T06 reached 2.32 g / L, a slightly lower yield compared to SZ-T05. HPLC analysis results of the product are shown below. Figure 6 As shown.
[0073] SEQ ID NO:4
[0074]
[0075] Example 9: Construction and culture of engineered strain SZ-T07
[0076] To reduce the enzyme catalyzing the conversion of NMN to the byproduct NaMN by the pncC gene, the pncC gene (SEQ ID NO:7) was knocked out in the genome of strain SZ-T06. Single clones with the knockout gene were screened under certain antibiotic resistance conditions to obtain the engineered strain SZ-T07 (E. coli BL21(DE3):ΔpurRΔushAΔpncAΔpncC).
[0077] SZ-T07 was transformed into 50 mL of 2YT medium and cultured at 37 °C and 200 rpm for 5 h. Then, 0.1 mM IPTG and 2 g / L NAM were added, and the mixture was cultured at 30 °C for 26 h. The NMN concentration synthesized by strain SZ-T07 reached 3.18 g / L, representing a 37.06% increase in yield compared to SZ-T06, and no byproduct NaMN was detected. HPLC analysis results of the product are as follows: Figure 7 As shown.
[0078] SEQ ID NO.7
[0079] ATGCCCCCTCGCGCCCTGTTACTGGTCGATTTACAAAATGATTTCTGTGCTGGTGGCGCGCTCGCCGTGCCGGAAGGTGACAGTACGGTGGATGTCGCTAACCGCCTGATTGACTGGTGCCAGTCGCGCGGTGAAGCGGTTATCGCCAGTCAGGACTGGC ACCCGGCGAATCACGGCAGTTTTGCCAGTCAGCACGGTGTAGAGCCTTATACGCCAGGCCAACTCGACGTTTGCCACAAACCTTCTGGCCAGATCACTGTGTGCAGAACAGTGAAGGCGCACAATTACATCCGTTACTGCACCAAAAAGCGATCGCAGCG GTGTTCCATAAAGGCGAAAATCCTTTAGTTGACAGTTACAGTGCCTTTTTTGATAACGGCCGTCGGCAGAAAACCTCTCTCGATGACTGGTTACCGATCATGAAATCGATGAATTGATCGTTATGGGCCTGGCTACTGACTATTGCGTGAAGTTTTACCG TGCTGGACGCGTTACAGTTAGGTTATAAGGTAAACGTGATTACCGATGGTTGTCGTGGCGTGAATATCCAGCCCCAGGACAGTGCGCACGCGTTTATGGAGATGTCAGCAGCTGGGGCAACGCTATATACGCTGGCAGACTGGGAAGAGACACAGGGGTAA
[0080] Example 10 Construction and culture of engineered strain SZ-T08
[0081] The ED metabolic pathway in *E. coli* was found to break down glucose-6-phosphate (G-6-P), affecting the synthesis of the intermediate product ribose-5-phosphate (R-5-P). To avoid indirectly affecting the synthesis of the final product NMN, two genes involved in the ED metabolic pathway, edd and eda, were knocked out in the genome of strain SZ-T07, resulting in the engineered strain SZ-08 (E. coli BL21(DE3):ΔpurRΔushAΔpncAΔpncCΔeddΔeda).
[0082] Shake-flask fermentation of engineered strain SZ-T08 was conducted. After induction at 30℃ for 24 h, the concentration of product NMN reached 5.03 g / L, which was 58.1% higher than that of SZ-T07, and the residual amount of substrate NAM was very low. HPLC analysis results are as follows. Figure 8 As shown.
[0083] Example 11: Fermentation scale-up of engineered strain SZ-T08
[0084] Take 50 μL of the glycerol-preserved strain SZ-T08 and transfer it to 100 mL of liquid LB containing the corresponding antibiotic and culture for 16 h. Transfer the cultured seed culture to a 5 L fermenter containing 2.5 L of fermentation medium at an inoculation rate of 2%. The fermentation medium is: 10 g / L yeast extract, 6 g / L KH2PO4, 16.4 g / L K2HPO4, 5 g / L (NH4)2SO4, 1.1 g / L citric acid monohydrate, 1 g / L MgSO4, and 10 g / L glucose.
