Method for the preparation of a pig blood bioreactor simultaneously expressing human albumin and erythropoietin

Abstract

The application discloses a preparation method of a pig blood bioreactor for simultaneously expressing human albumin and erythropoietin, and belongs to the technical field of genetic engineering and animal bioreactor. The method is characterized in that a specific sgRNA is designed for a +91 position of a pig ALB gene by using a CRISPR / Cas9 RNP complex-mediated gene editing technology, a human ALB, EPO and FC fusion gene is knocked into a pig ALB gene site, after electric transfection and positive monoclonal cell screening, a positive monoclonal cell is used as a donor cell to perform somatic cell nuclear transfer, a reconstructed embryo is obtained and transplanted into a recipient sow, and finally, a gene editing cloned pig is obtained. The cloned pig can stably express human albumin and human erythropoietin in blood at the same time. The application has the characteristics of high editing efficiency, low off-target effect and high pregnancy rate of the recipient, and can be used for large-scale production of human albumin and erythropoietin biological products.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and animal bioreactor preparation technology, and relates to a method for preparing a pig blood bioreactor that simultaneously expresses human albumin and erythropoietin. Specifically, it relates to a method for preparing a pig blood bioreactor that simultaneously expresses human albumin (Human ALB) and human erythropoietin (Human EPO) by combining CRISPR / Cas9 gene editing technology with somatic cell nuclear transfer technology. Background Technology

[0002] Human albumin and erythropoietin are biopharmaceuticals in extremely high demand in clinical applications. Human albumin is mainly used to treat hypoalbuminemia, shock, and burns, while human erythropoietin is mainly used to treat renal anemia. Currently, the preparation methods for these biopharmaceuticals have many drawbacks: extraction from human blood faces issues of blood shortage and cross-infection risks; in vitro recombinant expression suffers from low expression levels, loss of post-translational modifications, complex purification processes, and high costs.

[0003] Pigs are ideal models for constructing large animal bioreactors due to their physiological similarities to humans, short reproductive cycles, high litter sizes, and relatively low costs. By using gene editing technology to precisely knock human ALB and EPO genes into endogenous gene sites in pigs, and then producing these bioproducts using the pig blood system, large-scale, low-cost production can be achieved. However, current technologies lack the ability to simultaneously and stably knock in and express human ALB and EPO in pigs, and there are challenges such as low gene editing efficiency, difficulty in screening monoclonal cells, and unclear parameters related to somatic cell nuclear transfer.

[0004] Therefore, developing an efficient and stable method for preparing a porcine blood bioreactor that simultaneously expresses human albumin and erythropoietin has significant application value. Summary of the Invention

[0005] To overcome the shortcomings of existing technologies, this invention provides a method for preparing a porcine blood bioreactor that simultaneously expresses human albumin and erythropoietin. This method uses CRISPR / Cas9 RNP complex-mediated gene editing technology to knock the human ALB, EPO, and FC fusion genes into a specific site in the porcine ALB gene. Combined with somatic cell nuclear transfer technology, gene-edited cloned pigs are obtained, achieving stable expression of human albumin and erythropoietin in porcine blood, thus solving the drawbacks of existing bioproduct preparation methods.

[0006] The Fc fragment is a crystallizable fragment of human immunoglobulin G1 (IgG1), derived from the human IGHG1 gene, corresponding to the Asp104 to Lys330 amino acid region of UniProt accession number P01857, containing a hinge region, a CH2 domain, and a CH3 domain. Its coding sequence is referenced from GenBank accession number AH007035.1. The Fc fragment is used to prolong the half-life of the fusion protein in vivo and improve serum stability.

[0007] The technical solution is as follows:

[0008] First, this invention provides a method for preparing a porcine blood bioreactor that simultaneously expresses human albumin and erythropoietin, comprising the following steps:

