Statistical methods for in situ collection of marine cyanobacterial symbionts and free-living cyanobacteria

By combining multiple gradient filtration and flow cytometry cell sorting, the problem of separating and statistically analyzing cyanobacterial symbiotic systems from free cyanobacteria was solved, achieving the removal of interference from eukaryotic algae and the elimination of pseudo-symbiotic systems, thus ensuring the accuracy of the in-situ state and quantity ratio of cyanobacterial symbiotic systems.

CN122256138APending Publication Date: 2026-06-23TIANJIN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TIANJIN UNIV
Filing Date
2026-03-23
Publication Date
2026-06-23

Smart Images

  • Figure CN122256138A_ABST
    Figure CN122256138A_ABST
Patent Text Reader

Abstract

The application discloses a method for in-situ collection and statistics of marine cyanobacterial symbiotic system and free cyanobacteria, which comprises the following steps: firstly, multiple gradient filtration pretreatment is performed on seawater samples, and the samples are sequentially filtered through 5 μm, 3 μm (including secondary filtration and slight ultrasonic) and 0.22 μm filter membranes, so that the samples are preliminarily separated according to particle sizes and different samples are obtained, and false symbiotic systems are removed; then, flow cytometry sorting is performed, eukaryotic algae interference is removed according to the differences of five light signals of FSC, SSC, APC, PE and PerCP-cy5.5, and symbiotic cyanobacteria, symbiotic heterotrophic bacteria and free cyanobacteria are sorted out; and the sorting results can be verified through 16S amplicon sequencing. The application does not intervene in biochemistry in the whole process, can keep the original state and natural proportion of microorganisms to the maximum extent, and realizes in-situ, accurate separation and statistics of marine cyanobacterial symbiotic system and free cyanobacteria.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of environmental microbiology and marine microbial detection technology, and in particular to an in-situ collection, isolation and statistical method for marine cyanobacterial symbiotic systems and free cyanobacteria. Background Technology

[0002] In natural water bodies and marine environments, bacteria acquire antibiotic resistance through various pathways to adapt to higher antibiotic concentrations. Among these, acquiring antibiotic resistance genes (hereinafter referred to as resistance genes) is a significant reason for developing resistance. Bacteria do not only acquire resistance through their own mutations but can also directly acquire ready-made resistance genes from other microorganisms or the environment: contact with other bacteria, free DNA in the environment, and the mediation of factors such as plasmids, vesicles, and bacteriophages. These are all referred to as the "horizontal transfer" of resistance genes.

[0003] Marine cyanobacteria (also known as blue-green algae) are widely distributed in the environment as major contributors to primary production. Furthermore, due to their prokaryotic nature, they can more easily exchange genes with other heterotrophic bacteria, making cyanobacteria valuable for research in areas such as resistance genes, antibacterial substances, and microplastics. Cyanobacteria can carry a large number of resistance genes and possess the ability to transfer these genes to other bacteria through various mechanisms.

[0004] Cyanobacteria can also secrete extracellular secretions containing polysaccharides (nutrients), forming an "inter-algal environment" around the cyanobacterial body. This environment can attract other heterotrophic bacteria, thus forming an inter-algal symbiotic system of cyanobacteria and heterotrophic bacteria within this "inter-algal environment." Existing research suggests that the cyanobacterial-heterotrophic bacterium inter-algal symbiotic system (hereinafter referred to as the cyanobacterial symbiotic system) may be a hotspot for horizontal transfer of resistance genes. However, the above speculation lacks direct empirical research on this symbiotic system in the natural environment. To verify this viewpoint, it is necessary to understand the proportion of cyanobacterial symbiotic systems in the total number of cyanobacteria in the marine environment (symbiotic / (symbiotic + free)), and maintain this proportion for subsequent statistical analysis of resistance genes in the symbiotic system. To accomplish this work, in-situ collection and statistical analysis of symbiotic systems in the marine environment are essential.

[0005] Microbial collection and statistical analysis in marine environments is a well-established technique. However, in-situ collection and statistical analysis of cyanobacterial symbiotic systems in marine environments has been rarely explored. This is because directly applying existing sampling techniques can disrupt the symbiotic structure (chemical and biological processes can destroy it), and it is difficult to maintain the in-situ state (expanded cultivation can disrupt the proportion of the symbiotic system in the water). More importantly, existing sampling techniques cannot separate the symbiotic system from free bacteria while preserving the in-situ symbiotic structure and quantity. To study the horizontal transfer of resistance genes in environmental cyanobacterial symbiotic systems and deepen our understanding of resistance gene propagation in the environment, it is essential to develop an in-situ collection and statistical analysis method for environmental cyanobacterial symbiotic systems.

[0006] Flow cytometry sorting is a widely used technique. Its basic principle can be understood as follows: tiny particles in water are passed one by one through a detection area, and they are counted or grouped based on their size, shape, and whether they emit specific light signals. In environmental microbiology research, this technique is often used to distinguish microorganisms of different sizes, such as differentiating between bacteria and microalgae, or to count the number of a particular type of microorganism.

[0007] In practical applications, flow cytometry sorting typically uses "single cells" as the most basic analytical object, assuming that each detected particle corresponds to an independent microbial individual, and classifies or sorts them accordingly. However, in natural marine environments, cyanobacteria often do not exist in a completely independent form, but rather attach together with other heterotrophic bacteria, forming a symbiotic system composed of multiple microorganisms.

[0008] Because cyanobacterial symbiotic systems can be similar in size to individual cyanobacterial cells, relying solely on particle size for differentiation can easily misclassify "small-scale symbiotic systems" as "free individual cyanobacteria," leading to the symbiotic system being overlooked during collection. Furthermore, existing flow cytometry sorting methods typically require sample staining, fixation, or other treatments, which can disrupt the original binding relationship between cyanobacteria and heterotrophic bacteria, making it difficult to maintain their in-situ state in the natural environment.