[0085] SZ-T08 was first cultured at 37℃, with the pH adjusted to 7.0 using ammonia. Aeration was controlled at 0.2–4 vvm, dissolved oxygen was controlled in a correlation with agitation speed at 5–40%, and agitation speed was controlled within the range of 200–700 r / min. After inoculation, the cells were cultured for 6–8 hours, and the OD value was measured. 600 The absorbance value at OD. 600 When the bacterial cell growth reaches 15–25 μmol / L, 0.1 mM IPTG is added, and induction is performed at 30 °C. Glucose is then added continuously, and the substrate nicotinamide (NAM) is added at a constant rate of 10–12 mL / h at a concentration of 700 g / L. Cell growth, NAM consumption, and NMN synthesis are monitored regularly.
[0086] OD during the growth of SZ-T08 strain 600 The highest concentration reached 42, and after 48 hours of fermentation, the yield of NMN was 20.6 g / L. During fermentation, 13 g / L of substrate NAM was co-added, leaving 5.1 g / L of NAM remaining. The molar conversion rate of the consumed NAM to NMN was 97.6%, and no byproducts nicotinic acid or NAMN were detected.
Claims
1. A method for constructing NMN-producing Escherichia coli, characterized in that, The method includes the following steps: First, using Escherichia coli BL21(DE3) as the original strain, an engineered strain SZ-T01 is constructed by introducing the genes nampt, prs, and Bcniap. Then, the engineered strain SZ-T04 is constructed by knocking out the genes purR, ushA, and pncA on the basis of SZ-T01. Next, the recombinant plasmid pCDFDuet-Bnciap-prs is transferred into SZ-T04 to construct the engineered strain SZ-T05. Then, the engineered strain SZ-T06 is constructed by enhancing the gene zwf. Finally, the engineered strain SZ-T08 (E. coli BL21(DE3):ΔpurRΔushAΔpncAΔpncCΔeddΔeda) is constructed by knocking out the genes pncC, edd, and eda on the basis of SZ-T06.
2. The method for constructing NMN-producing Escherichia coli as described in claim 1, characterized in that, The original strain was BL21(DE3) Escherichia coli, which does not produce NMN.
3. The method for constructing NMN-producing Escherichia coli as described in claim 1, characterized in that, The genes nampt, prs, Bcniap, and zwf are exogenous genes constructed on plasmids to achieve multi-copy expression in E. coli cells, and their nucleotide sequences are shown in SEQ ID NO:1-4, respectively.
4. The method for constructing NMN-producing Escherichia coli as described in claim 1, characterized in that, The gene zwf was constructed on the expression vector pACYCDuet-1.
5. The method for constructing NMN-producing Escherichia coli as described in claim 1, characterized in that, The genes prs and nampt are constructed and expressed on the pET28a vector, and the two genes are linked by a linker.
6. The method for constructing NMN-producing Escherichia coli as described in claim 1, characterized in that, The genes purR, ushA, pncC, and pncA have degradation functions for PRPP, NMN, and NAM, and their nucleotide sequences are shown in SEQ ID NO:5-8, respectively.
7. The method for constructing NMN-producing Escherichia coli as described in claim 1, characterized in that, The recombinant plasmid pCDFDuet-Bnciap-prs was constructed by inserting the gene prs into the MCS2 region of pCDFDuet-Bnciap.
8. The method for constructing NMN-producing Escherichia coli as described in claim 1, characterized in that, The genetically engineered strain SZ-T08 can be used to produce NMN.
Citation Information
Patent Citations
Nicotinamide mononucleotide and preparation method thereof
CN110195089A