Method for improving heat tolerance of corn and application thereof

By editing the ZmHR1 gene in maize, the problem of heat resistance in maize under high temperature conditions was solved, pollen viability and ear setting rate were improved, and maize yield was increased under high temperature conditions.

CN122189081APending Publication Date: 2026-06-12LONGPING BIOTECHNOLOGY (HAINAN) CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
Filing Date
2026-05-14
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively improve the heat resistance of corn in high-temperature environments, resulting in decreased pollen viability, low ear setting rate, and reduced yield.

Method used

By using genetic engineering techniques to edit specific key sites of the ZmHR1 gene in the maize genome, mutations at specific amino acid sites in the ZmHR1 protein are caused, reducing its expression or activity, thus cultivating heat-resistant maize materials.

Benefits of technology

High temperatures significantly improve pollen heat resistance, increase ear grain filling rate, increase corn yield, and enhance corn's adaptability to high temperatures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122189081A_ABST
    Figure CN122189081A_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of genetic engineering breeding, and particularly relates to a method for improving heat tolerance of corn and application thereof. The method provided by the present application can be used for cultivating transgenic corn plants with high-temperature tolerance and other agronomic traits, and provides a new breeding technical scheme for creating heat-tolerant corn, improving corn pollen vitality, enhancing corn fertility and increasing corn yield. In agriculture, the heat-tolerant corn material created by the method provided by the present application can enhance the adaptability of corn to high-temperature environment, thereby improving the yield per unit area of crops, and has important significance for corn breeding work.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering breeding technology, specifically relating to a method for improving the heat tolerance of maize and its application. To address the problem of plant tolerance under high-temperature conditions, a target gene in the maize genome is targeted... ZmHR1 Gene editing at specific key sites, the target gene after editing at specific key sites ZmHR1 The encoded protein undergoes mutations at specific amino acid sites, and new plant materials are obtained through further cultivation and screening. Under high temperature conditions, the pollen heat resistance is significantly improved compared with the raw materials, and the fruit setting rate of the ears is increased, thus achieving increased yield under high temperature conditions. Background Technology

[0002] As a vital global food, feed, and industrial raw material crop, maize plays a crucial role in driving economic development. In recent years, high-temperature stress has become a significant environmental factor limiting maize growth, development, and yield. High temperatures affect maize throughout its entire growth cycle. During the seedling stage, high temperatures exacerbate water loss, hinder root growth, and negatively impact plant vigor and subsequent development. During the tillering stage, high temperatures cause leaves to wilt, curl, and turn yellow, reducing photosynthetic efficiency. In the reproductive stage, the damage from high temperature stress is even more pronounced. It interferes with pollination, reducing pollen viability and inhibiting silk elongation, leading to grain abortion and severely impacting seed setting rate and yield. Furthermore, high temperatures disrupt maize's physiological and biochemical processes, such as imbalances in photosynthesis and respiration, the accumulation of reactive oxygen species (ROS) damaging cell structure and function, and hormonal homeostasis, affecting normal plant growth and development regulation.

[0003] Currently, although numerous studies have been conducted on the response mechanisms of maize to high-temperature stress, involving gene expression and signal transduction, the overall heat tolerance mechanism remains unclear. In production practice, more effective technologies and methods are urgently needed to enhance maize's heat tolerance and reduce losses caused by high-temperature stress. Improving maize's heat tolerance to increasingly high-temperature environments is a crucial issue in this field. Developing maize varieties with good adaptability to environmental temperature changes using genetic engineering techniques can provide new strategies for the production and application of water-tolerant maize in this field, and has profound significance for promoting the continuous and steady increase of grain yield. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention proposes a method for improving the heat resistance of maize and its application. Furthermore, through cultivation and screening, new maize materials are obtained, which, compared to raw materials, exhibit significantly improved pollen heat resistance and increased ear setting rate under high-temperature conditions, thus achieving increased yield in high-temperature environments.