[0009] Therefore, although existing flow cytometry sorting technology is suitable for routine statistics and sorting of microorganisms, it still has significant limitations in distinguishing and collecting symbiotic systems from free cyanobacteria without destroying the symbiotic structure of cyanobacteria and while maintaining their natural population proportions.

[0010] In summary, the defects of the existing technology include: 1) Because there are a considerable number of small eukaryotic algae forming symbiotic systems in the water, it is impossible to distinguish the eukaryotic algae symbiotic systems simply by particle size, which will interfere with the statistics and analysis of cyanobacterial symbiotic systems.

[0011] 2) Using only 3μm as the boundary between symbiosis and free is too simplistic. Many of the "symbiotic samples" after this treatment are "pseudo-symbiotic systems" that are formed temporarily and accidentally during the treatment process. They need to be redesigned based on the actual situation. Summary of the Invention

[0012] This invention aims to solve the technical problems in the prior art, such as the inability to accurately separate and count cyanobacterial symbiotic systems and free cyanobacteria while maintaining them in situ, as well as the interference from eukaryotic algae and misjudgment of pseudo-symbiotic systems. It proposes an in-situ collection and statistical method for marine cyanobacterial symbiotic systems and free cyanobacteria, which adopts a scheme design of multiple gradient filtration combined with flow cytometry cell sorting. The entire process is physical operation, and the cyanobacteria are separated into symbiotic and free states according to particle size. Fluorescence signals are used to remove interference from eukaryotic algae, so as to achieve in-situ collection and statistics.

[0013] To achieve the above-mentioned objectives, the present invention proposes the following technical solution: This invention proposes an in-situ collection and statistical method for marine cyanobacterial symbiotic systems and free cyanobacteria, including multiple pretreatment filtration steps and flow cytometry sorting steps. The entire collection and statistical process is completed solely through physical processes, without introducing any biological or chemical factors. The multiple filtration steps include: Step 1: Collect seawater samples, filter them through a 320-mesh steel sieve to remove impurities, and then filter them through a 5μm filter membrane. The particles trapped on the 5μm filter membrane are resuspended in sterile PBS to obtain a 5μm sample. Step 2: Filter the filtrate from Step 1 through a 3μm filter membrane. Resuspend the particles trapped on the 3μm filter membrane in sterile PBS and then sonicate them lightly. Filter the resuspended liquid through a 3μm filter membrane again. Resuspend the particles trapped on the 3μm filter membrane a second time in sterile PBS to obtain a 3μm sample. Step 3: Filter the filtrate from the second 3μm filtration in Step 2 through a 0.22μm filter membrane. Resuspend the particles trapped on the 0.22μm filter membrane in sterile PBS to obtain a 0.22μm sample. The flow cytometry sorting step includes: processing the 5μm, 3μm, and 0.22μm samples through a 40μm cell filter before loading them onto the flow cytometry instrument. Five light signals, FSC, SSC, APC, PE, and PerCP-cy5.5, are selected as detection indicators. Eukaryotic algae are sorted and removed based on the light signal characteristics. Marine cyanobacterial symbiotic systems and free cyanobacteria are counted and collected separately. The sorting results are verified by 16S amplicon sequencing.

[0014] In some embodiments, in step 1, the impurities include silt and large eukaryotic algae in the water; the specific operation of resuspension is to collect the filter membrane in a 50ml centrifuge tube, add 50ml of sterile PBS and shake until all particles on the filter membrane are transferred to sterile PBS, discard the filter membrane to obtain the corresponding sample, and store the samples in a 4℃ refrigerator for flow cytometry.

[0015] In some embodiments, the role of mild sonication in step 2 is to redisperse the free cyanobacteria that have accidentally bound together during the filtration process, while preserving the naturally formed, tightly bound cyanobacterial symbiotic system in the environment.

[0016] In some embodiments, during the flow cytometry sorting step, the optical signal characteristics of eukaryotic algae are positive for PerCP-cy5.5 signal, while both APC and PE signals are negative.

[0017] In some embodiments, during the flow cytometry sorting step, the optical signal characteristics of cyanobacteria are positive for PerCP-cy5.5 signal and at least one of APC and PE signals; the optical signal characteristics of heterotrophic bacteria are negative for PerCP-cy5.5 signal.

[0018] In some implementations, when sorting 5μm and 3μm samples by flow cytometry, particles that are positive for PerCP-cy5.5 signal and at least one of APC and PE signals are collected as symbiotic cyanobacteria, and particles that are negative for PerCP-cy5.5 signal are collected as symbiotic heterotrophic bacteria, thus completing the collection and statistics of the marine cyanobacterial symbiotic system.

[0019] In some implementations, when sorting 0.22 μm samples by flow cytometry, particles that are positive for PerCP-cy5.5 signal and at least one of APC and PE signals are collected as free cyanobacteria, thus completing the collection and statistics of free cyanobacteria.

[0020] In some embodiments, the 5 μm sample contains a symbiotic system formed by large cyanobacteria, the 3 μm sample contains a symbiotic system formed by smaller cyanobacteria, and the 0.22 μm sample contains free small cyanobacteria and free heterotrophic bacteria.

[0021] In some embodiments, during the flow cytometry sorting step, when sorting the 5μm and 3μm samples, a fluorescence signal-based gating strategy is executed to sort the target microorganisms. When sorting the 5μm and 3μm samples, a two-level gating strategy is implemented: the first level of gating is based on the PerCP-Cy5.5-A signal and the side-scattered light signal to delineate the target population containing chlorophyll from the total events; the second level of gating is based on the APC-A signal and the PE signal to sort particles from the target population that are positive for PerCP-Cy5.5-A signal and at least one of APC-A and PE signals as symbiotic cyanobacteria, and exclude eukaryotic algal particles that are positive for PerCP-Cy5.5-A signal but negative for both APC-A and PE signals. When sorting the 0.22μm samples, the same second-level gating criteria were used directly, namely, based on the PerCP-Cy5.5-A, APC-A and PE signals. Particles that were positive for PerCP-Cy5.5-A signal and at least one of APC-A and PE signals were sorted and collected as free cyanobacteria.

