A calcium carbonate manganese nanoprobe for in-situ imaging detection of proteins and a preparation method and application thereof

By combining calcium manganese carbonate nanoprobes (DND) with nanocarriers and DNAzyme catalytic amplification mechanisms, highly sensitive and specific in situ imaging of VEGF was achieved, solving the problems of insufficient detection sensitivity and poor stability in traditional methods. This method is suitable for early tumor diagnosis and biomarker detection.

CN122256362APending Publication Date: 2026-06-23YULIN NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610388578.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-27
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

Existing technologies struggle to achieve highly sensitive and specific in-situ detection of VEGF in live cells or the in vivo environment. Traditional DNAzyme systems exhibit poor stability, low delivery efficiency, and high non-specific background signals in the in vivo environment. Nanoprobes lack effective catalytic amplification mechanisms, resulting in limited detection sensitivity.

Method used

A calcium manganese carbonate nanoprobe (DND) was designed, which is a nucleic acid-antibody deoxyribonuclease probe with dual recognition by two antibodies and aptamers. Combined with a nanocarrier and DNAzyme catalytic amplification mechanism, it achieves the synergistic effect of target recognition, structure assembly and catalytic amplification, endogenously releases Mn²⁺ cofactor, and utilizes acid response characteristics to achieve spatial and temporal regulation of signal activation.

Benefits of technology

It improves the detection sensitivity and imaging performance of low-abundance biomarkers, and realizes high-specificity real-time in-situ dynamic imaging of tumor cells and proteins in vivo. It has good biocompatibility and low toxicity, and is suitable for live cell and in vivo imaging and analysis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122256362A_ABST
    Figure CN122256362A_ABST
Patent Text Reader

Abstract

This invention belongs to the medical field and provides a calcium carbonate manganese nanoprobe for in situ imaging detection of vascular epidermal growth factor, its preparation method, and its application. In this strategy, a DNA strand (P1 and P2) containing a protein recognition antibody, a protein recognition sequence, and a deoxyribonuclease, along with a molecular beacon DNA strand (H1), is stirred in a DMEM cell culture medium containing calcium chloride and manganese chloride to prepare the calcium carbonate manganese nanoprobe. In acidic tumor cells, this nanoprobe releases P1, P2, H1, and manganese ions. P1 and P2 can simultaneously recognize proteins, forming a complete deoxyribonuclease center, which catalyzes the cleavage of H1 under the action of the cofactor manganese ions, generating a fluorescent signal. This strategy achieves specific in situ dynamic imaging of low-abundance proteins in vivo and has great potential in biomedical research.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the medical field, specifically to a calcium carbonate manganese nanoprobe for in situ protein imaging detection, its preparation method, and its application. Background Technology

[0002] Vascular endothelial growth factor (VEGF) is a class of proteins that play a crucial role in tumor development and progression, participating in important physiological and pathological processes such as tumor angiogenesis, cell proliferation, and metastasis. Numerous studies have shown that VEGF is abnormally highly expressed in various tumor tissues, and its expression level is closely related to tumor occurrence, progression, and prognosis. Therefore, achieving highly sensitive and specific detection of VEGF is of great significance for early diagnosis, dynamic monitoring, and precision treatment of tumors.

