Construction method of a human respiratory syncytial virus newborn mouse infection model and application thereof

By intranasally inoculating SPF-grade BALB/c neonatal mice with RSV virus solution and optimizing inoculation parameters, a stable and low-cost human respiratory syncytial virus (RSV) infection model in neonatal mice was constructed. This solved the problems of gene uniformity and cost in existing models and enabled efficient evaluation of drugs and vaccines.

CN122250425APending Publication Date: 2026-06-23ANJI CHANGBAI TECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ANJI CHANGBAI TECHNOLOGY CO LTD
Filing Date
2026-05-21
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing RSV animal models suffer from insufficient gene homozygosity, genetic stability, and phenotypic homogeneity, making it difficult to meet the needs of efficient, stable, and low-cost evaluation for drug and vaccine development. Furthermore, their construction costs are high, the operation is complex, and it is difficult to guarantee the homogeneity of RSV susceptibility.

Method used

SPF-grade healthy BALB/c newborn mice were used to establish a human respiratory syncytial virus (RSV) infection model in newborn mice by intranasal inoculation with viral fluid containing RSV, optimizing the inoculation route, dosage, and age of the newborn mice.

Benefits of technology

An animal infection model with stable viral replication, typical lung pathological damage, and clear inflammatory response characteristics was constructed. It is simple, low-cost, and highly reproducible, and can simulate the infection characteristics of human respiratory syncytial virus in infants and young children. It is suitable for the evaluation of anti-infective drugs and preventive vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122250425A_ABST
    Figure CN122250425A_ABST
Patent Text Reader

Abstract

The embodiment of the application discloses a method for constructing a human respiratory syncytial virus newborn mouse infection model and application thereof.The method comprises the following steps: inoculating a virus liquid containing a human respiratory syncytial virus (RSV) into a 3-day-old SPF healthy BALB / c newborn mouse through nasal drops, and obtaining the human respiratory syncytial virus newborn mouse infection model after 4-5 days.The application successfully establishes a newborn mouse infection model which is simple to operate, good in repeatability and closer to clinical pathological characteristics.The model has the advantages of high virus infection rate, high similarity of pathological characteristics to human newborn infection, simple model construction method, short cycle, low cost, good stability and strong repeatability, and has a wide application prospect in RSV related research and development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method for constructing a human respiratory syncytial virus (RSV) infection model in newborn mice and its application. Background Technology

[0002] Respiratory syncytial virus (RSV) is a single-stranded, negative-sense RNA virus belonging to the Paramyxoviridae family and the Pneumovirus genus. This virus is widespread globally and is the leading cause of acute lower respiratory tract infections (such as bronchiolitis and pneumonia) in children under 5 years of age, as well as a major cause of hospitalization and death in infants and young children. Pharmacodynamic evaluation is a core step in the development of RSV-related drugs and vaccines. Currently, the mainstream animal model uses 6-week-old mice. Changes in body weight, viral load in the nasal turbinate bones and lung tissues, and live virus titers after RSV infection are key indicators for evaluating the efficacy of drugs or vaccines.

[0003] RSV is highly contagious and primarily spreads through respiratory droplets, close contact, and aerosols. Infection is not limited to infants and young children; the elderly and immunocompromised adults are also susceptible. Although RSV infection is usually self-limiting, it can cause serious complications such as respiratory failure and heart failure in high-risk groups, and severe early infection may be associated with the development of later-onset asthma in children. To meet the needs of RSV-related research, Xiong Rui et al. (Antiviral Research, 2025, 244:106304) disclosed a rapid method for constructing models for RSV research. This technique uses conditional knock-in mice (R26R-hIGF1R) carrying the human insulin-like growth factor 1 receptor (hIGF1R) gene and transduces the human RSV receptor hIGF1R in the mouse lungs via tracheal transduction using an adenovirus vector (Ad5-CMV-Cre). This method can rapidly obtain RSV-susceptible Ad5-hIGF1R mice within 7 days. After infection with RSV, the viral load in the lungs of mice in this model increased significantly, and pathological changes similar to those of RSV infection in human infants and young children, such as diffuse interstitial pneumonia, were observed. It is mainly used for efficacy evaluation and safety studies of RSV vaccines and antiviral drugs.