[0009] (1) Preparation of porcine ALB gene editing RNP complex: The +91 position of the porcine ALB gene is defined as the 91st nucleotide along the transcription direction (3′ end) with the porcine (Susscrofa) albumin gene transcription start site (TSS) as +1; the reference sequence is NCBI RefSeq NM_001005208.1, genomic version Sscrofa11.1. Using the coding strand as the counting standard, an sgRNA target was designed, the nucleotide sequence of which is AGCCTTTGGCACAATGAAGT. Cas9 protein was synthesized in vitro. The Cas9 protein, the sgRNA, and the human ALB, EPO, and Fc fusion gene synthesis fragments were mixed in proportion to prepare the RNP editing complex; the human ALB, EPO, and Fc fusion gene synthesis fragments are polycistronic expression cassettes, which contain, from the 5′ end to the 3′ end, the following sequence: Kozak sequence, 10×His tag coding sequence, and human ALB. The fusion fragment includes the CDS region, P2A self-cleaving peptide coding sequence, human EPO coding sequence, human Fc coding sequence, and bGH poly(A) signal. The fusion fragment is site-specifically integrated into the porcine ALB gene at site +91 via a homologous recombination arm. Transcription is driven by the porcine ALB endogenous promoter. After P2A peptide self-cleavage, 10xHis-hALB and hEPO-Fc proteins are independently expressed and secreted into the bloodstream.

[0010] (2) Isolation, culture and cryopreservation of fetal pig fibroblasts: Take pig fetuses 30-35 days after mating, prepare trunk muscle tissue fragments, digest with collagenase IV, centrifuge, resuspend and culture, and when the cells grow to 80%-90% confluence, perform passage culture and cryopreservation.

[0011] (3) Electrotransfection and screening of positive monoclonal cells: The RNP complex obtained in step (1) was electrotransfected into fetal pig fibroblasts in the logarithmic growth phase. After monoclonal culture, positive monoclonal cell lines with the target fragment knocked in were screened by PCR combined with Sanger sequencing.

[0012] (4) Somatic cell nuclear transfer: Using the positive monoclonal cells obtained in step (3) as donor cells and the in vitro matured porcine oocytes as recipient cells, the reconstructed embryos are obtained after enucleation, donor cell injection, electrofusion, and activation.

[0013] (5) Embryo transfer and pregnancy identification: The reconstructed embryos obtained in step (4) with a cleavage rate of over 80% after 24-48 hours of culture were transferred to the recipient sows that were in estrus for 48 hours. The pregnancy status was detected by ultrasound 28 days after the transfer, and the gene-edited cloned pigs, i.e., pig blood bioreactors, were obtained.

[0014] Preferably, in step (2), the concentration of collagenase IV is 2 mg / ml, and the incubation time at 37°C is 20 min; the digestion is terminated using DMEM high-glucose medium containing 10% FBS; the centrifugation parameters after tissue digestion are 1500 rpm at room temperature for 5 min; the trypsin-EDTA digestion time during passage culture is 1 min, and the centrifugation parameters are 1000 rpm for 5 min; the cell cryopreservation solution is a mixture containing 10% DMSO and 90% FBS, and is stored using a gradient cooling box.

[0015] Preferably, the specific primers used for PCR identification in step (3) include a left-side ligation primer, a right-side ligation primer, a target site primer, and a full-length knock-in primer; the primer sequences, expected target bands, and annealing temperatures are as follows:

[0016] Left-side connection: Upstream primer as shown in SEQ ID NO:1, downstream primer as shown in SEQ ID NO:2, expected band 942bp, annealing temperature 58℃;

[0017] Right-side connection: Upstream primer as shown in SEQ ID NO:3, downstream primer as shown in SEQ ID NO:4, expected band 930bp, annealing temperature 60℃;

[0018] At the target site: the upstream primer is shown in SEQ ID NO:5, the downstream primer is shown in SEQ ID NO:6, the expected band is 799bp, and the annealing temperature is 58℃;

[0019] Full-length knock-in fragment: Upstream primer as shown in SEQ ID NO:7, downstream primer as shown in SEQ ID NO:8, expected band 4399bp, annealing temperature 57℃.

[0020] Preferably, in step (3), the target fragment is knocked into the gap after a deletion of 62 bases at positions +85 to +146 of the porcine ALB gene; the left and right ligation sites of the positive monoclonal cell line and the target fragment insertion site are all single peaks in Sanger sequencing, and there are no amplified bands at the target site in PCR.

[0021] Preferably, the oocyte maturation culture medium in step (4) is TCM199 medium containing 0.57mM cysteine, 10ng / ml EGF, 25mM HEPES, 2.5mM sodium pyruvate, 1mM L-glutamine, 0.5μg / ml LH and 0.5μg / ml FSH, and the maturation culture conditions are 38.5℃ and 5% CO2 for 42-44 hours; the enucleation operation is performed in TCM199 operation solution containing 5μg / mL cytochalasin B; the electrofusion uses BTX electrofusion solution, and the DC parameters are 1.0kv / cm, 50μs, and 2 pulses; the reconstructed embryo activation is performed by electroactivation combined with chemical activation: after electrofusion, it is treated with 5μM ionomycin for 5min, and then treated with 2mM 6-DMAP for 4h; the activated reconstructed embryo is cultured in PZM-3 embryo development medium under the following conditions: 38.5℃, 5% CO2, 5% O2, and 90% N2.