[0003] Currently, detection methods for VEGF mainly include enzyme-linked immunosorbent assay (ELISA), immunofluorescence staining, and immunohistochemical analysis. While these methods have high specificity, they typically rely on fixed or lysed samples, making in-situ detection in live cells or the in vivo environment difficult. Furthermore, these methods generally lack effective signal amplification mechanisms, resulting in limited sensitivity for low-abundance target molecules and failing to meet the detection needs of trace proteins in complex biological systems. In recent years, nucleic acid-based molecular recognition and signal amplification technologies (such as DNAzymes, molecular beacons, and strand displacement reactions) have received widespread attention in the field of biodetection. Among them, DNAzymes are widely used to construct signal amplification systems due to their advantages such as high programmability, stable catalytic activity, and no need for protease participation. However, traditional DNAzyme systems usually rely on the addition of exogenous metal ions (such as Mn²⁺) as cofactors, and suffer from poor stability, low delivery efficiency, and high non-specific background signals in the in vivo environment, limiting their application in live cells and in vivo imaging. On the other hand, nanomaterials, due to their good biocompatibility and tunable structural properties, show broad application prospects in the field of biomolecule delivery and imaging. Integrating functional nucleic acid components into nanocarriers can not only improve their stability in physiological environments but also enable spatiotemporal control of signal activation processes. However, existing nanoprobe systems mostly focus on single-shot recognition or simple responses, lacking effective catalytic amplification mechanisms, which limits detection sensitivity. Furthermore, how to achieve efficient coupling between endogenous supply of cofactors and signal amplification processes in nanosystems remains a critical problem that urgently needs to be solved.

[0004] Therefore, developing a novel nanoprobe system capable of efficient delivery, target-specific recognition, and signal amplification in complex biological environments, especially a detection strategy that achieves synergistic effects between DNAzyme catalytic amplification and nanocarriers, is of great significance for improving the detection sensitivity and imaging performance of low-abundance proteins (such as VEGF). Summary of the Invention

[0005] The purpose of this invention is to provide a method for preparing calcium manganese carbonate nanoprobes (DND) for in situ protein imaging detection and its application, addressing the aforementioned problems. The DND prepared by this invention can achieve real-time dynamic fluorescence imaging of low-abundance tumor-related proteins in vivo, and has good potential medical diagnostic value, and is expected to be used for early imaging diagnosis of various cancers.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: (1) In a first aspect of the present invention, a design of a nucleic acid-antibody deoxyribonuclease probe and molecular beacon with dual recognition of two antibodies and aptamers is provided: including DNA chain P1, DNA chain P2 and DNA chain H1.

[0007] (2) The P1 and P2 chains contain VEGF recognition antibody and aptamer sequences, with 27 T bases connecting the antibody and protein recognition sequences, and deoxyribozyme sequences; Cy5 and BHQ3 are labeled at the third T base at the 5' end and 3' end of H1, respectively.

[0008] (3) A second aspect of the present invention provides a method for preparing DND, comprising: MnCl2•4H2O was dissolved in sugar-free DMEM medium, followed by the addition of P1, P2, and H1, then sealed and incubated at room temperature with stirring for 24 h. CaCl2 was then added, and the mixture was incubated again with stirring for 24 h. The final product was separated by centrifugation, washed twice with deionized water, and freeze-dried for later use.

[0009] (4) The probe exhibits satisfactory stability, specificity and real-time imaging capabilities, and can be used for in situ imaging of tumor-associated proteins in vivo.

[0010] (5) A third aspect of the present invention provides the application of the above-described DND in in situ protein imaging; (6) This strategy enables real-time in situ dynamic imaging of tumor cells and proteins in vivo with high specificity. Since both antibodies and aptamer sequences can be obtained through in vitro screening, this strategy can be extended to in situ imaging of other target proteins by simply changing the recognition antibody and recognition sequence.

[0011] (7) The advantages of the present invention are: This invention constructs an integrated DNAzyme nanoprobe system encompassing target recognition, structure assembly, and catalytic amplification. By inducing DNAzyme activation through target targeting, a cascaded signal amplification is achieved, significantly improving the detection sensitivity for low-abundance biomarkers. Encapsulating functional nucleic acid components using nanocarriers effectively enhances their stability and resistance to degradation in complex physiological environments, overcoming the problem of easy inactivation in traditional nucleic acid probes. Utilizing acid-responsive properties enables controllable dissociation of the nanostructure and on-demand release of functional components, thereby achieving spatial and temporal modulation of signal activation, reducing background interference, and improving detection specificity. This DND nanosystem can endogenously release the Mn²⁺ cofactor required for the DNAzyme reaction without exogenous addition, avoiding the limitations of reaction conditions in traditional systems and improving its applicability in living cells and in vivo environments. Through the synergistic coupling of nanodelivery and the DNAzyme catalytic amplification mechanism, efficient delivery of functional nucleic acids into cells is achieved while ensuring signal amplification capabilities, solving the technical challenge of traditional DNAzyme systems' inability to enter cells and exert their effects. This DND exhibits good biocompatibility and low toxicity, and can be used for live cell and in vivo imaging and analysis, making it of significant value in the fields of early tumor diagnosis and biomarker detection. Attached Figure Description