[0022] Compared with the prior art, the beneficial effects of the technical solution of the present invention are: 1) Optimize the design of the single 3μm particle size boundary line in the existing technology, and combine the actual distribution characteristics of marine cyanobacteria to propose a multi-gradient filtration method of 5μm + two 3μm + 0.22μm, which can effectively eliminate pseudo-symbiotic systems.

[0023] 2) Introducing flow cytometry cell sorting technology and designing a targeted five-signal gating strategy to completely remove interference from eukaryotic algae by utilizing differences in fluorescence characteristics, thus overcoming the application limitations of conventional flow cytometry sorting which focuses on single cells as the analysis object.

[0024] 3) Based on the requirements of in-situ detection, a complete physical operation plan is designed to avoid the introduction of biological and chemical factors, minimize the damage to cyanobacteria and their symbiotic system, and achieve in-situ collection and statistics.

[0025] 4) While maintaining the in-situ structure of the cyanobacterial symbiotic system and without disrupting its natural abundance in the marine environment, we can achieve effective separation and accurate statistics of the cyanobacterial symbiotic system and free cyanobacteria, providing reliable samples and data support for verifying the hypothesis that "the cyanobacterial symbiotic system is a hotspot for horizontal transfer of resistance genes". Attached Figure Description

[0026] Figure 1 This is a schematic diagram of the process for the in-situ collection and statistical method of the marine cyanobacterial symbiotic system and free cyanobacteria of the present invention.

[0027] Figure 2 This is a schematic diagram of an embodiment of a streaming sorting gating strategy.

[0028] Figure 3 This is a schematic diagram of the second embodiment of the flow sorting gating strategy.

[0029] Figure 4 This is a schematic diagram illustrating PCR amplification conditions.

[0030] Figure 5 This is a technical roadmap for a specific embodiment of the present invention.

[0031] Figure 6 This is a schematic diagram of the separation and collection process of bacteria in natural water bodies in symbiotic and free states in existing technologies.

[0032] Figure 7 This is a schematic diagram of the algal symbiotic system. Detailed Implementation

[0033] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0034] like Figure 1 The diagram illustrates an in-situ collection and statistical method for a marine cyanobacterial symbiotic system and free cyanobacteria, comprising multiple pretreatment filtration steps and flow cytometry sorting steps. The entire collection and statistical process is completed solely through physical processes, without introducing any biological or chemical factors. The multiple filtration steps include: Step 1: Collect seawater samples, filter them through a 320-mesh steel sieve to remove impurities, and then filter them through a 5μm filter membrane. The particles trapped on the 5μm filter membrane are resuspended in sterile PBS to obtain a 5μm sample. Specifically, the process parameters for a single filtration operation are set as follows: the recommended operating vacuum level is 0.08 MPa, and the recommended pumping rate is 10 L / min. Note that the actual flow rate will dynamically change due to the degree of filter membrane clogging. To prevent system overload or damage, the critical warning value for the vacuum level during operation must not exceed 0.098 MPa.

[0035] Step 2: Filter the filtrate from Step 1 through a 3μm filter membrane. Resuspend the particles trapped on the 3μm filter membrane in sterile PBS and then sonicate them lightly. Filter the resuspended liquid through a 3μm filter membrane again. Resuspend the particles trapped on the 3μm filter membrane a second time in sterile PBS to obtain a 3μm sample. Specifically, the process parameters for the secondary filtration operation are set as follows: the recommended operating vacuum level is 0.08 MPa, and the recommended pumping rate is 10 L / min. It should be noted that the actual flow rate will dynamically change depending on the degree of filter membrane clogging. To prevent filter membrane clogging or damage to the symbiotic system structure, the critical warning value for the vacuum level during operation must not exceed 0.098 MPa.

[0036] Specifically, the specifications for mild ultrasonic treatment and core equipment consumables are as follows: For mild ultrasound treatment, it is recommended to use a continuous ultrasound mode with a frequency of 35KHz and a duration of 5min.

[0037] Filter membrane specifications: The 5μm, 3μm and 0.22μm filter membranes used are all made of nylon and must be sterile.

[0038] Flow cytometer configuration: The instrument model is BD Aria III from BD Corporation, USA; the core configuration should include three lasers with wavelength ranges of 470-490nm, 625-645nm and 355-375nm respectively, and a nozzle with an aperture of 85μm.

[0039] Buffer solution and pre-filtration: The sterile PBS was prepared to a specification of 0.01 mol / L, pH 7.4; pre-filtration was performed using a 320-mesh steel sieve with a pore size of approximately 47 μm or a nylon cell filter with a pore size of 40 μm.

[0040] Step 3: Filter the filtrate from the second 3μm filtration in Step 2 through a 0.22μm filter membrane. Resuspend the particles retained on the 0.22μm filter membrane in sterile PBS to obtain a 0.22μm sample. The flow cytometry sorting step includes: processing the 5μm, 3μm, and 0.22μm samples through a 40μm cell filter before loading them into the flow cytometry system. Fluorescence signals detected by five channels—FSC, SSC, APC, PE, and PerCP-cy5.5—were selected as detection indicators. Eukaryotic algae were sorted and removed based on their optical signal characteristics. Marine cyanobacterial symbiotic systems and free cyanobacteria were statistically analyzed and collected. The sorting results were verified by 16S rRNA amplicon sequencing.

[0041] Specifically, the criteria for judging the dispersion effect after mild ultrasound are as follows: There is no absolute standard; the standard is that the main symbiotic structures in the sample show no obvious breakage under microscopic examination before and after ultrasonic treatment.

[0042] like Figure 2 The diagram shown is a schematic representation of an embodiment of a flow cytometry sorting gating strategy. It demonstrates a two-step sorting strategy for 5μm and 3μm samples, accurately distinguishing different microbial communities based on fluorescence signals.