[0022] Preferably, the recipient sows in step (5) are healthy multiparous sows with an estrus synchronization difference of ≤ ±12h. Each recipient sow is transplanted with 200 high-quality cloned embryos at the 2-4 cell stage, with uniform blastomeres and no fragmentation. The transplantation site is the ampulla of the oviduct. Pregnancy is detected by Doppler ultrasound 28 days after transplantation. The detection parameters are gain 91dB, detection depth 180mm, and ultrasound frequency 3.5MHz. Pregnancy is determined by the appearance of a clear gestational sac and early fetal images in the uterus. The pregnancy rate of the 4 recipient sows is 100%.

[0023] Second, the present invention also provides a porcine blood bioreactor prepared by the above preparation method. The porcine blood bioreactor is a gene-edited cloned pig with human ALB, EPO and FC fusion genes knocked into the porcine ALB gene at a specific site, and its blood simultaneously and stably expresses human albumin and human erythropoietin.

[0024] Third, the present invention also provides the application of the porcine blood bioreactor in the preparation of human albumin and / or human erythropoietin bioproducts.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0026] This invention is the first to achieve site-directed knock-in and co-expression of human albumin (ALB) and erythropoietin (EPO) at the same gene locus (ALB gene + 91 site) in pigs, providing a new platform for the joint production of these two important biological products.

[0027] This invention uses the CRISPR / Cas9 RNP complex for gene editing, which has advantages such as high editing efficiency, low off-target effect, and no risk of foreign DNA integration compared to plasmid transfection or viral vectors.

[0028] This invention establishes a complete system for the isolation, culture, electroporation, and single-clone screening of fetal porcine fibroblasts, and achieves efficient identification of positive clones by using specific PCR primers combined with Sanger sequencing.

[0029] This invention optimizes key parameters for somatic cell nuclear transfer (electrofusion parameters 1.0 kV / cm, 50 µs, 2 pulses; oocyte maturation culture conditions, etc.), achieving a cleavage rate of over 80% and a recipient pregnancy rate of 100% (4 / 4), demonstrating the reliability and reproducibility of the technology.

[0030] This invention utilizes the porcine blood system to produce human-derived proteins, offering advantages such as high yield, low cost, scalability, and avoidance of human pathogen contamination. Furthermore, overexpression of EPO can provide a reliable animal model for studying altitude sickness. Attached Figure Description

[0031] Figure 1 The agarose gel electrophoresis diagram for PCR identification of positive monoclonal cells shows that A is the left-side ligation amplification band, B is the right-side ligation amplification band, C is the target site amplification band, and D is the full-length fragment knock-in amplification band. In the diagram, M is the DL2000 DNA Marker, 1 is the positive monoclonal cell amplification band, and W is the wild-type cell control.

[0032] Figure 2 Optical microscope image (×100x) of gene-edited positive monoclonal porcine fibroblasts.

[0033] Figure 3 The image shows the Sanger sequencing results of gel recovery from positive monoclonal cells, where A represents the sequencing results of left-side ligation, B represents the sequencing results of right-side ligation, and C represents the sequencing results of full-length fragment knock-in.

[0034] Figure 4 This is an ultrasound image of the recipient sows 28 days after transplantation, showing that all four recipient sows are pregnant. The detection parameters are gain 91dB, depth 180mm, and detection frequency 3.5MHz.

[0035] Figure 5The standard curve for human EPO detection by ELISA (four-parameter logistic fitting, R²=0.99951).

[0036] Figure 6 The standard curve for human ALB detection by ELISA (four-parameter logistic fitting, R²=0.99745).

[0037] Figure 7 A comparison of human ALB expression levels in serum from different cloned pigs. Detailed Implementation

[0038] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0039] A method for preparing a porcine blood bioreactor that simultaneously expresses human albumin and erythropoietin specifically includes the following steps:

[0040] 1. Preparation of the porcine ALB gene editing RNP complex: A single sgRNA target was designed at position +91 of the porcine ALB gene. The nucleotide sequence of this sgRNA is AGCCTTTGGCACAATGAAGT (SEQ ID NO:9). Cas9 protein was synthesized in vitro, and the corresponding sgRNA was synthesized by Genscript Biotech. The Cas9 protein, sgRNA, and human ALB, EPO, and FC fusion gene fragments were mixed in a specific ratio to prepare the RNP editing complex, which was used for subsequent gene editing in fetal porcine fibroblasts.