[0004] However, existing RSV animal models still have many shortcomings, making it difficult to meet the needs of efficient, stable, and low-cost evaluation in drug and vaccine development. For example, the cotton rats used in conventional modeling are outbred (closed colony) breeds, whose gene homozygosity, genetic stability, gene homology, and phenotypic uniformity are inferior to conventional inbred rodents such as BALB / c mice and SD rats. Furthermore, cotton rats are non-conventional experimental animals that need to be imported, resulting in a small market breeding population and significantly higher modeling costs compared to conventional experimental animals. Ad5-hIGF1R mice and similar genetically modified mice rely on adenovirus-mediated transient hIGF1R expression for their construction, leading to significant individual variability and relatively complex procedures. This makes it difficult to ensure the uniformity of RSV susceptibility across different modeling batches of mice, thus hindering the stable and repeated evaluation of the same drug or vaccine across multiple batches. In addition, the high cost of constructing and modeling these genetically modified mice further limits their widespread application in RSV-related research. Summary of the Invention

[0005] Therefore, embodiments of the present invention provide a method for constructing a human respiratory syncytial virus (RSV) infection model in newborn mice and its application.

[0006] To achieve the above objectives, the embodiments of the present invention provide the following technical solutions:

[0007] According to a first aspect of the present invention, the present invention provides a method for constructing a human respiratory syncytial virus (RSV) neonatal mouse infection model, the method comprising: intranasally inoculating SPF-grade healthy BALB / c neonatal mice on the 3rd day after birth with a viral solution containing human respiratory syncytial virus (RSV), and obtaining the human respiratory syncytial virus neonatal mouse infection model after 4-5 days.

[0008] Furthermore, the RSV viral load of the viral fluid is 10^4.5 PFU.

[0009] Furthermore, the method for preparing the viral fluid includes: culturing and amplifying the RSV strain using HEp-2 cells, and obtaining the viral fluid after harvesting and processing.

[0010] Furthermore, the RSV strain is RSV-A2.

[0011] According to a second aspect of the present invention, the present invention provides a human respiratory syncytial virus (RSV) infection model in newborn mice, which is constructed by the method described in any of the preceding claims.

[0012] According to a third aspect of the present invention, the present invention provides the application of the human respiratory syncytial virus neonatal mouse infection model as described above in the efficacy evaluation of anti-infective drugs and the protective evaluation of preventive vaccines.

[0013] The embodiments of the present invention have the following advantages:

[0014] This invention utilizes SPF-grade newborn BALB / c mice and, by optimizing key parameters such as the viral inoculation route, dosage, and age of the newborn mice, successfully constructed an animal infection model exhibiting stable viral replication, typical lung pathological damage, and well-defined inflammatory response characteristics. This model is simple to construct, has a short modeling cycle, low preparation cost, and good reproducibility, and can effectively simulate the infection characteristics of human respiratory syncytial virus in infants and young children.

[0015] Furthermore, this invention applies the constructed human respiratory syncytial virus (RSV) neonatal mouse infection model to the efficacy evaluation of anti-infective drugs and the protective effect evaluation of prophylactic vaccines. Regarding the efficacy evaluation of anti-infective drugs, this model can objectively reflect the effects of drugs in inhibiting viral replication, reducing lung lesions, and alleviating inflammatory damage. Regarding the protective effect evaluation of prophylactic vaccines, this model can be used to assess the immune protective efficacy induced by the vaccine, including reducing viral load and alleviating lung pathological damage.

[0016] In summary, the method for constructing a newborn mouse model of human respiratory syncytial virus infection provided by this invention and its application can provide a reliable and practical animal tool for screening anti-respiratory syncytial virus drugs and evaluating vaccine efficacy, and has important basic scientific research value and good prospects for clinical translational application. Attached Figure Description

[0017] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other embodiments based on the provided drawings without creative effort.