[0005] This invention discloses a method for obtaining heat-resistant maize materials, wherein the method involves using genetic engineering techniques to reduce the heat resistance of maize. ZmHR1 Gene expression was used to obtain heat-resistant maize material with enhanced pollen activity under high-temperature conditions. ZmHR1 The amino acid sequence of the protein ZmHR1 encoded by the gene is shown in SEQ ID NO.2. ZmHR1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the genetic engineering method is gene editing.

[0006] Furthermore, the method includes any one of the following: (1) Gene editing using CRISPR-Cas9 to knock out the gene as described above. ZmHR1 Gene; (2) In the presence of the aforementioned ZmHR1 The genetic corn general ZmHR1 Genes undergo loss-of-function mutations.

[0007] This invention discloses a heat-resistant maize material with enhanced pollen activity under high-temperature conditions, wherein the maize material contains... ZmHR1 The expression or activity of the gene is downregulated, the ZmHR1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0008] The reduction is ZmHR1 The gene is knocked out or silenced, or contains a reagent that inhibits the ZmHR1 protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] Furthermore, the knockout or silencing of the gene encoding the ZmHR1 protein in maize, or the inhibition of ZmHR1 protein activity, includes any one of the following: 1) The amino acid sequence of the ZmHR1 protein contains a deletion at positions 26-39, as shown in SEQ ID NO.4; that is... ZmHR1 The nucleotide sequence of the gene is missing bases 76-242, and its nucleotide sequence is shown in SEQ ID NO.3; 2) The amino acid sequence of the ZmHR1 protein is missing amino acids 25-36, as shown in SEQ ID NO. 6. ZmHR1 The nucleotide sequence of the gene is missing bases 73-108, and its nucleotide sequence is shown in SEQ ID NO.5; 3) The amino acid sequence of the ZmHR1 protein changes starting from amino acid position 32, as shown in SEQ ID NO. 8. ZmHR1The nucleotide sequence of the gene has a C-base insertion at position 93, as shown in SEQ ID NO.7.

[0010] Furthermore, the gene encoding the ZmHR1 protein in the maize material is knocked out or silenced, or the maize material contains a reagent that inhibits the ZmHR1 protein, the reagent comprising one or more of the following characteristics: (1) The reagent is a CRISPR gene editing reagent; (2) The reagent is used to downregulate the expression of ZmHR1 protein; (3) The reagent is used to inhibit the activity of ZmHR1 protein; (4) The reagent is used to induce a loss-of-function mutation in the ZmHR1 protein; (5) The reagent is used for knockout or silencing. ZmHR1 Gene; (6) The reagent is used to downregulate ZmHR1 Gene expression; (7) The reagent is used to inhibit ZmHR1 Gene activity.

[0011] Furthermore, the reagent is used to enhance the heat resistance of corn or protect corn yield at high temperatures.

[0012] This invention discloses a corn cell containing the aforementioned reagent.

[0013] Compared with the prior art, the present invention has the following beneficial effects: This invention utilizes genetic engineering techniques to target genes in plants. ZmHR1 Performing editing at specific key sites, the target gene after editing at specific key sites ZmHR1 The encoded protein undergoes mutations at specific amino acid sites, and further cultivation and screening yield heat-resistant plant materials. The method provided by this invention can be used to cultivate transgenic maize plants with heat resistance and other agronomic traits, while also providing a new breeding technology solution for creating heat-resistant maize, improving maize pollen viability, enhancing maize seed setting, and increasing maize yield. In agriculture, the heat-resistant maize materials created using the method provided by this invention can enhance maize's adaptability to high-temperature environments, thereby increasing crop yield per unit area, which is of great significance to maize breeding work. Attached Figure Description

[0014] Figure 1 This is a schematic diagram illustrating the relative gene expression levels. Figure 2 This is a schematic diagram of three types of mutant sequences resulting from editing a target gene at specific key sites; Figure 3A map showing the local highest temperature during the corn flowering period; Figure 4 This is a schematic diagram of the leaf damage phenotype between heat-resistant maize and wild-type control maize according to the present invention; Figure 5 This is a schematic diagram of the leaf heat sensitivity index of the heat-resistant maize and the wild-type control maize of this invention; Figure 6 This is a schematic diagram showing the pollen activity rates of heat-resistant maize and wild-type control maize according to the present invention. Detailed Implementation

[0015] The technical solutions of the embodiments of this application will be further described clearly and completely below with reference to the accompanying drawings. It should be noted that the described embodiments are only some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are within the scope of protection of this application.