[0041] 2. Isolation, culture, and cryopreservation of fetal porcine fibroblasts

[0042] 2.1 Tissue Acquisition and Processing: Under aseptic conditions, pig fetuses 30-35 days after mating were removed and quickly placed in pre-cooled calcium- and magnesium-free PBS buffer at 4°C. The fetuses were then transferred to a biosafety cabinet and rinsed repeatedly with pre-cooled PBS. The outer membranes of the fetuses were peeled off with sterile forceps, and the fetuses were removed. The head, limbs, and internal organs were removed, while the trunk muscle tissue was preserved. The fetuses were rinsed three times with 5 mL of PBS buffer to remove blood and impurities. The remaining body tissues were cut into pieces of approximately 1 mm³ using sterile surgical scissors.

[0043] 2.2 Digestion Culture: Add 2 mL of 2 mg / mL collagenase IV solution to a centrifuge tube containing fetal pig tissue fragments, incubate at 37°C for 20 min, gently shaking every 5 min to promote tissue digestion; after digestion, add 5 mL of DMEM high-glucose medium containing 10% FBS to terminate digestion, centrifuge at 1500 rpm at room temperature for 5 min, discard the supernatant, add 5 mL of DMEM medium to resuspend the cell pellet, gently pipette 10 times to prepare a single-cell suspension and inoculate into 10 cm culture dishes, place in a 37°C, 5% CO2 saturated humidity incubator, and replace with fresh medium after 24 h, removing non-adherent cells and fragments.

[0044] 2.3 Subculture: When the primary cells have grown to approximately 80%-90% confluence at the bottom of the culture dish, discard the old culture medium and gently wash the cell surface twice with pre-warmed PBS (37°C). Add 2 mL of 0.25% trypsin-EDTA digestion solution and incubate at 37°C for 1 minute. When most spindle fibroblasts are observed to have cytoplasmic retraction, increased intercellular spaces, and rounding under an inverted microscope, immediately add 2-3 times the volume of complete culture medium to stop the digestion. Gently pipette the bottom of the culture dish and collect the cell suspension into a 15 mL centrifuge tube. Centrifuge at 1000 rpm for 5 minutes. Discard the supernatant, resuspend the cell pellet in 10 mL of culture medium, seed into 10 cm dishes, and incubate at 37°C with 5% CO2 saturated humidity. Replace with fresh culture medium after 24 hours.

[0045] 2.4 Cryopreservation: When the cells reach 80%-90% confluence, collect the cells according to the digestion method of passage culture described above, centrifuge at 1000 rpm for 5 min, and discard the supernatant; add pre-cooled cell cryopreservation solution, gently pipette to mix, and aliquot 1 mL into cryopreservation tubes, labeling each tube with the cell name, passage number, and date; place the cryopreservation tubes in a programmed cooling box at -80℃ overnight, and transfer them to a liquid nitrogen storage tank for long-term storage the next day.

[0046] Example 1: Preparation of the porcine ALB gene-editing RNP complex

[0047] 1.1 Target sequence design

[0048] Using the transcription start site (TSS) of the porcine ALB gene as +1, position +91 was selected as the gene editing integration site; reference sequence: NCBI RefSeq NM_001005208.1, genome version Sscrofa11.1. An sgRNA was designed targeting this site with the sequence: 5′-AGCCTTTGGCACAATGAAGT-3′.

[0049] 1.2 Preparation of CRISPR / Cas9 RNP complex

[0050] sgRNA was chemically synthesized in vitro; Cas9 protein was obtained by in vitro purification; sgRNA and Cas9 protein were mixed at a molar ratio of 1.2:1 and incubated at room temperature for 15 min to form a Cas9-sgRNA RNP complex; the RNP complex was mixed with human 10xHis-ALB-P2A-EPO-FC fusion expression cassette donor DNA in a certain proportion for subsequent electroporation.