[0018] Figure 1 The present invention provides curves showing the changes in body weight of newborn mice of different ages after infection;

[0019] Figure 2 The weight change curves of 3-day-old newborn mice after being vaccinated with different doses provided by the present invention;

[0020] Figure 3 A statistical chart of lung tissue copy numbers in 3-day-old newborn mice using different inoculation routes, provided by this invention;

[0021] Figure 4 The viral load change curve of lung tissue in 3-day-old newborn mice after intranasal inoculation, as provided by the present invention;

[0022] Figure 5 A curve showing the change in pathological scores of lung tissue in 3-day-old newborn mice after intranasal inoculation, provided by the present invention.

[0023] Figure 6 The pathological observation results of lung tissue from 3-day-old newborn mice inoculated with intranasal drops, as provided by this invention;

[0024] Figure 7 A statistical graph of lung tissue copy number for pharmacodynamic evaluation of the small molecule drug provided by this invention in a human respiratory syncytial virus neonatal mouse infection model;

[0025] Figure 8 A statistical graph showing the copy number of the small molecule drug provided by this invention in the nasal turbinate bone tissue for pharmacodynamic evaluation in a human respiratory syncytial virus neonatal mouse infection model.

[0026] Figure 9 A statistical chart of lung tissue pathological scores for pharmacodynamic evaluation of small molecule drugs in a neonatal rat model of human respiratory syncytial virus infection, provided by the present invention.

[0027] Figure 10 The pharmacodynamic evaluation of the small molecule drug provided by this invention in a neonatal rat model of human respiratory syncytial virus infection; and the pathological observation results of lung tissue.

[0028] Figure 11 A statistical graph of lung tissue copy number for evaluating the protective effect of the vaccine provided by this invention against human respiratory syncytial virus in a neonatal mouse infection model;

[0029] Figure 12 A statistical graph showing the copy number of nasal turbinate bone tissue in evaluating the protective effect of the vaccine provided by this invention against human respiratory syncytial virus in a neonatal mouse infection model.

[0030] Figure 13 A statistical graph of lung tissue pathological scores for evaluating the protective effect of the vaccine provided by this invention against human respiratory syncytial virus in a neonatal mouse infection model;

[0031] Figure 14 The results of lung tissue pathological observation on the protective effect of the vaccine provided by this invention against human respiratory syncytial virus in a neonatal mouse infection model. Detailed Implementation

[0032] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0033] HEp-2 cells: Purchased through ATCC, ATCC Number: CCL-2TM ;

[0034] RSV-A2 strain: purchased through ATCC, ATCC Number VR-1540.

[0035] Example 1: Method for constructing a neonatal mouse model of human respiratory syncytial virus infection

[0036] 1. Host cell preparation

[0037] 1.1 HEp-2 cell resuscitation

[0038] Before starting the resuscitation process, turn on the water bath and ensure the temperature reaches 37°C. Place the cells in the 37°C water bath, gently press the cryovials with forceps to ensure they are completely submerged in the liquid, and gently agitate them in the water. The cells will begin to thaw; remove them when no ice crystals are visible to the naked eye. Wear safety goggles throughout the resuscitation process to prevent the cryovials from exploding. Transfer the cell suspension from the cryovials to a 15mL centrifuge tube containing 5mL of complete culture medium. Centrifuge at 1000rpm for 3 minutes at room temperature, discarding the supernatant. Resuspend the centrifuged cell pellet in 1mL of complete culture medium, then seed all of the pellet into T75 culture flasks, adding 15mL of complete culture medium. Place the culture flasks in a 37°C, 5% CO2 incubator. Record the cell resuscitation process.

[0039] 1.2 Cell passage

[0040] Passage criteria: Cell density reaches 100%, cells are in good condition, passage every two days, and passage three times a week.

[0041] Remove the cell culture flask, discard the culture medium, add approximately 7 ml of PBS to rinse the cells, discard the PBS again, add 3 ml of trypsin digestion solution to the culture flask, and digest at 37°C for 2 minutes. When the cells flow down in a sandy manner, add 4 ml of complete culture medium to stop the digestion. Mix the cells thoroughly and transfer them to a 15 ml centrifuge tube. Centrifuge at 1000 rpm for 3 minutes at room temperature, discard the supernatant, and resuspend the cells in 3 ml of complete culture medium. Count the cells and determine their viability. Transfer the cells to three T75 flasks, add 15 ml of complete culture medium, mix the cells, and incubate at 37°C. Record the cell culture and passage procedures.