[0043] (2a) and (2c): First-step gating (high chlorophyll screening) Scatter plots of 5μm and 3μm samples with PerCP-Cy5.5-A (chlorophyll fluorescence) and SSC-A (particle complexity) as coordinates are shown. This gating step effectively delineates all target populations of chlorophyll-containing autotrophic microorganisms from the total background events.

[0044] (2b) and (2d): Second-step gating (phycobiliprotein identification and sorting) Based on the population identified in the first step, fine sorting was performed using the fluorescence intensity of the APC-A and PE channels, respectively. See the figure below (especially in the image). Figure 2 d) Populations with double negative APC-A and PE signals and located in the low fluorescence intensity region were identified as eukaryotic algae, accounting for only 0.20%; while populations with significant positive APC-A and / or PE signals and high fluorescence intensity were identified as symbiotic bacteria, accounting for as high as 99.8%. This result directly proves that this method, through pretreatment and specific gating, can efficiently remove interference from eukaryotic algae and successfully enrich symbiotic systems centered on cyanobacteria.

[0045] Furthermore, in the first phylum of some samples (such as 3μm samples), a population that is PerCP-Cy5.5-A negative but has specific scattered light characteristics can be observed; this is the target symbiotic heterotrophic bacteria. This population can be further phylogenized and sorted using independent combinations of fluorescence signals (such as all algal fluorescence channels being negative), thereby obtaining the complete microbial composition of the symbiotic system.

[0046] In the flow cytometry analysis of this invention, the suffix "-A" in the signal name represents the integration area of ​​the signal in that channel. Therefore, the PerCP-Cy5.5-A signal and the APC-A signal refer to the integrated fluorescence signals detected from the PerCP-Cy5.5 channel and the APC channel, respectively.

[0047] like Figure 3 The diagram shows a schematic of Example 2 of the flow cytometry gating strategy. (3a) 0.22μm sample, first step valve (chlorophyll), (3b) 0.22μm sample, second step valve (free cyanobacteria), which intuitively demonstrates a key example of a two-stage gating strategy in flow cytometry cell sorting.

[0048] (3a) Chlorophyll gating design: Using PerCP-Cy5-5-A (chlorophyll fluorescence) and SSC-A (granule internal complexity) as coordinates, autotrophic biological populations containing chlorophyll were delineated from the total events. Events within this phylum accounted for 0.59% of the total events, which is the target analysis object.

[0049] (3b) Cyanobacterial sorting design: Based on the population within phylum (3a), further subdivision was performed using APC-A and PE(S671)-A (both characteristic fluorescence signals of cyanobacterial phycobiliproteins) as coordinates. The blue dot clusters in the figure represent free-living cyanobacteria. The target cells ultimately sorted using this strategy were all double-positive for both APC-A and PE(S671)-A fluorescence signals. This example clearly demonstrates how to accurately identify and quantify target microbial communities from complex environmental samples through a two-step fluorescence signal combination.

[0050] In principle, based on a signal strength greater than 10 3The standard for determining a positive result is as follows: However, because pretreatment and transportation processes take a certain amount of time, the activity of microorganisms in the sample gradually decreases and the light signal gradually quenches. Therefore, the standard (gate) can be appropriately shifted towards the origin (0,0) and the gate can be defined in combination with the clustering situation (clustering).

[0051] In summary: For 5μm samples: These samples may contain larger particles and eukaryotic algae. In flow cytometry sorting, gating was primarily designed based on chlorophyll autofluorescence and phycobiliprotein fluorescence signals (APC / PE). First, autotrophic biological populations were screened using chlorophyll signals. Then, based on whether they simultaneously exhibited phycobiliprotein fluorescence, chlorophyll-positive and phycobiliprotein-positive populations were identified as target cyanobacteria. Meanwhile, chlorophyll-negative populations were sorted as potential symbiotic heterotrophic bacteria for subsequent symbiotic system studies. Chlorophyll-positive and phycobiliprotein-negative populations (mainly eukaryotic algae) were excluded to reduce background interference in subsequent analyses.

[0052] For 3μm samples: These samples underwent secondary filtration and mild sonication to more accurately capture cyanobacterial symbiotic systems. The sorting strategy was further refined based on that for 5μm samples. In addition to distinguishing between cyanobacteria and eukaryotic algae, the strategy focused on differentiating between symbiotic cyanobacteria (present in the symbiotic system) and free-living cyanobacteria (with relatively weaker signals) from the cyanobacterial population based on differences in forward scattering (FSC, reflecting particle size) and side scattering (SSC, reflecting particle complexity) signals. Simultaneously, chlorophyll-negative populations were sorted as potential symbiotic heterotrophic bacteria for subsequent symbiotic system studies.

[0053] For the 0.22 μm sample: This sample mainly contains microorganisms with a particle size smaller than 0.22 μm, and the sorting target is free-state cyanobacteria. The sorting strategy employs a two-step fluorescence gating method: First, a first-step gating is performed based on the PerCP-Cy5.5-A (chlorophyll fluorescence) signal to screen out autotrophic microbial communities containing chlorophyll from the total events, which account for approximately 0.59%; subsequently, based on the community within this phylum, a second-step gating is performed based on the fluorescence signals of the APC-A (allophycocyanin) and PE (phycoerythrin) channels. 100% of the particles within this phylum possess both of these phycobiliprotein characteristics and are successfully collected as free-state cyanobacteria. This 100% success rate indicates that interference from eukaryotic algae (eukaryotic autotrophs) is almost completely eliminated.

[0054] Specific experimental procedures for 16S amplicon sequencing: 1. Examples of primer sequences are illustrated below: 1) V3-V4 region amplification includes: Forward primer 338F: ACTCCTACGGGAGGCAGCAG; Reverse primer 806R: GGACTACHVGGGTWTCTAAT; 2) Full-length amplification includes: Forward primer 27F: AGRGTTYGATYMTGGCTCAG Reverse primer 1492R: RGYTACCTTGTTACGACTT 2. PCR amplification conditions: A total reaction volume of 25 μL was used. Specific conditions are as follows: Figure 4 As shown.