[0051] The synthesized fragment of the human ALB, EPO, and Fc fusion gene is a polycistronic expression cassette, containing, from the 5′ to the 3′ end, the following sequences: Kozak sequence, 10×His tag coding sequence, human ALB CDS region, P2A self-cleaving peptide coding sequence, human EPO coding sequence, human Fc coding sequence, and bGH poly(A) signal. The Fc fragment is a crystallizable fragment of human immunoglobulin G1 (IgG1), derived from the human IGHG1 gene, corresponding to the Asp 104 to Lys 330 amino acid region of UniProt accession number P01857, and includes a hinge region, a CH2 domain, and a CH3 domain.

[0052] Example 2: Isolation, culture and cryopreservation of fetal porcine fibroblasts

[0053] Under aseptic conditions, pig fetuses 30-35 days after mating were removed and quickly placed in pre-cooled calcium- and magnesium-free PBS buffer at 4°C. The fetuses were then transferred to a biosafety cabinet and rinsed repeatedly. After removing the fetal membranes, the fetal head, limbs, and internal organs were removed, leaving the trunk muscle tissue intact. The fetuses were rinsed three times with 5 mL of PBS and cut into 1 mm³ tissue fragments. 2 mL of 2 mg / mL collagenase IV solution was added to the tissue fragments, and the mixture was incubated at 37°C for 20 min with gentle shaking every 5 min. Digestion was terminated by adding 5 mL of DMEM high-glucose medium containing 10% FBS. The mixture was centrifuged at 1500 rpm at room temperature for 5 min, the supernatant was discarded, and the cells were resuspended in 5 mL of DMEM medium. The cells were pipetted 10 times to prepare a single-cell suspension, which was then inoculated into 10 cm culture dishes and cultured in a 37°C, 5% CO2 saturated humidity incubator. The culture medium was replaced with fresh medium after 24 h.

[0054] When the primary cells reach 80%-90% confluence at the bottom of the culture dish, perform subculture: wash the cell surface twice with PBS pre-warmed to 37°C, add 2 mL of 0.25% trypsin-EDTA digestion solution and digest at 37°C for 1 min. After the cell morphology changes, add 2-3 times the volume of complete culture medium to stop the digestion. Collect the cell suspension, centrifuge at 1000 rpm for 5 min, discard the supernatant, resuspend in 10 mL of culture medium, and seed into 10 cm dishes for continued culture. Replace with fresh culture medium after 24 h.

[0055] When passaged cells reach 80%-90% confluence, collect the cells using the digestion method described above. Centrifuge at 1000 rpm for 5 min, discard the supernatant, and add pre-chilled cell cryopreservation buffer (containing 10% DMSO and 90% FBS). Aliquot into 1 mL tubes, label with relevant information, and incubate overnight at -80°C. Then transfer to a liquid nitrogen storage tank for long-term storage. Figure 2 As shown. Figure 2 The image shows an optical microscope image (×100x) of gene-edited positive monoclonal porcine fibroblasts. The cells are typically spindle-shaped and elongated, which is the characteristic morphology of porcine fetal fibroblasts. The cells are densely arranged, grow uniformly, and have no obvious cell debris or contamination. They are in good condition and meet the requirements for donor cells for somatic cell nuclear transfer.

[0056] Example 3: RNP complex electroporation and screening of positive monoclonal cells

[0057] Fetal porcine fibroblasts frozen in liquid nitrogen were revived and cultured until they reached the logarithmic growth phase and had a confluence of approximately 80%. Single-cell suspensions were prepared by trypsin digestion, washed twice with PBS, and resuspended using an electroporation kit. The cells were then transferred to sterile electroporation cuvettes. The RNP complex prepared in Example 1 was added to the cell suspension in the electroporation cuvettes and mixed thoroughly. The cells were then electroporated using a 4D-Nucleofector electroporation system. After electroporation, the cells were transferred to 6-well plates containing fresh, pre-warmed culture medium and incubated statically at 37°C in a 5% CO2 incubator.

[0058] After electroporation for 72 hours, once the cells had recovered proliferation and were passaged, single-clone screening was performed. When the single-clone cells reached 80%-90% confluence, genomic DNA was extracted, and PCR amplification was performed using designed specific identification primers. The PCR products were initially screened by 1.5% agarose gel electrophoresis. Figure 1 As shown, the results indicated that bands of the expected size were amplified at the left-side ligation, right-side ligation, and full-length fragment knock-in sites, but no band was amplified at the target site. The target band was excised and subjected to Sanger sequencing, as shown... Figure 3As shown, the sequencing results showed that the left and right junctions and the target fragment insertion junction were all single peaks, and a positive monoclonal cell line with target fragment knock-in was successfully screened. This cell line had a deletion of 62 bases at positions +85 to +146 of the porcine ALB gene, and the target fragment was knocked in at this gap.