[0042] 1.3 Cell cryopreservation

[0043] Cell cryopreservation solution should be prepared fresh for each use. The composition and volume ratio of the cell cryopreservation solution are: culture medium: serum: DMSO = 4:5:1. When the cell density reaches 95-100% and the cells are in good condition, digest and centrifuge the cells normally, then resuspend them in the cryopreservation solution. Count the cells using a cell counter, and adjust the cell density to 5 × 10⁶ cells / mL using the cryopreservation solution. 6 Cells / ml

[0044] 2. Virus culture, harvesting, and titration

[0045] 2.1 Cultivation

[0046] HEp-2 cell suspension was seeded into 12-well plates at a density of 2.5 × 10⁶ cells / well. 5 Cells / mL / well were incubated overnight (18h±3h) at 37℃ in a 5% CO2 incubator until a monolayer was formed. The viral strain to be amplified was thawed at room temperature and vortexed three times. The required amount of virus to be added was calculated based on a multiplicity of infection (MOI) of 0.1, and diluted using DMEM medium. MOI = virus titer (PFU / mL) × volume added to well (ml) / number of cells. A 12-well plate inoculated with cells was taken, the original medium was discarded, and 1 mL of diluted virus solution was added to each well. 1 mL of DMEM medium was added to the cell control wells. The plates were incubated at 37℃ in a 5% CO2 incubator.

[0047] 2.2 Harvest

[0048] Observe the cytopathic effect daily. When the cell pathogenesis reaches approximately 70% after 48-72 hours of culture (optimal around 60 hours), the cells are ready for harvest. Scrape the cells from the wells and collect them into centrifuge tubes. Freeze and thaw once at -80°C, then centrifuge at 1000 rpm for 3 minutes. Transfer the supernatant to new centrifuge tubes, mix well, and aliquot into 2ml cryovials (1ml per tube). Label the tubes and store at -80°C.

[0049] 2.3 Titration

[0050] HEp-2 cells to be passaged were divided into groups of 2 × 10⁻⁶. 4 Cells were seeded at 100 μL per well in a 96-well plate and incubated overnight at 37°C in a 5% CO2 cell incubator. The virus was serially diluted 10-fold (10 μL / well) with maintenance medium. -1 ~10 -10The virus was added to pre-coated 96-well plates and incubated at 37°C in a 5% CO2 cell culture incubator for 2 h for adsorption. A covering medium was prepared using 2×DMEM and 2.4% CMC at a 1:1 ratio, with 150 μL added to each well. The plates were then incubated at 37°C in a 5% CO2 incubator for 48 h. The culture medium was discarded, and 150 μL of 4% paraformaldehyde was added for fixation at room temperature for 15 min. The plates were washed three times with PBS, and 150 μL of 0.2% Triton X-100 was added for permeabilization for 15 min, followed by three washes with PBS. 150 μL of 2% BSA was added for blocking for 30 min, followed by three washes with PBS. Finally, 100 μL of 1 μg / mL Palivizumab primary antibody was added, and the plates were incubated at 37°C for 1 h, followed by three washes with PBS. Add 100 μL of 1 μg / mL HRP-labeled goat anti-human IgG secondary antibody, incubate at 37°C for 1 h, and wash 3 times with PBS; add 50 μL of TrueBlue chromogenic solution until the spots are clear, wash twice with pure water, and invert to air dry. Viral titer (PFU) = maximum dilution at which spots appear * number of spots.

[0051] 3. Construction of a neonatal mouse model of human respiratory syncytial virus infection

[0052] SPF-grade healthy newborn BALB / c mice, regardless of sex, were selected as experimental subjects. Mice were nursed by their mothers and housed in individually ventilated IVC cages. All animal experimental procedures required approval from the institution's animal care and use committee.

[0053] The day of infection was recorded as day 0 (D0). Starting from day 1 post-infection (D1), the weight of each group of mice was measured at a fixed time every day for 7 consecutive days (D1-D7), and a weight change curve was plotted. The survival rate, mental state, respiratory rate, fur luster, and activity of the mice were observed and recorded daily.

