A ganoderma lucidum hydrophobic protein glhyd694 gene, the encoded protein and application thereof
By cloning and constructing the Glhyd694 gene, a hydrophobic protein from Ganoderma lucidum, and a silent strain, the expression and self-assembly of the recombinant protein in Escherichia coli were achieved. This solved the problem of the sensitivity of Ganoderma lucidum mycelium to environmental stress and enhanced its application potential in the food industry.
Patent Information
- Application Number
- CN202610730259.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-26
- Publication Date
- 2026-06-23
AI Technical Summary
In the existing technology, the research on hydrophobic proteins of Ganoderma lucidum is relatively preliminary, lacking functional identification of the Glhyd694 gene and expression of heterologous recombinant proteins. In addition, Ganoderma lucidum mycelium is highly sensitive to environmental stress, making it difficult to apply in the food industry.
The Ganoderma lucidum hydrophobic protein gene Glhyd694 was cloned, and a heterologous Escherichia coli strain expressing the recombinant protein Glhyd694 and a Glhyd694 gene-silencing strain were constructed. The recombinant protein was successfully expressed in Escherichia coli, achieving self-assembly ability and emulsification properties. The exogenous recombinant protein promoted mycelial growth.
The recombinant protein Glhyd694 was self-assembled at a hydrophobic/hydrophilic interface, which changed the surface wettability, exhibited good emulsifying properties, improved the tolerance of Ganoderma lucidum mycelium to various environmental stresses, and promoted its application in the food industry.
Smart Images

Figure CN122256378A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a Ganoderma lucidum hydrophobic protein Glhyd694 gene, its encoded protein, and its applications. Background Technology
[0002] Hydrophobic proteins are a class of small molecular weight proteins secreted by filamentous fungi, typically with a molecular weight of 10-15 kDa. The core characteristic of these proteins is the simultaneous presence of both hydrophobic and hydrophilic domains, enabling them to spontaneously assemble at hydrophobic / hydrophilic interfaces to form nanoscale amphiphilic films, thereby regulating interfacial wettability. Although hydrophobic proteins from different sources exhibit low amino acid sequence homology, their primary structure generally contains eight conserved cysteine residues. These residues maintain the protein's highly stable three-dimensional structure by forming four pairs of intrachain disulfide bonds. Based on the distribution characteristics of cysteine residues and hydrophilicity maps, hydrophobic proteins are generally classified into class I and class II. Class I hydrophobic proteins are found in both ascomycetes and basidiomycetes, while class II hydrophobic proteins are found only in ascomycetes.
[0003] In the fungal life cycle, hydrophobic proteins participate in the regulation of physiological processes such as hyphal growth, primordium differentiation, fruiting body development, spore formation, and stress response. Based on their ability to self-assemble into amphiphilic films, hydrophobic proteins possess surface activity and stability, and can be used industrially as emulsifiers, drug carriers, or biosensor matrices. Currently, hydrophobic proteins are mainly prepared through filamentous fungal fermentation or recombinant expression systems.
[0004] Ganoderma lucidum, a large fungus used in both traditional Chinese medicine and food, is not only a precious medicinal material but also an important cultivated variety with significant economic value in the modern edible fungi industry. Previous studies have shown that the Ganoderma lucidum genome contains a large number of genes encoding hydrophobic proteins, and these genes exhibit differential expression patterns at stages such as mycelial growth and fruiting body development, revealing that this gene family may play an important role in the life cycle of Ganoderma lucidum. However, current research on hydrophobic proteins in Ganoderma lucidum is still relatively preliminary. To date, only one publicly reported study has confirmed the key role of the hyd1 gene in mycelial growth, fruiting body development, and abiotic stress resistance of Ganoderma lucidum using RNAi interference technology (Qiao, J., Liu, H., Xue, P., Hong, M., Guo, X., Xing, Z., Zhao, M., & Zhu, J. (2023). Function of a hydrophobin in growth and development, nitrogen regulation, andabiotic stress resistance of Ganoderma lucidum. FEMS Microbiology Letters, 370, fnad051). Furthermore, the amino acid sequence similarity between Glhyd694 in this invention and hyd1 reported in the literature is only 31.03%. Overall, although multiple hydrophobic protein encoding genes are predicted to exist in the Ganoderma lucidum genome, only the hyd1 gene has been functionally identified so far. Summary of the Invention
[0005] To address the aforementioned problems in existing technologies, the technical problem this invention aims to solve is to provide a Ganoderma lucidum hydrophobic protein gene, Glhyd694. Another technical problem this invention aims to solve is to provide a heterologous recombinant protein of the Ganoderma lucidum Glhyd694 gene. This recombinant protein Glhyd694 can be successfully expressed in *Escherichia coli*, and Ganoderma lucidum mycelia exhibit self-assembly ability at hydrophobic / hydrophilic interfaces, can regulate surface wettability, and possesses good emulsifying properties, showing great potential for applications in the food industry. A further technical problem this invention aims to solve is to provide a silenced strain of the Glhyd694 gene, which can improve the sensitivity of Ganoderma lucidum mycelia to various environmental stresses. Finally, the technical problem this invention aims to solve is to provide a method for promoting the growth rate of Glhyd694-silenced transformants under cell wall stress through exogenous addition of the recombinant protein Glhyd694.