[0016] To address the issue of maize's heat tolerance under high-temperature conditions, this invention provides a method for improving maize's heat resistance and its application, utilizing genetic engineering techniques to target genes in the maize genome. ZmHR1 Gene editing at specific key sites, the target gene after editing at specific key sites ZmHR1 The encoded protein undergoes mutations at specific amino acid sites, and through further cultivation and screening, new maize materials are obtained. Compared with the raw materials, the pollen heat resistance is significantly improved under high temperature conditions, and the ear seed setting rate is increased, thus achieving increased yield under high temperature conditions.

[0017] Example 1: Design of gene editing sites Target sites were designed using the CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ) for the maize target gene. ZmHR1 Related information was downloaded from the MaizeGDB database (https: / / www.maizegdb.org / ). The exon sequences of the target genes were uploaded to the CRISPR-P website, with the maize genome selected as the reference genome to obtain potential editing sites in adjacent 5'-TNN regions. Two target sites were designed for each gene, located on the first exon of the gene, and the two target sites (located in different expression cassettes) were tandemly coupled to the same gene editing vector. Maize target genes. ZmHR1 The CDS sequence is shown in SEQ ID NO.1, and the amino acid sequence it encodes is shown in SEQ ID NO.2.

[0018] Example 2: Construction of gene editing vector The gRNA was constructed into the gene sequence of the Cas9 protein in the gene editing system used in this invention and the corresponding expression vector to construct the corresponding gene editing vector LP170, wherein the gRNA sequence is as follows: LP170-ZmHR1-Cas9-gRNA: tcgccgtcgacgcgctccaccgg (SEQ ID NO.9) was synthesized and cloned into the plant expression vector pCas9-ZmHR1. The recombinant cloning vector pCas9-ZmHR1 was then transformed into *E. coli* T1 competent cells (Transgen, Beijing, China; Cat. No.: CD501) using a heat shock method. The transformation process was as follows: 50 μL of *E. coli* T1 competent cells and 10 μL of cytosine plasmid DNA (recombinant cloning vectors LP10-T and LP11-T) were mixed and incubated at 42°C for 30 s, followed by a 37°C water bath for 45 min. After transformation, the cells were shaken at 200 rpm for 1 h, then plated onto LB agar plates containing ampicillin (100 mg / L) (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar, pH adjusted to 7.5 with NaOH) and grown overnight. White colonies were picked and cultured overnight on LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 100 mg / L ampicillin, pH adjusted to 7.5 with NaOH) at 37°C with a shaker. The plasmid was extracted using the alkaline method, with the following steps: Centrifuge the bacterial culture at 12000 rpm for 1 min, discard the supernatant, and resuspend the precipitated bacterial cells in 100 μL of pre-chilled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH adjusted to 8.0); add 150 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the centrifuge tube four times to mix, and place on ice for 3-5 min; add 150 μL of ice-cold solution III (4 M potassium acetate, 2 M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at 12000 rpm for 5 min at 4℃, add 2 volumes of anhydrous ethanol to the supernatant, mix well, and place at room temperature for 5 min; centrifuge at 12000 rpm for 5 min at 4℃. After 30 min, discard the supernatant, wash the precipitate with 70% ethanol and air dry; add 30 μL of TE (10 mM Tris-HCl 1 mM EDTA) containing RNase (20 μg / mL), adjust the pH to 8.0 to dissolve the precipitate; digest the RNA in a water bath at 37℃ for 30 min; finally store in a -20℃ freezer for later use.