[0054] From day 1 to day 7 post-infection, a number of mice were randomly selected, sacrificed, and their left lung tissue was aseptically harvested for viral plaque assay or RT-qPCR to detect viral load. The right lung was fixed with paraformaldehyde and stained with hematoxylin and eosin (HE) to observe pathological changes such as peribronchial and interstitial inflammatory cell infiltration and alveolar wall thickening, in order to comprehensively evaluate the success of the model construction.

[0055] The detection method is as follows:

[0056] 3.1 Sample Collection. First, newborn mice were deeply anesthetized with isoflurane, and whole blood was collected via cardiac puncture. Serum was separated for subsequent serological or cytokine detection. Mice were euthanized by cervical dislocation after blood collection, and dissection was performed under strict aseptic conditions. The nasal turbinate, lung, liver, and spleen were then separated sequentially. Specifically, the left lung tissue, nasal turbinate, and parts of the liver and spleen were rapidly frozen in liquid nitrogen and then transferred to a -80°C freezer for viral RNA extraction and load detection. The right lung tissue (ligated after tracheal perfusion with 4% paraformaldehyde) and parts of the nasal turbinate, liver, and spleen were fixed in 4% paraformaldehyde for at least 24 hours for paraffin embedding and sectioning.

[0057] 3.2 Pathogen molecular level detection (RT-qPCR)

[0058] Tissue samples (left lung, nasal turbinate, liver, and spleen) stored at -80℃ were thawed, added with TRIzol lysis buffer, and homogenized using a tissue homogenizer. Total RNA was extracted using the chloroform-isopropanol method and amplified by real-time quantitative PCR using the TaqMan probe method. The RSV RNA copy number per gram of tissue was calculated using a standard curve to assess the viral replication level.

[0059] RSV-A F: 5'CAACATTGAGATAGAATCTAGAAAATCCTACA 3';

[0060] RSV-A R: 5'ATTTTGGTTATTACTAATGCYGCTATACA 3';

[0061] RSV-A Probe: TGGCTCCAGAATACAGGCATGACTCTCC 5`6-FAM, 3`TAMRA.

[0062] 3.3 Histopathological examination (HE staining and pathological scoring)

[0063] The fixed right lung, nasal turbinate, liver, and spleen tissues were routinely dehydrated, cleared, paraffin-embedded, and embedded. Sections were 4-5 μm thick, mounted, and baked. Hematoxylin-eosin (HE) staining was performed, following these steps: dewaxing with xylene, hydration with graded ethanol, hematoxylin staining for 5-10 minutes, differentiation with hydrochloric acid ethanol, blueing with ammonia, eosin staining for 1-3 minutes, dehydration with graded ethanol, clearing with xylene, and mounting with neutral resin. Histopathological changes were observed under a light microscope. Key observations included: peribronchial and perivascular inflammatory cell infiltration (mainly lymphocytes) in the lung tissue, thickening of the alveolar septa, alveolar exudation, and interstitial edema.

[0064] 4. Optimization of model building conditions

[0065] 4.1 Optimization of the age of newborn mice

[0066] Six SPF-grade newborn BALB / c mice were selected at days 1, 3, 5, and 7 after birth, respectively. They were administered the same dose (1×10⁻⁶) via intranasal instillation. 4.5 PFU / animal human respiratory virus suspension, inoculated at a volume of 10 μL / animal. Observe continuously for 7 days post-infection, recording changes in weight, clinical symptoms (such as arched back, piloerection, and rapid breathing), survival rate, and viral load in the lungs.

[0067] 4.2 Optimization of virus inoculation dosage

[0068] Using 3-day-old newborn mice and nasal instillation as fixed conditions, different inoculation dose groups were set up: 1×10 3 1×10 3.5 1×10 4 1×10 4.5 1×10 5 1×10 5.5 1×10 6 PFU / animal, with a blank control (PBS). Weight changes were recorded within 5 days post-infection.