[0012] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0013] Figure 1 This is a schematic diagram illustrating the principle of a calcium carbonate manganese nanoprobe for in-situ protein imaging detection in Embodiment 1 of the present invention.

[0014] Figure 2 The images shown are transmission electron microscope images and elemental energy spectrum diagrams of DND in Embodiment 1 of the present invention.

[0015] Figure 3 The images shown are the particle size distribution diagram, transmission electron microscope image, and Mn image of DND after incubation in solutions of different pH values ​​in Example 1 of this invention. 2+ Release curve.

[0016] Figure 4 The images show the fluorescence spectra and fluorescence imaging of DND and DND1 after being treated with VEGF in Example 1 of this invention.

[0017] Figure 5This is a fluorescence imaging image of DND and DND1 after being incubated with HepG2 and L02 cells for 4 hours, respectively, in Example 1 of the present invention.

[0018] Figure 6 The images show fluorescence imaging of DND and DND1 in mouse tumor models, respectively, in Example 1 of this invention. Detailed Implementation

[0019] To more clearly illustrate the present invention, the following specific embodiments will be used to further explain the invention.

[0020] Example 1: This invention utilizes manganese (Mn)-doped calcium carbonate nanoparticles as a carrier and a coenzyme factor donor for DNAzymes, employing intracellular tumor protein markers as stimuli and proximity effect products as DNAzymes to construct a stimulus-responsive functional nucleic acid nanoprobe for in vivo protein signal amplification and fluorescence imaging analysis. Figure 1 As shown in Figure A, we used CaMnCO3 nanoparticles to assemble two antibody-labeled DNA fragments (P1, P2) and a DNA-zyme substrate hairpin H1 labeled with a fluorescent dye into a functionalized DND using a one-pot method. The principle of fluorescence signal generation in cells is as follows: Figure 1 As shown in Figure B, after DND is taken up by cells, the CaMnCO3 nanoparticles dissolve in the slightly acidic environment of tumor cells, releasing H1, P1, and P2 into the cells, while simultaneously releasing the coenzyme factor Mn required for DNAzyme. 2+ At this point, the antibodies modified on P1 and P2 simultaneously recognize the same target protein VEGF through affinity, forming a VEGF / P1 / P2 complex. Based on the proximity effect, the DNA fragments of P1 and P2 move closer together, forming a complete DNA enzyme. Meanwhile, the cofactor Mn... 2+ Under catalysis, the substrate hairpin H1 labeled with fluorescent dye is cleaved, the fluorophore moves away from the quencher, and fluorescence is restored; the DNAzyme active site is re-released to cleave another H1, further enhancing fluorescence. Furthermore, the cleaved H1 fragment can act as an analog of the target protein, initiating new proximity hybridization reactions, thus continuously cycling and ultimately leading to significant fluorescence enhancement. Based on these principles, the designed nanoprobe enables ultrasensitive fluorescence imaging analysis of tumor cell proteins.

[0021] 1.1 Construction of DND probe This embodiment provides a method for constructing a DNAzyme signal amplification-based DND.

[0022] (1) Preparation of nucleic acid components The nucleic acid sequences and modifications used in this invention are shown in Table 1. Recognition strands P1 and P2 and substrate hairpin strand H1 were synthesized, respectively. H1 molecule contains DNAzyme substrate sequence and fluorescence-quenching label (such as Cy5 / BHQ3). P1, P2 and H1 were mixed in buffer solution at a predetermined ratio (preferably 1:1:1) for later use.