[0055] The sequencing platform used was the PacBio platform.

[0056] Data processing flow: The raw data first undergoes quality control filtering to remove low-quality reads and obtain high-quality Clean Data. Then, based on the overlap between reads, the sequences are concatenated into Tags. Under a set similarity threshold, the Tags are clustered into Operational Taxonomic Units (OTUs), and species annotation of the OTUs is completed by comparing them with a reference database. Finally, based on the OTUs and species annotation information, sample species complexity analysis and intergroup species difference analysis are performed.

[0057] Water Sampling Standards: To ensure the representativeness of the samples and the reliability of subsequent statistical analysis, seawater sample collection must follow these standards: Sampling depth: Samples were collected at a depth of 0-1 m below the water surface to obtain active cyanobacterial communities in the photosphere.

[0058] Parallel setup: Set up 3-5 parallel samples for each sampling point to reduce random errors and ensure data repeatability.

[0059] Environmental records: Record in detail the basic environmental characteristics of the sampling points, such as latitude and longitude, water temperature, and salinity.

[0060] Separation and Statistical Effect Validation: This method has been validated in practice, and the key performance data are as follows: Eukaryotic algae removal rate: >99%, effectively avoiding major biological interference.

[0061] Cyanobacterial recovery rate: approximately 87%, which comprehensively reflects the natural decline in microbial activity throughout the entire process of sampling, pretreatment, and flow cytometry.

[0062] The purity of the free cyanobacteria isolation is approximately 80%. It should be noted that the symbiotic and free states of cyanobacteria in nature are continuously distributed without absolute boundaries. This method achieves artificial approximation and efficient separation of this continuous spectrum by setting specific physical and fluorescence sorting thresholds.

[0063] The deviation of the number of events in the flow cytometry sorting was ≤ 5% between parallel samples, indicating that the method has high reproducibility.

[0064] Observation of main morphology: Flow cytometry and sequencing data show that the vast majority of cyanobacteria in natural seawater (>90%) exist in a symbiotic form, confirming the importance of studying symbiotic systems.

[0065] Emergency handling of common experimental abnormalities: Filter membrane clogging troubleshooting steps: Immediately disconnect the tubing connecting the filtration flask and stop filtration; use sterile forceps to transfer the clogged filter membrane to a sterile centrifuge tube for temporary storage; after replacing the filter membrane, reconnect and continue working.

[0066] Prevention recommendations: For water samples with high particulate matter content, pre-filtration or batch filtration can be added.

[0067] Procedure for handling clogged tubing in a flow cytometer: Immediately stop the sample loading program; remove the sample tube, replace it with ultrapure water, and run the sample loading program to flush the tubing for 10 minutes; then remove the nozzle, ultrasonically clean it at 35 kHz for 1 minute, air dry, and reinstall it; continue the experiment after calibration.

[0068] Prevention recommendations: All samples must be filtered through a 40μm cell filter and thoroughly vortexed before being loaded onto the instrument.

[0069] Specifically, 16S rRNA amplicon sequencing was used to determine the types and proportions of cyanobacteria and heterotrophic bacteria after sorting.

[0070] like Figure 5 The diagram illustrates a specific embodiment of the present invention. The specific embodiments of the present invention are described below in conjunction with this technical roadmap: I. Multiple filtration steps in sample pretreatment: The core of the pretreatment in this invention is a gradient multiple filtration operation. Through customized filter membrane pore size gradient design and secondary filtration optimization, the initial particle size separation of the cyanobacterial symbiotic system and free cyanobacteria is achieved, while removing water sample impurities and eliminating the pseudo-symbiotic system formed during the filtration process. The specific steps are as follows: Water sample collection and preliminary impurity removal: 5L of seawater sample was collected from the marine environment and filtered through a 320-mesh steel sieve to remove large impurities such as silt and large eukaryotic algae. This avoids problems such as pipe blockage and interference with detection signals caused by impurities in subsequent filtration and flow cytometry, and ensures that cyanobacteria and the symbiotic system can completely pass through the steel sieve into the subsequent processing stage.

[0071] Preparation of 5μm samples by filtration through a 5μm filter membrane: Water samples filtered through a 320-mesh steel sieve are filtered through a 5μm filter membrane. In this step, free heterotrophic bacteria (size much smaller than 1μm), free cyanobacteria (size less than 3μm), and symbiotic systems formed by smaller cyanobacteria (size less than 5μm) enter the filtrate, while symbiotic systems formed by larger cyanobacteria (size greater than 5μm) are retained on the 5μm filter membrane. The 5μm filter membrane with retained particles is collected in a 50ml centrifuge tube, and 50ml of sterile PBS (phosphate buffer, used to fix cell morphology) is added. The centrifuge tube is shaken to transfer all particles on the filter membrane to the sterile PBS. The filter membrane is discarded, and the resulting suspension is designated as the 5μm sample. This suspension is stored at 4℃ for flow cytometry. The storage time at 4℃ should not exceed 24 hours. The sample is vortexed at 50W power, 2800 rpm for 1 min.

[0072] 3μm samples were prepared by double filtration through a 3μm filter membrane: The filtrate obtained in step 2 was first filtered through a 3μm filter membrane. Smaller cyanobacterial symbiotic systems and a very small portion of larger free cyanobacteria were retained on the filter membrane, while the vast majority of free cyanobacteria and free heterotrophic bacteria entered the filtrate. The 3μm filter membrane was collected in a 50ml centrifuge tube, and 50ml of sterile PBS was added for resuspension. After all particles were transferred, the filter membrane was discarded, and the resuspension was lightly sonicated. This sonication was only used to redisperse free cyanobacteria that had accidentally bound together during filtration. Naturally formed cyanobacterial symbiotic systems in the environment were not dispersed by this physical process due to their tight internal binding. Subsequently, the lightly sonicated resuspension was filtered a second time through a 3μm filter membrane. The particles retained on the filter membrane were again resuspensed with 50ml of sterile PBS and transferred. After discarding the filter membrane, the 3μm sample was obtained and stored at 4°C for flow cytometry.