[0069] 4.3 Optimization of virus inoculation routes

[0070] Three-day-old SPF-grade neonatal BALB / c mice were used as subjects to compare three vaccination routes: intranasal instillation (10 μL / mouse), intraperitoneal injection (50 μL / mouse), and gavage (50 μL / mouse). The fixed vaccination dose was 1×10⁻⁶. 4.5 PFU / animal, record the viral load in the lungs on day 5 post-infection.

[0071] 5. Results

[0072] 5.1 See Figure 1 One-day-old mice showed the most significant weight loss after infection, with considerable individual variation; three-day-old mice showed stable symptoms, minimal weight loss, moderate viral load in the lungs, and good reproducibility; mice aged 5-7 days and older showed only slight weight loss after infection. Considering both model stability and operability, the optimal age for newborn mice was determined to be 3 days.

[0073] 5.2 See Figure 2 The infection dose is 1×10 3 PFU / only with 1×10 3.5 PFU / mouse in both groups of mice showed no obvious clinical symptoms, the viral load in the lungs remained at a low level, there was no statistically significant difference in body weight, and the infection intensity was insufficient; the infection dose was 1×10⁻⁶. 4 In the PFU / animal group, only mild weight loss was observed, with no typical pathological changes, indicating insufficient infection; the infection dose was 1×10⁻⁶.4.5 Mice in the PFU / mouse group showed some degree of weight loss, increased viral load in the lungs, and pathological changes ranging from mild to moderate; the infection dose was 1×10⁻⁶. 5 PFU / only with 1×10 5.5 PFU / mouse in both groups resulted in a 15%–20% decrease in body weight and the development of typical interstitial pneumonia pathological changes in the lungs; 1×10 6 Mice in the PFU / mouse group experienced a weight loss of >30%, indicating excessively high infection rates and a high likelihood of significant individual variability within the model. Considering both infection efficiency and model stability, the optimal inoculation dose was determined to be 1×10⁻⁶ for effective and reproducible infection. 4.5 PFU / each.

[0074] See 5.3 Figure 3 Mice infected via nasal instillation exhibited typical respiratory symptoms (increased respiratory rate, pathological changes in lung tissue), with the highest viral titer observed in the lungs (reaching 10). 6 (Copies / g); intraperitoneal injection mainly caused a systemic inflammatory response, with a positive rate of only 30% for virus isolation from the lungs; the gavage group showed almost no respiratory symptoms, and the virus was detected only in the intestines of some mice. Therefore, nasal instillation was determined to be the optimal route of inoculation.

[0075] See 5.4 Figure 4 RSV infection 1×10 4.5 After PFU / animal infection, the viral RNA load in lung tissue initially increased rapidly, reached a peak, and then gradually decreased. Specifically, the viral load reached 5 Logs on days 2 to 5 post-infection. 10 The presence of copies / g or higher indicates that 3-day-old BALB / c newborn mice are highly susceptible to RSV, consistent with the virological characteristics of acute RSV infection.

[0076] See 5.5 Figure 5 and Figure 6 RSV infection 1×10 4.5 From day 3 to day 5 post-PFU administration, the lung tissue pathology scores all reached 5 or higher. Furthermore, pathological observation of the lung tissue showed severe structural abnormalities from day 3 to day 5 post-infection, and extensive inflammatory cell infiltration was observed in the tissue from day 4 to day 5 post-infection. These findings indicate that the human respiratory syncytial virus (RSV) infection model in newborn mice was successfully established.

[0077] 6. Stability test

[0078] Parallel modeling was performed on 30 three-day-old SPF-grade neonatal BALB / c mice from the same batch, with an intranasal drop dose of 1×10⁻⁶. 4.5PFU / animal, and viral load in lung tissue was measured on day 5 post-infection. The results showed that the coefficient of variation (CV%) of the logarithmic viral titer was 12.3%, indicating that the model has high stability and reproducibility, and provides a reliable technical platform for the screening and evaluation of antiviral drugs.

[0079] Example 1: Pharmacodynamic evaluation of small molecule drugs in a human respiratory syncytial virus (RSV) neonatal mouse infection model.