[0019] Example 3: Transformation of Agrobacterium tumefaciens with recombinant expression vector and detection (I) Transformation of Agrobacterium tumefaciens with recombinant expression vector The correctly constructed recombinant expression vector pCas9-ZmHR1 was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using liquid nitrogen. The transformation conditions were as follows: 100 μL of Agrobacterium LBA4404 and 3 μL of plasmid DNA (recombinant expression vector) were frozen in liquid nitrogen for 10 min and then incubated in a water bath at 37°C for 10 min. The transformed Agrobacterium LBA4404 was inoculated into centrifuge tubes containing LB liquid medium and cultured on a shaker at 28°C and 200 rpm for 2 h. The cultured tubes were then spread on LB solid medium containing 50 mg / L rifampicin and 50 mg / L kanamycin until positive single colonies appeared. Single colonies were picked and cultured for 4-6 h for PCR detection. Positive clones were further cultured: 10 μL of bacterial culture was added to 10 mL of liquid LB (100 mg / L kanamycin, 50 mg / L gentamicin, 50 mg / L rifampin) and cultured overnight at 28°C and 220 rpm. The cells were then centrifuged at 5000 rpm, resuspended in 10 mM MgCl2, and incubated with 10 mM MES and 200 μM AS in the dark for 3 hours for genetic transformation.

[0020] The specific steps for the conversion are as follows: 1. Preparation of Agrobacterium (1) Take the transformed and identified Agrobacterium glycerolus, streak it on YEP solid medium containing 100 mg / L kan and 12 mg / L tet, and then incubate it in the dark at 28℃ for 2-3 days; (2) Add 1 mL of infection medium to a sterile 2 mL centrifuge tube, take the Agrobacterium from step 1 and put it into the infection medium, and mix it thoroughly by pipetting. (3) Take another sterile 2 mL centrifuge tube and adjust the bacterial concentration with infection medium so that OD660 reaches 0.5-0.7.

[0021] 2. Co-culture of maize immature embryos (derived from wild-type maize AX808, which can be purchased through conventional commercial channels) with Agrobacterium. (1) Remove the infection medium from the centrifuge tube containing the embryos and add 1.5 mL of fresh infection medium to wash the embryos once. (2) Remove the infecting culture medium and add the prepared Agrobacterium tumefaciens solution; (3) Place on a shaker at maximum speed for 30 seconds and let stand at room temperature for 5 minutes; (4) Pour the embryos onto the co-culture medium and blot out the liquid; (5) Place the embryo with the flat side facing up and the shield side facing down; (6) Place the embryo in the dark at 22℃ for 2-3 days.

[0022] 3. Callus induction and selection (1) After co-culture, the embryos were transferred to callus induction medium and cultured in the dark at 28°C for 7-10 days. (2) Transfer the induced callus to the selection medium for selection culture. The selection pressure is 5.0 mM glyphosate. Incubate in the dark at 28℃ for 2-3 weeks. (3) Take the callus that survived the first screening and perform a second screening with a screening pressure of 2.0 mM glyphosate.

[0023] 4. Regeneration and culture of transformed lines (1) Take the embryogenic callus that has grown after screening and place it on a predifferentiation medium. Incubate it in the dark at 28°C for 10-14 days. (2) Take embryogenic callus onto differentiation medium and culture at 28℃ for 10-14 days until seedlings differentiate; (3) Transfer the well-differentiated seedlings to the rooting medium and culture them at 28°C until the roots are fully developed; (4) Transplant healthy seedlings into a greenhouse substrate for further growth. Harvest the transgenic plants after they flower and bear fruit. Sow the harvested seeds in a greenhouse, and perform PCR analysis to detect their expression when the plants reach the 4-6 leaf stage.

[0024] (II) Detection of genetically modified maize plants that have undergone editing 1. The editing status of heat-resistant maize ZmHR1 plants was verified by conventional PCR using TransGen PCR's EasyTag PCR SuperMix (China, Beijing, Cat: AS111-11), and the relative expression level of the ZmHR1 gene in maize plants was verified by qRT-PCR. Samples with conventional PCR bands matching the target fragment size were sequenced. qRT-PCR results showed a significantly reduced relative expression level of the ZmHR1 gene in the mutant strains. Sequencing further identified mutant strains with reduced ZmHR1 gene expression or loss of gene function. The results are as follows: Figure 1 As shown. PCR reaction conditions: 95℃ for 30s, 58℃ for 30s, 72℃ for 40s, 30 cycles.