[0073] Preparation of 0.22μm samples by filtration through a 0.22μm filter membrane: The filtrate after the second 3μm filtration in step 3 was filtered through a 0.22μm filter membrane. All free bacteria and free cyanobacteria in the filtrate were retained on the filter membrane. The filter membrane was collected in a 50ml centrifuge tube, and 50ml of sterile PBS was added for resuspension by shaking. After all particles were transferred, the filter membrane was discarded to obtain the 0.22μm sample, which was stored in a 4℃ refrigerator for flow cytometry.

[0074] In the above steps, the 5μm sample contains symbiotic systems formed by large cyanobacteria, and the 3μm sample contains symbiotic systems formed by smaller cyanobacteria. Together, they cover cyanobacterial symbiotic systems at all scales in the marine environment. The 0.22μm sample contains free small cyanobacteria and free heterotrophic bacteria, providing a complete sample source for subsequent statistics on free cyanobacteria.

[0075] II. Flow Cytometry Sorting Steps The flow cytometry sorting step of this invention uses five optical signals as detection indicators: FSC (particle size), SSC (particle surface complexity), APC (phycocyanin signal), PE (phycoerythrin signal), and PerCP-cy5.5 (chlorophyll signal). Utilizing the differences in fluorescence signal characteristics between cyanobacteria and eukaryotic algae, it accurately removes interference from eukaryotic algae. The cyanobacterial symbiotic system and free cyanobacteria are statistically analyzed and collected separately. Simultaneously, the sorting results are verified. The specific operation is as follows: Flow cytometry instrument pretreatment and sample pretreatment: The flow cytometer was preheated and calibrated to ensure detection accuracy. The previously stored 5μm, 3μm, and 0.22μm samples were filtered through a 40μm cell filter to prevent small particle agglomerations from clogging the instrument tubing. The processed samples were then ready for use. (Flow cytometer parameter settings: Flow rate set to 1.0. Detection voltage: Requires real-time adjustment based on sample size; there is no fixed value. The adjustment principle is to ensure that the signal from the negative control population is mainly distributed within the 10¹–10² range, while avoiding saturation and overflow of the positive signal, ensuring a linear distribution of FCS and SSC signals.)

[0076] Flow cytometry sorting of 5μm and 3μm samples: Pretreated 5μm and 3μm samples were loaded into a flow cytometer for sorting. Gated sorting was performed based on the characteristics of five optical signals. The specific sorting logic was as follows: Particle populations that were positive for PerCP-cy5.5 signal but negative for both APC and PE signals were selected. This population consisted of eukaryotic algae. The number of events was counted and the particles were sorted into flow cytometry tubes containing sterile PBS to remove the eukaryotic algae. Select a population of particles that are positive for PerCP-cy5.5 signal and at least one of APC and PE signals. This population is symbiotic cyanobacteria. Count the number of events and sort them into flow cytometry tubes containing sterile PBS to complete the collection of symbiotic cyanobacteria. Particle populations with negative PerCP-cy5.5 signals were selected. This population consists of symbiotic heterotrophic bacteria. The number of events was counted and the particles were sorted into flow cytometry tubes containing sterile PBS. After the above operations are completed, the complete collection and statistics of the marine cyanobacterial symbiotic system (symbiotic cyanobacteria + symbiotic heterotrophic bacteria) will be achieved.

[0077] Flow cytometry analysis and sorting of 0.22μm samples: The pretreated 0.22μm samples were loaded into a flow cytometer. According to the above optical signal characteristics, particle populations that were positive for PerCP-cy5.5 signal and at least one of APC and PE signals were selected. This population was free cyanobacteria. The number of events was counted and sorted into flow cytometry tubes containing sterile PBS to complete the collection and counting of free cyanobacteria.

[0078] Verification and species analysis of sorting results: The sorted products of symbiotic cyanobacteria, symbiotic heterotrophic bacteria and free cyanobacteria obtained by the above flow cytometry sorting were subjected to 16S amplicon sequencing. This sequencing technology was used to determine the specific species and proportion of cyanobacteria and heterotrophic bacteria in the sorted products, verify the accuracy of the flow cytometry sorting results, and provide basic species data for subsequent research on cyanobacterial symbiotic systems.

[0079] III. Key Technical Points and Performance Guarantee: The entire process is physical: the multiple filtration steps (screening, filtration, and mild sonication) and flow cytometry sorting steps of this invention are all physical processes. The entire collection and statistical process does not introduce any biological or chemical factors (such as lysozyme, fixatives, staining agents, etc.), which can effectively avoid the destruction of the symbiotic structure of cyanobacteria and heterotrophic bacteria by biochemical factors, ensure the in-situ state of the cyanobacterial symbiotic system, and preserve the natural population ratio of the cyanobacterial symbiotic system in the marine environment, thus achieving the core requirements of in-situ collection and statistics.

[0080] The complementary synergy of multiple filtration stages and flow cytometry: In this invention, multiple filtration stages are responsible for separating the cyanobacterial symbiotic system from free cyanobacteria by particle size gradient, effectively eliminating pseudo-symbiotic systems; flow cytometry is responsible for accurately removing eukaryotic algae interference based on fluorescence signal characteristics, achieving specific screening of target microorganisms. The combination of the two forms a dual guarantee system of "particle size separation + fluorescence screening", which solves the core defects of existing technologies that rely solely on single-stage filtration, such as eukaryotic algae interference and misjudgment of pseudo-symbiotic systems.

[0081] Customized optical signals and sorting logic: This invention targets the characteristics of cyanobacteria, which are rich in chlorophyll, phycocyanin, and phycoerythrin, while eukaryotic algae contain only chlorophyll and no phycobiliproteins (phycocyanin and phycoerythrin). It designs five optical signal detection combinations and corresponding sorting logics, which can achieve accurate differentiation of cyanobacteria, eukaryotic algae, and heterotrophic bacteria, completely eliminate the interference of eukaryotic algae on the statistics of cyanobacterial symbiotic systems, and improve the accuracy of statistical results.