[0080] Construction of a human respiratory syncytial virus (RSV) infection model in newborn mice and administration of the drug to the control group

[0081] Thirty-six 3-day-old BABL / C mice were selected and divided into six groups, G1-G6. G1 served as the saline control group, receiving an equal volume of saline solution intranasally. G2-G6 represented the RSV model group, high-dose drug group, medium-dose drug group, low-dose drug group, and the positive control group (Ziresovir). Groups G2-G6 received 10 μL of RSV virus solution intranasally each time, at a concentration of 10... 4.5 PFU was administered via challenge; body weight was measured for 7 days afterward; G1-G2 mice were administered an equal volume of physiological saline via gavage; G3-G6 mice were administered 50 μL via gavage, with high-dose groups receiving 50 mg / kg, medium-dose groups receiving 25 mg / kg, and low-dose groups receiving 10 mg / kg. Newborn mice were isolated from their mothers and fasted for 2 hours before administration. Five days later, the newborn mice were euthanized, and lung tissue and nasal turbinate bones were collected.

[0082] 1. Detection of viral load in lung tissue and nasal turbinate bones

[0083] Table 1. Average viral load in mice

[0084]

[0085] 2. Lung tissue pathological examination

[0086] Table 2. Average pathological scores of mouse lung tissue

[0087]

[0088] according to Figure 10 The pathological results of lung tissue in each group are as follows:

[0089] G1: The lung tissue structure is basically normal, the alveolar outlines are clear and the structure is intact, and no obvious thickening of the alveolar walls is seen; the bronchial epithelial cells are tightly arranged and no obvious cell shedding is seen; the vascular smooth muscle fiber structure is clear; no obvious inflammatory cell infiltration is seen in the tissue.

[0090] G2: Severe abnormalities in lung tissue structure, atrophy of alveolar contour structure, and obvious thickening of alveolar walls; a small amount of protein mucus is visible in the bronchial lumen, and a large number of epithelial cells are sloughed off; the vascular smooth muscle fiber structure is clear; and a large number of inflammatory cells are infiltrated in the tissue.

[0091] G3: Mild abnormalities in lung tissue structure, clear alveolar outlines, intact structure, slight thickening of alveolar walls; tightly packed bronchial epithelial cells with no obvious cell shedding; clear vascular smooth muscle fiber structure; no obvious inflammatory cell infiltration in the tissue.

[0092] G4: Moderate abnormalities in lung tissue structure, atrophy of alveolar contour structure, and a small amount of pink serous exudate visible in local alveoli; bronchial epithelial cells are neatly and tightly arranged; vascular smooth muscle fiber structure is clear; a small amount of inflammatory cell infiltration is visible in the tissue.

[0093] G5: Severe abnormalities in lung tissue structure, atrophy of alveolar contour structure, and obvious thickening of alveolar walls; a small amount of protein mucus is visible in the bronchial lumen, and a large number of epithelial cells are sloughed off; the vascular smooth muscle fiber structure is clear; a small amount of inflammatory cell infiltration is visible in the tissue.

[0094] G6: Moderate abnormalities in lung tissue structure, atrophy of alveolar contour structure, and significant thickening of alveolar walls; extensive shedding of epithelial cells in the bronchi; clear vascular smooth muscle fiber structure; and extensive infiltration of inflammatory cells in the tissue.

[0095] The above results indicate that this invention has successfully constructed a stable, reliable, and pathologically typical human respiratory syncytial virus (RSV) infection model in newborn mice. This model can realistically simulate the clinical and pathological manifestations of natural human RSV infection and has good responsiveness to small molecule drugs, providing a standardized animal model for RSV-related basic research, drug development, and vaccine evaluation.

[0096] Experimental Example 2: Evaluation of the protective effect of the vaccine against a newborn mouse model of human respiratory syncytial virus infection.