[0059] Figure 1 In the diagram: A (left link) shows positive monoclonal cells amplifying a specific band of approximately 942 bp, while wild-type cells show no band; B (right link) shows positive monoclonal cells amplifying a specific band of approximately 930 bp, while wild-type cells show no band; C (target region) shows positive monoclonal cells showing no amplified band, confirming that the target region has been inserted by the exogenous fragment; D (full-length fragment knock-in) shows positive monoclonal cells amplifying a specific band consistent with the expectation, while wild-type cells show no band. M is the DL2000 DNA Marker, 1 is a positive monoclonal cell, and W is a wild-type cell control. The results indicate that the human ALB-EPO fusion expression cassette has been precisely integrated into the porcine ALB gene locus.

[0060] Figure 3 In the middle section: A (left-side ligation sequencing results) shows a single sequencing peak shape without any extraneous peaks, and the sequence is clearly readable and completely matches the designed sequence, proving that the 5′ end of the human ALB-EPO fusion expression cassette has achieved precise and mutation-free ligation with the porcine ALB gene; B (right-side ligation sequencing results) shows a single sequencing peak shape without any extraneous peaks, and the sequence is completely consistent with the design, proving that the 3′ end of the fusion expression cassette has achieved precise and mutation-free ligation with the porcine ALB gene; C (fragment knock-in full-length sequencing results) shows a single sequencing peak shape without any extraneous peaks, and the sequence covers the complete insertion region without any base mutations, deletions, or frameshifts, proving that the human ALB-EPO fusion expression cassette has been completely and correctly knocked into the porcine ALB gene site.

[0061] Example 4: Preparation of reconstructed embryos by somatic cell nuclear transfer

[0062] The positive monoclonal cells obtained from Example 3 were revived, rapidly thawed in a 37°C water bath for 1-2 minutes, transferred to DMEM medium containing 10% fetal bovine serum, centrifuged, resuspended, inoculated, and cultured at 37°C with 5% CO2. Cells with good viability were selected as donor cells.

[0063] Ovaries from healthy sows were obtained from the slaughterhouse and transported to the laboratory within one hour in sterile saline (containing antibiotics) at 37°C. Cellular cells (COCs) were extracted from follicles measuring 2-6 mm on the ovarian surface. COCs with intact morphology and dense cumulus cell layers were selected and placed in maturation medium at 38.5°C and 5% CO2 for 42-44 hours to complete in vitro maturation. The maturation medium was TCM199 medium containing 0.57 mM cysteine, 10 ng / ml EGF, 25 mM HEPES, 2.5 mM sodium pyruvate, 1 mM L-glutamine, 0.5 μg / ml LH, and 0.5 μg / ml FSH.

[0064] After maturation, COCs were treated with 0.1% hyaluronidase to remove cumulus cells. The oocytes were then placed in TCM199 manipulation solution containing 5 μg / mL cytochalasin B. The first polar body and the nucleus region below it were aspirated under a micromanipulator. After confirming that there were no nucleus remnants, enucleation was completed. Donor cells were injected into the perivitelline space of the enucleated oocytes. The reconstructed embryos were transferred to BTX electrofusion solution and fused by direct current shocks of 1.0 kV / cm, 50 µs, and 2 pulses. The reconstructed embryos were activated (electroactivation combined with chemical activation: after electrofusion, they were treated with 5 μM ionomycin for 5 min, followed by 2 mM 6-DMAP for 4 h). They were then washed three times with washing solution and cultured in PZM-3 embryo development medium under the following conditions: 38.5℃, 5% CO2, 5% O2, and 90% N2. After 24-48 h of culture, the cleavage rate was calculated, and the cleavage rate reached over 80%.

[0065] Example 5: Embryo Transfer and Pregnancy Determination

[0066] Four healthy multiparous sows with estrus duration of 48 hours (estrus synchronization difference ≤ ±12 hours) were selected. High-quality cloned embryos with a cleavage rate of over 80% (2-4 cell stage, uniform blastomeres, and no fragmentation) from Example 4 were transferred to the ampulla of the oviduct. 200 cloned embryos were transferred to each sow. After transfer, the recipient sows were fed and managed routinely. Pregnancy was detected 28 days later using Doppler ultrasound (detection parameters: gain 91dB, detection depth 180mm, ultrasound frequency 3.5MHz). Pregnancy was defined as the presence of a clear gestational sac and early fetal images in the uterus. Results showed that all four recipient sows achieved successful pregnancy, with a pregnancy rate of 100%. In this single experiment, the four recipient sows gave birth to a total of 8 piglets, all of which survived. A porcine blood bioreactor capable of simultaneously expressing human albumin and erythropoietin was successfully obtained. Figure 4 As shown.