[0023] Table 1. Nucleic acid sequences and modifications used in this invention (2) Preparation of DND The above-mentioned nucleic acid mixture solution was mixed with a precursor solution containing Ca²⁺ and Mn²⁺, and CaMnCO₃ nanoparticles were generated by biomineralization, thus embedding the nucleic acid components in situ within the nanostructure to form DNDs. Transmission electron microscopy was used to test the DNDs, and the results showed that the DNDs were approximately 100 nm in size and contained C, N, O, Mn, Ca, P, and S elements, indicating the successful preparation of the DNDs. Figure 2 ).

[0024] (3) Purification and preservation The obtained DND was washed by centrifugation to remove unbound components, and then resuspended in a buffer solution and stored at 4 °C for later use.

[0025] 1.2 Acid-responsive release performance of DND DND was placed in buffer solutions with different pH conditions (e.g., pH 7.4 and pH 5.5) and incubated at 37 °C for different times (90 min). The samples were tested using transmission electron microscopy and a force analyzer. The results showed that the particle size of DND decreased significantly in the pH 5.5 solution. Under acidic conditions, the release of nucleic acid components increased with time, reaching a high level at approximately 90 min, while release was less under neutral conditions, indicating that the system has good acid-responsive release characteristics. Figure 3 ).

[0026] 1.3 Verification of DNAzyme signal amplification performance DND was mixed with VEGF solutions of different concentrations and incubated at 37 °C for a certain time (120 min), and the changes in fluorescence signal were recorded. A control group, DND1 (which does not have self-amplification ability), was also included for comparative analysis.

[0027] The results showed that the fluorescence signal of the DND system was significantly higher than that of DND1 ( Figure 4 This indicates that the system has good signal amplification capability.

[0028] 1.4 Cell Imaging Experiment DND was incubated in target cells (such as HepG2) and control cells (such as L02) and cultured at 37 ℃ and 5% CO2 for a certain period of time. The intracellular fluorescence signal was then observed using a confocal laser scanning microscope.

[0029] The results showed that the fluorescence signal was significantly enhanced in tumor cells with high VEGF expression, while the signal was weaker in normal cells, indicating that the probe can effectively detect intracellular VEGF; and the fluorescence of DND-treated cells was significantly stronger than that of DND1 (…). Figure 5 This indicates that the DND system has catalytic amplification characteristics.

[0030] 1.5 Animal in vivo imaging experiments To verify the imaging capability and tumor recognition performance of the DND constructed in this invention in the in vivo environment, the following animal imaging experiments were conducted.

[0031] (1) Establishment of animal models Healthy female BALB / c nude mice (4-6 weeks old) were selected and subcutaneously inoculated with tumor cells (such as HepG2 cells), with each mouse receiving approximately 1 × 10⁻⁶ cells. 6 1 cell. When the tumor grows to about 100-200 mm³, it will be used for subsequent experiments.

[0032] (2) Probe drug delivery The prepared DND was dispersed in sterile PBS buffer solution at an appropriate concentration and injected into tumor-bearing mice via tail vein injection (the administration volume is generally 100~200 μL).

[0033] A control group was also set up, including: PBS group (negative control) DND1 group (without magnification function for comparison) (3) In vivo fluorescence imaging Fluorescence imaging was performed on mice at different time points after drug administration (e.g., 0, 1, 3, 5, and 7 h) using a small animal in vivo imaging system. Appropriate excitation and emission wavelength parameters were set, and the distribution of fluorescence signals at the tumor site and throughout the body was recorded. Results showed that in the DND treatment group, the fluorescence signal at the tumor site was significantly enhanced, gradually increasing over time and reaching a high level after a certain period; while the fluorescence signal in the PBS group and the DND1 group was significantly weaker. Figure 6 ).