[0025] The universal primers used for PCR detection are: LP170-F: CCGCGCACTACGTATAACCAG (SEQ ID NO.10) LP170-R: CTCAGCAGCAAGGAACATATAGAG (SEQ ID NO.11) The primers used for qRT-PCR detection are: qF:CCGCGCACTACGTATAACCAG(SEQ ID NO.12) qR:AAGCCGATCTCCCGGTGGA (SEQ ID NO.13) Example 4: Heat-resistant corn ZmHR1 can significantly reduce leaf tip dieback caused by high temperature. Leaves under high temperatures are a common indicator of heat tolerance in maize. High temperature stress causes the tops of maize leaves to wither, leading to slow plant growth. This invention presents three types of edited mutants resulting from editing the target gene at specific key sites. zmHR1- 1 , zmHR1-2 , zmHR1-3 (Mutation situation as follows) Figure 2 (As shown) and wild-type conventional maize (control) were sown in a continuous high-temperature environment, with standardized field planting and management. Row length was 5 m, row spacing was 0.67 m, and plant spacing was 0.26 m. Seedlings were thinned at V4, and glyphosate was sprayed to screen out negative seedlings. Insecticides were applied at V6. Each material was sown in one row with 20 holes per row. The local maximum temperature at the maize flowering period was recorded. Figure 3 As shown, if the maximum temperature exceeds 35℃ for more than 11 days, this environment will have a significant heat damage effect on corn. Corn leaf scorch assessment: Leave scorch severity was assessed during the pollen shedding period after 5 consecutive days of high temperatures exceeding 35℃ in the field. The scorched area of ​​each leaf was graded from mild to severe as 0 to 5, with the leaf injury severity calculated as (damaged area of ​​a single leaf / total area of ​​a single leaf) × 100%. Based on the scorched condition of all leaves on a single plant, the plant's heat tolerance was defined as a "heat sensitivity index," graded from mild to severe as 1 to 9. For each material, the percentage of diseased plants out of all plants was defined as the "incidence rate" (incidence rate = number of diseased plants / total number of plants × 100%). Phenotypic assessments were performed on heat-resistant corn ZmHR1 and wild-type control plants based on leaf damage severity and heat sensitivity index. Leaf damage severity is shown in the figure. Figure 4 As shown, the leaf heat sensitivity index is identified as follows: Figure 5 As shown in the box plot, after high-temperature stress, the average heat sensitivity index of the control material leaves was 3.5 (× in the figure), while the average heat sensitivity index of the heat-resistant maize ZmHR1 leaves was 1.5, which was significantly lower than that of the control, showing that it was more heat-resistant.

[0026] Example 5: Heat-resistant maize ZmHR1 can significantly enhance pollen viability under high temperature conditions. High temperatures reduce the viability and lifespan of corn pollen, causing it to easily lose activity and hindering normal pollination, leading to a decrease in seed set. Therefore, this invention further investigates the differences in pollen activity between heat-resistant corn and conventional wild-type corn under high-temperature stress, comparing them with controls under high-temperature conditions. zmHR1 Pollen viability was assessed in maize mutants using a clean pollination bag. Pollen from the same ear row was collected from multiple plants, stained with 1% TTC staining solution, and incubated at 37°C in the dark for 1 hour. The stained pollen solution was then spread evenly on a white background and observed and photographed using an optical microscope. The number of pollen grains stained in different fields of view was recorded and counted. Pollen viability was calculated as (number of red-stained pollen grains in the field of view / total number of pollen grains in the field of view) × 100%. The average pollen viability of the collected material was calculated based on the pollen viability of multiple fields of view. Pollen collection was conducted in the field when the maize material had just shed pollen and the ambient temperature was approximately 29°C, serving as a room temperature control. Pollen collection was conducted at midday when the ambient temperature was approximately 37°C, serving as a heat stress treatment. The pollen viability was assessed as follows: Figure 6 As shown, at 29℃, the pollen viability of both wild-type AX808 maize and heat-resistant maize ZmHR1 was above 60%, with ZmHR1 exhibiting even higher viability. At 37℃, the pollen viability of ZmHR1 remained around 40%, while the control wild-type AX808 maize only maintained around 10%. This demonstrates that, compared to the conventional maize control, heat-resistant maize exhibits higher pollen viability even under extreme high-temperature conditions, ensuring normal pollination, thus guaranteeing seed setting rate and increasing maize yield. This proves that heat-resistant maize ZmHR1 can significantly enhance pollen viability under high-temperature conditions.