[0067] Example 6: Detection of human ALB and EPO expression in cloned pig serum

[0068] Enzyme-linked immunosorbent assay (ELISA) was used to establish a four-parameter logistic regression standard curve using human ALB and EPO standards. Cloned pig serum samples were then serially diluted for detection, and the results were based on absorbance values ​​(OD). 450 Calculate the target protein concentration.

[0069] Testing materials:

[0070] (1) Samples to be tested: serum from 3 transgenic cloned pigs (numbers: 06137055, 64584382, 64584398);

[0071] (2) Control samples: wild-type pig serum (WT), human ALB / EPO positive control, and blank control;

[0072] (3) Detection reagents: Human ALB ELISA kit, Human EPO ELISA kit.

[0073] Standard curve:

[0074] hEPO standard curve ( Figure 5 R² = 0.99951;

[0075] hALB standard curve ( Figure 6 R² = 0.99745.

[0076] (1) Results of human erythropoietin (hEPO) detection:

[0077] In this embodiment, the three transgenic cloned pigs used for hEPO detection were all born on January 22, 2026, and serum was collected for testing when they reached four weeks of age.

[0078] The concentration of hEPO in cloned pig serum ranged from 4.63 to 58.66 mIU / mL. After 100-fold dilution, the serum concentration was within the linear range of the standard curve, and the original serum concentration after correction was 5866.33 mIU / mL. The detected concentration was within the physiologically effective range of human serum EPO (2.6-18.5 mIU / mL) and the therapeutic concentration range. The gradient dilution showed a good linear relationship with no obvious non-specific interference, indicating that recombinant hEPO has potential biological activity.

[0079] (2) Human albumin (hALB) detection results ( Figure 7 ):

[0080] In this embodiment, the three transgenic cloned pigs used for hALB testing were all born on January 22, 2026, and serum was collected for testing when they reached seven weeks of age.

[0081] Three transgenic cloned pigs were analyzed using a 5-fold dilution:

[0082] Cloned pig 64584382: 2662.28 μg / mL (highest expression level);

[0083] Cloned pig 64584398: 1993.42 μg / mL;

[0084] Cloned pig 06137055: 1689.175 μg / mL;

[0085] The overall serum hALB final concentration ranged from 1520.855 to 2662.28 μg / mL, with an average expression level of 2090.395 μg / mL. No hALB expression signal was observed in the wild-type control, indicating high specificity for detection; the positive control recovery rate met the standards.

[0086] Conclusion: The transgenic cloned pigs described in this invention can stably and efficiently express human ALB and human EPO; the expressed recombinant hALB and hEPO have biological activity; the expression levels of hALB and hEPO in serum meet physiological levels and application requirements, and the expression differences between individuals are controllable, showing promise for large-scale preparation and industrial application.

Claims

1. A method for preparing a porcine blood bioreactor that simultaneously expresses human albumin and erythropoietin, characterized in that, Includes the following steps: (1) Preparation of porcine ALB gene editing RNP complex: sgRNA target site was designed for the +91 position of porcine ALB gene with the nucleotide sequence AGCCTTTGGCACAATGAAGT. Cas9 protein was synthesized in vitro. Cas9 protein, the sgRNA and human ALB, EPO and FC fusion gene synthesis fragments were mixed in proportion to prepare RNP editing complex. (2) Isolation, culture and cryopreservation of fetal pig fibroblasts: Take pig fetuses 30-35 days after mating, prepare trunk muscle tissue fragments, digest with collagenase IV, centrifuge, resuspend and culture, and when the cells grow to 80%-90% confluence, perform passage culture and cryopreservation. (3) Electrotransfection and screening of positive monoclonal cells: The RNP complex obtained in step (1) was electrotransfected into fetal pig fibroblasts in the logarithmic growth phase. After monoclonal culture, positive monoclonal cell lines with the target fragment knocked in were screened by PCR combined with Sanger sequencing. (4) Somatic cell nuclear transfer: Using the positive monoclonal cells obtained in step (3) as donor cells and the in vitro matured porcine oocytes as recipient cells, the reconstructed embryos are obtained after enucleation, donor cell injection, electrofusion, and activation. (5) Embryo transfer and pregnancy identification: The reconstructed embryos obtained in step (4) with a cleavage rate of over 80% after 24-48 hours of culture were transferred to the recipient sows that were in estrus for 48 hours. The pregnancy status was detected by ultrasound 28 days after the transfer, and the gene-edited cloned pigs, i.e., pig blood bioreactors, were obtained.