[0082] like Figure 6 The diagram shown is a schematic of the separation and collection process of symbiotic and free bacteria in natural water bodies in the prior art. It fully demonstrates the complete steps of separating symbiotic / free samples, including water, through filtration using a 3μm + 0.22μm filter membrane, which is closest to the prior art.

[0083] like Figure 7 The figure shows a schematic diagram of the algal symbiotic system. The figures are labeled as follows: 1. Algal environment, 2. Cyanobacteria, 31, 32. Heterotrophic bacteria.

[0084] The implementation of this invention enables precise separation, in-situ collection, and accurate statistical analysis of cyanobacterial symbiotic systems and free cyanobacteria in the marine environment. It can effectively obtain data on the proportion of cyanobacterial symbiotic systems in the total number of cyanobacteria in the marine environment, providing a reliable sample preparation method and accurate basic data for subsequent experiments on cyanobacterial symbiotic systems as a hotspot for horizontal transfer of resistance genes, and filling the gap in in-situ collection and statistical techniques for cyanobacterial symbiotic systems in the marine environment.

[0085] The above embodiments are preferred embodiments of the present invention. Those skilled in the art can make conventional adjustments within the scope of the technical concept of the present invention, such as appropriately adjusting the collection volume of seawater samples and the amount of sterile PBS used, while ensuring the in-situ state and separation effect. Such adjustments are all within the protection scope of the present invention.

[0086] In summary, most marine cyanobacteria are between 3 and 5 μm in diameter. Only small eukaryotic algae have similar fluorescence characteristics to cyanobacteria in this size range. However, simple filtration alone cannot remove the interference of eukaryotic algae, nor can it effectively separate symbiotic cyanobacteria from free cyanobacteria. Therefore, a combination of multiple filtrations and flow cytometry was used to complete the separation and statistical analysis of symbiotic and free cyanobacteria in the ocean. The reason why there are a large number of heterotrophic bacteria in the 5 μm and 3 μm samples is that even though the symbiotic system is not easily separated by mild physical action, a considerable portion of the symbiotic system is still separated into cyanobacteria and heterotrophic bacteria under the action of PBS and flow cytometry, but this does not affect their symbiotic state before filtration. (1) Because there are a considerable number of eukaryotic algae in the water, it is impossible to separate eukaryotic algae simply by particle size, which will interfere with the statistical analysis of cyanobacteria. (2) Using only 3μm as the boundary between symbiosis and free is too simplistic. Many of the symbiotic samples after this treatment are "pseudo-symbiotic systems" that are formed temporarily and accidentally during the treatment process. They need to be redesigned based on the actual situation.

[0087] Multiple filtrations: Groups larger than 5 μm are defined as symbiotic cyanobacteria and bacteria. The 3-5 μm segment includes small cyanobacterial symbiotic systems (cyanobacteria + bacteria) and free large cyanobacteria. Preliminary investigations showed that most cyanobacteria in the marine environment are in a symbiotic state, so this segment was pre-determined as symbiotic cyanobacteria. The segment below 3 μm consists of free small cyanobacteria and free heterotrophic bacteria. In other words, by using 5 μm filtration and two 3 μm filtrations, it is ensured that the symbiotic samples (i.e., the 5 μm sample and the 3 μm sample) essentially only contain the symbiotic systems already formed in the environment. This results in better separation of cyanobacterial symbiotic systems and free cyanobacteria, reflecting not only the proportion of cyanobacterial symbiotic systems in the environment but also facilitating subsequent analysis and experiments on cyanobacterial symbiotic systems. The entire scheme avoids the introduction of any biological or chemical factors, relying entirely on physical processes, minimizing damage to cyanobacteria and their symbiotic systems. Some sampling methods use chemicals, such as lysozyme, for treatment, but these can damage the cyanobacterial symbiotic system. This paper optimizes and redesigns the original method, which only uses 3 μm as the boundary between symbiotic and free cyanobacteria, and proposes a multi-stage filtration process tailored to actual environmental conditions.

[0088] Flow cytometry sorting (analysis): Five optical signals were selected: FSC (particle size), SSC (particle surface complexity), APC (phycocyanin signal), PE (phycoerythrin signal), and PerCP-cy5.5 (chlorophyll signal). APC, PE, and PerCP-cy5.5 were primarily used to distinguish between cyanobacteria and eukaryotic algae. Cyanobacteria are rich in chlorophyll, phycocyanin, and phycoerythrin (these two are collectively known as phycobiliproteins), while eukaryotic algae lack phycobiliproteins and only have chlorophyll. Therefore, particles with a positive PerCP-cy5.5 signal but negative APC and PE signals were identified as eukaryotic algae and were to be removed. Particles with a positive PerCP-cy5.5 signal and at least one positive APC and PE signal were identified as cyanobacteria, and particles with a negative PerCP-cy5.5 signal were identified as heterotrophic bacteria. Finally, 16S sequencing was performed on the sorted cyanobacteria and heterotrophic bacteria to verify their classification. A flow cytometry gating scheme was designed as the flow cytometry analysis and sorting scheme, which can completely remove interference from eukaryotic algae. The entire solution, designed based on near-in-situ detection, avoids the introduction of any chemical or biological factors and is completed entirely by physical processes, minimizing damage to cyanobacteria and their symbiotic systems.

[0089] In summary: filtration is responsible for separating symbiotic and free cyanobacteria, while flow cytometry is responsible for removing interference from eukaryotic algae. Combining these two methods allows for the separation and statistical analysis of symbiotic and free cyanobacteria in the ocean.

[0090] Objective: To separate the symbiotic and free states of cyanobacteria through multiple filtrations, and then remove the eukaryotic algae by flow cytometry based on the difference in fluorescence signals between cyanobacteria and eukaryotic algae.