[0027] Although preferred embodiments of this application have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this application.

Claims

1. A method for obtaining heat-resistant corn material, characterized in that, The method described involves using genetic engineering techniques to reduce the concentration of certain substances in corn. ZmHR1 Gene expression was used to obtain heat-resistant maize material with enhanced pollen activity under high-temperature conditions. ZmHR1 The amino acid sequence of the gene-encoded protein ZmHR1 is shown in SEQ ID NO.

2. ZmHR1 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the genetic engineering method is gene editing.

2. The method as described in claim 1, characterized in that, The method includes any one of the following: (1) Gene editing using CRISPR-Cas9 to knock out the gene as described in claim 1. ZmHR1 Gene; (2) In the presence of the as described in claim 1 ZmHR1 The genetic corn general ZmHR1 Genes undergo loss-of-function mutations.

3. A heat-resistant corn material with enhanced pollen activity under high-temperature conditions, characterized in that, The corn material ZmHR1 The expression or activity of the gene is downregulated, ZmHR1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. The corn material as described in claim 3, characterized in that, The reduction is ZmHR1 Genes are knocked out or silenced, or as described ZmHR1 The activity of the gene-encoded protein ZmHR1 was inhibited. The amino acid sequence of ZmHR1 is shown in SEQ ID NO.

2.

5. The corn material as described in claim 3, characterized in that, The gene encoding the ZmHR1 protein in maize is knocked out or silenced, or the activity of the ZmHR1 protein is inhibited, including any of the following: 1) The amino acid sequence of the ZmHR1 protein contains a deletion at positions 26-39, as shown in SEQ ID NO. 4; that is... ZmHR1 The nucleotide sequence of the gene is missing bases 76-242, and its nucleotide sequence is shown in SEQ ID NO.3; 2) The ZmHR1 protein has a deletion at amino acid positions 25-36, and its amino acid sequence is shown in SEQ ID NO.6, i.e. ZmHR1 The nucleotide sequence of the gene is missing bases 73-108, and its nucleotide sequence is shown in SEQ ID NO.5; 3) The amino acid sequence of the ZmHR1 protein changes starting from amino acid position 32, and its amino acid sequence is shown in SEQ ID NO. 8, i.e. ZmHR1 The nucleotide sequence of the gene has a C base inserted at position 93, and its nucleotide sequence is shown in SEQ ID NO.

7.

6. The corn material as described in claim 5, characterized in that, The gene encoding the ZmHR1 protein in the maize material is knocked out or silenced, or the maize material contains a reagent that inhibits the ZmHR1 protein, wherein the reagent has one or more of the following characteristics: (1) The reagent is a CRISPR gene editing reagent; (2) The reagent is used to downregulate the expression of ZmHR1 protein; (3) The reagent is used to inhibit the activity of ZmHR1 protein; (4) The reagent is used to induce a loss-of-function mutation in the ZmHR1 protein; (5) The reagent is used for knockout or silencing. ZmHR1 Gene; (6) The reagent is used to downregulate ZmHR1 Gene expression; (7) The reagent is used to inhibit ZmHR1 Gene activity.

7. The use of the reagent as described in claim 6, characterized in that, Used to enhance the heat resistance of corn or protect corn yield under high temperatures.

8. A type of corn cell, characterized in that, It contains the reagent described in claim 6.