[0097] Eighteen mature BALB / c female mice were selected and divided into six groups (G1-G6): G1 (saline control group), G2 (RSV model group), G3 (high-dose vaccine group), G4 (medium-dose vaccine group), G5 (low-dose vaccine group), and G6 (Arexvy positive vaccine control group). Primary and secondary immunizations were administered via injection of 50 μL into each leg on days 0 and 21, respectively (high-dose group: 24 μg; medium-dose group: 12 μg; low-dose group: 6 μg; positive vaccine group: 12 μg). Females were paired with males on day 14, and births occurred around day 35. Antibodies were transferred to newborn mice via breast milk and the placental barrier. Three days after birth, three newborn mice were kept from each female. Mice in group G1 received an equal volume of saline solution intranasally, while mice in groups G2 to G6 received 10 μL of RSV virus solution intranasally each time, at a dose of 10 μL.4.5 The mice were attacked with a dose of PFU. Five days later, the newborn mice were euthanized, and lung tissue and nasal turbinate bones were collected.

[0098] 1. Detection of viral load in lung tissue and nasal turbinate bones

[0099] Table 3. Average viral load in mice

[0100]

[0101] 2. Lung tissue pathological examination

[0102] Table 4. Average pathological scores of mouse lung tissue

[0103]

[0104] according to Figure 14 The pathological results of lung tissue in each group are as follows:

[0105] G1: The lung tissue structure is basically normal, with local alveolar atrophy and alveolar wall thickening in the field of view; the bronchial epithelial cells are neatly and tightly arranged, with no shedding; no obvious inflammatory cell infiltration is seen in the tissue.

[0106] G2: Severe abnormalities in lung tissue structure, local alveolar atrophy and alveolar wall thickening in the field of vision; a small number of bronchial epithelial cells detached; extensive tissue hemorrhage; red blood cells visible in the alveoli and bronchial lumen; and a small number of inflammatory cell infiltrations.

[0107] G3: The lung tissue structure is basically normal, with local alveolar atrophy and alveolar wall thickening in the field of view; the bronchial epithelial cells are neatly and tightly arranged, with no shedding; no obvious inflammatory cell infiltration is seen in the tissue.

[0108] G4: Moderate abnormalities in lung tissue structure, with localized alveolar atrophy and mild thickening of alveolar walls in the field of view; bronchial epithelial cells are neatly and tightly arranged without shedding; a large number of inflammatory cells are infiltrated in the tissue.

[0109] G5: Severe abnormalities in lung tissue structure, with localized alveolar atrophy and alveolar wall thickening in the field of vision; extensive shedding of bronchial epithelial cells; and extensive infiltration of inflammatory cells in the tissue.

[0110] G6: Moderate abnormalities in lung tissue structure, with localized alveolar atrophy and alveolar wall thickening in the field of vision; a small number of bronchial epithelial cells sloughed off; and a large number of inflammatory cells infiltrated in the tissue.

[0111] The above results indicate that this invention has successfully constructed a stable, reliable, and pathologically typical human respiratory syncytial virus (RSV) infection model in newborn mice. This model can realistically simulate the clinical and pathological manifestations of natural human RSV infection and has a good response to vaccine intervention, providing a standardized animal model for RSV-related basic research, drug development, and vaccine evaluation.

[0112] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for constructing a neonatal mouse model of human respiratory syncytial virus infection, characterized in that, The method includes: inoculating SPF-grade healthy BALB / c newborn mice on the 3rd day after birth with a viral solution containing human respiratory syncytial virus (RSV) via intranasal drip, and obtaining the human respiratory syncytial virus newborn mouse infection model 4-5 days later.

2. The method for constructing a neonatal mouse model of human respiratory syncytial virus infection according to claim 1, characterized in that, The RSV viral load in the viral fluid is 10^4.5 PFU.

3. The method for constructing a neonatal mouse model of human respiratory syncytial virus infection according to claim 1, characterized in that, The method for preparing the viral fluid includes: culturing and amplifying the RSV strain using HEp-2 cells, and obtaining the viral fluid after harvesting and processing.

4. The method for constructing a neonatal mouse model of human respiratory syncytial virus infection according to claim 3, characterized in that, The RSV strain in question is RSV-A2.

5. A human respiratory syncytial virus (RSV) infection model in newborn mice, characterized in that, It is constructed by the method of any one of claims 1-4.

6. The application of the human respiratory syncytial virus neonatal mouse infection model as described in claim 5 in the efficacy evaluation of anti-infective drugs and the protective evaluation of preventive vaccines.