[0091] The specific embodiments described in this invention are merely illustrative and not intended to limit the scope of protection. Within the scope defined by the spirit and claims of this invention, various modifications and implementations are possible: the actions or steps recorded in the claims may be performed in a different order than those described in the embodiments; the processes shown in the accompanying drawings do not necessarily require a specific order or continuity, and may be used when multitasking or parallel processing is feasible; any specific modifications or implementations made by those skilled in the art based on the teachings of this invention after learning of this invention, without departing from the above-mentioned scope of protection, are all within the scope of protection of this invention.

Claims

1. A method for in-situ collection and statistical analysis of marine cyanobacteria symbiotic systems and free cyanobacteria, characterized in that, The process includes multiple filtration steps in pretreatment and flow cytometry sorting steps, and the entire collection and statistical process is completed solely through physical processes without introducing any biological or chemical factors; the multiple filtration steps include: Step 1: Collect seawater samples, filter them through a 320-mesh steel sieve to remove impurities, and then filter them through a 5μm filter membrane. The particles trapped on the 5μm filter membrane are resuspended in sterile PBS to obtain a 5μm sample. Step 2: Filter the filtrate from Step 1 through a 3μm filter membrane. Resuspend the particles trapped on the 3μm filter membrane in sterile PBS and then sonicate them lightly. Filter the resuspended liquid through a 3μm filter membrane again. Resuspend the particles trapped on the 3μm filter membrane a second time in sterile PBS to obtain a 3μm sample. Step 3: Filter the filtrate from the second 3μm filtration in Step 2 through a 0.22μm filter membrane. Resuspend the particles trapped on the 0.22μm filter membrane in sterile PBS to obtain a 0.22μm sample. The flow cytometry sorting step includes: processing the 5μm, 3μm, and 0.22μm samples through a 40μm cell filter before loading them onto the flow cytometry instrument. Five light signals, FSC, SSC, APC, PE, and PerCP-cy5.5, are selected as detection indicators. Eukaryotic algae are sorted and removed based on the light signal characteristics. Marine cyanobacterial symbiotic systems and free cyanobacteria are counted and collected separately. The sorting results are verified by 16S rRNA amplicon sequencing.

2. The marine cyanobacterial symbiotic system and the in-situ collection and statistical method for free cyanobacteria according to claim 1, characterized in that, In step 1, the impurities include silt and large eukaryotic algae in the water; the specific operation of resuspension is to collect the filter membrane in a 50ml centrifuge tube, add 50ml of sterile PBS and shake until all particles on the filter membrane are transferred to sterile PBS, discard the filter membrane to obtain the corresponding sample, and store the samples in a 4℃ refrigerator for flow cytometry.

3. The marine cyanobacterial symbiotic system and the in-situ collection and statistical method for free cyanobacteria according to claim 1, characterized in that, In step 2, the purpose of mild ultrasonic treatment is to redisperse the free cyanobacteria that accidentally bound together during the filtration process, while preserving the naturally formed, tightly bound cyanobacterial symbiotic system in the environment.

4. The marine cyanobacterial symbiotic system and the in-situ collection and statistical method for free cyanobacteria according to claim 1, characterized in that, In the flow cytometry sorting step, the optical signal characteristics of eukaryotic algae were positive for PerCP-cy5.5 signal, while both APC and PE signals were negative.

5. The marine cyanobacterial symbiotic system and the in-situ collection and statistical method for free cyanobacteria according to claim 1, characterized in that, In the flow cytometry sorting step, the optical signal characteristics of cyanobacteria are positive for PerCP-cy5.5 signal and at least one of APC and PE signals; the optical signal characteristics of heterotrophic bacteria are negative for PerCP-cy5.

5.

6. The marine cyanobacterial symbiotic system and the in-situ collection and statistical method for free cyanobacteria according to claim 5, characterized in that, When sorting 5μm and 3μm samples by flow cytometry, particles that are positive for PerCP-cy5.5 signal and at least one of APC and PE signals are collected as symbiotic cyanobacteria, and particles that are negative for PerCP-cy5.5 are collected as symbiotic heterotrophic bacteria, thus completing the collection and statistics of marine cyanobacterial symbiotic systems.

7. The marine cyanobacterial symbiotic system and the in-situ collection and statistical method for free cyanobacteria according to claim 5, characterized in that, When sorting 0.22 μm samples by flow cytometry, particles that are positive for PerCP-cy5.5 signal and at least one of APC and PE signals are collected as free cyanobacteria, thus completing the collection and statistics of free cyanobacteria.

8. The marine cyanobacterial symbiotic system and the in-situ collection and statistical method for free cyanobacteria according to claim 1, characterized in that, The 5μm sample contains a symbiotic system formed by large cyanobacteria, the 3μm sample contains a symbiotic system formed by smaller cyanobacteria, and the 0.22μm sample contains free small cyanobacteria and free heterotrophic bacteria.

9. The marine cyanobacterial symbiotic system and the in-situ collection and statistical method for free cyanobacteria according to claim 1, characterized in that, In the flow cytometry sorting step, a fluorescence signal-based gating strategy is implemented to sort target microorganisms: When sorting the 5μm and 3μm samples, a two-level gating strategy is implemented: the first level of gating is based on the PerCP-Cy5.5-A signal and the side-scattered light signal to delineate the target population containing chlorophyll from the total events; the second level of gating is based on the APC-A signal and the PE signal to sort particles from the target population that are positive for PerCP-Cy5.5-A signal and at least one of APC-A and PE signals as symbiotic cyanobacteria, and exclude eukaryotic algal particles that are positive for PerCP-Cy5.5-A signal but negative for both APC-A and PE signals. When sorting the 0.22μm samples, the same second-level gating criteria were used directly, namely, based on the PerCP-Cy5.5-A, APC-A and PE signals. Particles that were positive for PerCP-Cy5.5-A signal and at least one of APC-A and PE signals were sorted and collected as free cyanobacteria.