[0034] 2. Conclusion This invention proposes an integrated DNAzyme signal amplification nanoprobe system, which achieves efficient detection of low-abundance target molecules in complex biological environments through the synergistic effect of nanodelivery, acid-responsive release, and catalytic amplification mechanisms. This technical solution is innovative in terms of structural design and functional integration, effectively overcoming the technical shortcomings of insufficient sensitivity and limited in vivo application in existing technologies, and has good application prospects and promotional value.

[0035] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Unless otherwise defined, all technical terms used below have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing specific embodiments only and are not intended to limit the scope of protection of the present invention. Unless otherwise specifically stated, all raw materials, reagents, instruments, and equipment used in the present invention are commercially available or can be prepared by existing methods.

Claims

1. A calcium carbonate manganese nanoprobe for in-situ protein imaging detection, characterized in that: The system comprises manganese-doped calcium carbonate manganese nanoparticles; recognition chains P1 and P2; a molecular beacon H1; sequences of the recognition chains P1 and P2, and the sequence of H1, with Cy5 and BHQ3 labeled at the 5' and 3' ends of H1, respectively; the complete deoxyribozyme sequence is divided into two parts and designed onto P1 and P2 respectively; the P1 and P2 chains are linked by 27 T bases between the antibody and protein recognition sequences; the sequences of the antibody-labeled P1 and P2 chains are as follows: P1:TCAGTAGCGATCCTTAATTTGGGCCCTTT(27)-Ab1 P2: Ab2-TTT(27)-GTC CGT ATG TTTGGCACCCATGTTAGATG.

2. The calcium carbonate manganese nanoprobe for in-situ protein imaging detection as described in claim 1, characterized in that, The H1 molecular beacon sequences labeled Cy5 and BHQ3 are as follows: CAT-BHQ3-ACGGACGGCCCATCTAArGrACTGACCGTCCGT-Cy5.

3. A method for preparing a calcium carbonate manganese nanoprobe for in-situ protein imaging detection as described in claim 1, characterized in that, The preparation method is as follows: 1 MnCl2•4H2O was dissolved in buffer solution, followed by the addition of P1, 100 µL of P2 (concentration of H1), and then sealed and incubated at room temperature with stirring for 24 h; then CaCl2 was added, and the mixture was incubated again with stirring for 24 h; the final product was separated by centrifugation, washed twice with deionized water, and freeze-dried for later use.

4. The method for preparing calcium carbonate manganese nanoprobes for in-situ protein imaging detection as described in claim 3, characterized in that, The mixing ratio of P1 chain, P2 chain and H chain is 1:1:

1.

5. The method for preparing calcium carbonate manganese nanoprobes for in-situ protein imaging detection as described in claim 3, characterized in that, The solvent for the buffer solution is sugar-free DMEM cell culture medium buffer.

6. The application of the probe according to claim 1 or 2 in in situ protein imaging.

7. The application as claimed in claim 6, characterized in that, HepG2 and L02 cells were incubated with calcium carbonate manganese nanoprobes for 4 hours in a cell culture incubator; the cells were washed three times with PBS for confocal scanning imaging.

8. The application as described in claim 7, characterized in that, The confocal scanning imaging parameters are as follows: excitation is performed using a wavelength of 633 nm, and the fluorescence of Cy5 is collected in the wavelength range of 645 nm to 700 nm.

9. The application as claimed in claim 6, characterized in that, Calcium carbonate manganese nanoprobes were dissolved in physiological saline and then injected into nude mice with tumors via the tail vein. Fluorescence imaging was performed after anesthetizing the nude mice at 1 hour, 3 hours, 5 hours and 7 hours.

10. The application as described in claim 7, characterized in that, The parameters for in vivo fluorescence imaging of small animals are as follows: excitation is performed at a wavelength of 633 nm, and the fluorescence of Cy5 is collected using a 700 nm filter.