2. The preparation method according to claim 1, characterized in that, In step (2), the concentration of collagenase IV is 2 mg / ml, and the incubation time at 37°C is 20 min. Digestion is terminated using DMEM high-glucose medium containing 10% FBS. After tissue digestion, the centrifugation parameters are 1500 rpm and 5 min at room temperature. During subculture, the trypsin-EDTA digestion time is 1 min, and the centrifugation parameters are 1000 rpm and 5 min. The cell cryopreservation solution is a mixture of 10% DMSO and 90% FBS, and is stored using a gradient cooling box.

3. The preparation method according to claim 1, characterized in that, In step (3), the target fragment is knocked into the nick at position +85 to +146 of the porcine ALB gene, where 62 bases are deleted. The left ligation site, right ligation site, and target fragment insertion ligation site of the positive monoclonal cell line all show a single peak pattern in Sanger sequencing, and no amplification band is observed in the PCR at the target site. The specific primers used for PCR identification include left ligation primers, right ligation primers, target site primers, and full-length knock-in primers. The primer sequences, expected target bands, and annealing temperatures are as follows: Left-side connection: Upstream primer as shown in SEQ ID NO:1, downstream primer as shown in SEQ ID NO:2, expected band 942bp, annealing temperature 58℃; Right-side ligation: Upstream primer as shown in SEQ ID NO:3, downstream primer as shown in SEQ ID NO:4, expected band 930bp, annealing temperature 60℃; At the target site: the upstream primer is shown in SEQ ID NO:5, the downstream primer is shown in SEQ ID NO:6, the expected band is 799bp, and the annealing temperature is 58℃; Full-length fragment knock-in: Upstream primer as shown in SEQ ID NO:7, downstream primer as shown in SEQ ID NO:8, expected band 4399bp, annealing temperature 57℃.

4. The preparation method according to claim 1, characterized in that, The oocyte maturation culture medium in step (4) is TCM199 medium containing 0.57mM cysteine, 10ng / ml EGF, 25mM HEPES, 2.5mM sodium pyruvate, 1mM L-glutamine, 0.5μg / ml LH and 0.5μg / ml FSH. The maturation culture conditions are 38.5℃ and 5% CO2 for 42-44 hours. The enucleation operation is performed in TCM199 operation solution containing 5μg / mL cytochalasin B. The electrofusion uses BTX electrofusion solution with DC parameters of 1.0kv / cm, 50μs and 2 pulses. The reconstructed embryo activation is a combination of electroactivation and chemical activation: after electrofusion, it is treated with 5μM ionomycin for 5min and then with 2mM 6-DMAP for 4h. The activated reconstructed embryo is cultured in PZM-3 embryo development medium under the following conditions: 38.5℃, 5% CO2, 5% O2 and 90% N2.

5. The preparation method according to claim 1, characterized in that, The recipient sows in step (5) were healthy multiparous sows with an estrus synchronization difference of ≤ ±12h. Each recipient sow was transplanted with 200 high-quality cloned embryos in the 2-4 cell stage, with uniform blastomeres and no fragmentation. The transplantation site was the ampulla of the oviduct. Pregnancy was detected 28 days after transplantation using Doppler ultrasound with the following parameters: gain 91dB, detection depth 180mm, and ultrasound frequency 3.5MHz. Pregnancy was determined by the appearance of a clear gestational sac and early fetal images in the uterus. The pregnancy rate of the four recipient sows was 100%.

6. The porcine blood bioreactor prepared by the method according to any one of claims 1-5, characterized in that, The porcine blood bioreactor is a gene-edited cloned pig with a porcine ALB gene knocked into a site by human ALB, EPO and FC fusion genes, whose blood simultaneously and stably expresses human albumin and human erythropoietin.

7. The use of the porcine blood bioreactor of claim 6 in the preparation of human albumin and / or human erythropoietin bioproducts.

Images