[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0007] A Ganoderma lucidum hydrophobic protein gene, Glhyd694, has the nucleotide sequence shown in SEQ ID NO.1.
[0008] The Ganoderma lucidum hydrophobic protein Glhyd694 gene encodes Glhyd694, and its amino acid sequence is shown in SEQ ID NO.2.
[0009] A recombinant expression vector containing the aforementioned gene.
[0010] A recombinant host cell comprising the recombinant expression vector.
[0011] A method for preparing the Ganoderma lucidum hydrophobic protein Glhyd694 includes the following steps:
[0012] (1) Construct a recombinant expression vector containing the gene;
[0013] (2) The recombinant expression vector is transformed into host cells to obtain recombinant host cells;
[0014] (3) The recombinant host cells are cultured to express the Ganoderma lucidum hydrophobic protein Glhyd694;
[0015] (4) The hydrophobic protein Glhyd694 of Ganoderma lucidum was isolated and purified from the culture product.
[0016] Application of the Ganoderma lucidum hydrophobic protein Glhyd694 in the preparation of surface hydrophobic modified materials or in the self-assembly of films on material surfaces.
[0017] The application of Ganoderma lucidum hydrophobic protein Glhyd694 as an emulsifier or emulsion stabilizer.
[0018] A method for improving the resistance of Ganoderma lucidum mycelium to cell wall stress includes the step of contacting the Ganoderma lucidum hydrophobic protein Glhyd694 with Ganoderma lucidum mycelium, wherein the Ganoderma lucidum mycelium has knocked out the Ganoderma lucidum hydrophobic protein Glhyd694 gene or reduced the expression of Ganoderma lucidum hydrophobic protein Glhyd694.
[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0020] 1) This invention obtains the Ganoderma lucidum hydrophobic protein gene Glhyd694 by cloning, and constructs a heterologous Escherichia coli strain expressing the recombinant protein Glhyd694 and a silenced strain of the Glhyd694 gene in Ganoderma lucidum.
[0021] 2) Soluble expression of the recombinant protein Glhyd694 was successfully achieved in *E. coli*. This recombinant protein exhibits self-assembly ability at hydrophobic / hydrophilic interfaces, significantly altering the wettability of glass slide surfaces, changing them from hydrophilic to hydrophobic; it also possesses good emulsifying properties, with emulsifying stability superior to bovine serum albumin. These results indicate that the recombinant protein Glhyd694 possesses the typical self-assembly characteristics and good emulsifying properties of a class I hydrophobic protein, and has significant application potential in the food industry.
[0022] 3) Silencing the Glhyd694 gene increased the relative growth inhibition rate of Ganoderma lucidum under cell membrane, cell wall, oxidative stress, and salt stress conditions. The exogenous recombinant protein Glhyd694 significantly promoted the growth rate of Ganoderma lucidum mycelia under cell wall stress. These results indicate that this gene plays an important role in Ganoderma lucidum's tolerance to various abiotic stresses, including cell wall stress, cell membrane stress, oxidative stress, and salt stress. Attached Figure Description
[0023] Figure 1 The image shows an electrophoresis diagram of the Glhyd694 gene obtained by PCR amplification from Ganoderma lucidum cDNA (lane M is the DNA marker; lane 1 is the nucleotide fragment of the Glhyd694 gene).
[0024] Figure 2 The image shows the qRT-PCR analysis results of the hydrophobic protein Glhyd694 gene at different developmental stages of Ganoderma lucidum (G1 is the mycelial stage, G2 is the primordium stage, G3 is the young fruiting body stage, and G4 is the mature fruiting body stage).
[0025] Figure 3 Prokaryotic expression vector construction and verification diagram (A is the amplification of the Glhyd694 gene fragment: lane 1 is the Glhyd694 gene fragment, lane M is the DNA marker; B is the double enzyme digestion verification of the recombinant plasmid: lane 1 is the recombinant plasmid, lane 2 is the recombinant plasmid after double enzyme digestion, lane M is the DNA marker).
[0026] Figure 4Experimental diagram for SDS-PAGE detection of recombinant protein Glhyd694 expression and elution conditions (A: SDS-PAGE detection of recombinant protein Glhyd694 expression: lane M is marker; lane 1 is whole E. coli-Glhyd694 cells; lanes 2-4 are total protein, supernatant, and precipitate of E. coli-Glhyd694 cells after sonication; lanes 5-7 are total protein, supernatant, and precipitate of E. coli-pET-32a(+) cells after sonication; B: SDS-PAGE detection of recombinant protein Glhyd694 elution conditions: lane M is marker; lanes 1 and 2 are supernatant and flow-through of E. coli-Glhyd694 cells after sonication; lanes 3-14 are elution conditions after sonication at 20 mM (3, 4), 50 mM (5, 6), 100 mM (7, 8), 200 mM (9, 10, 11) and 250 mM). The product eluted with mM (12, 13, 14) imidazole elution buffer.
[0027] Figure 5 SDS-PAGE and Western blotting results of purified recombinant protein Glhyd694 (A: SDS-PAGE of purified recombinant protein; B: Western blotting analysis of purified recombinant protein; in A and B: lanes 1 and 2 represent different concentrations of recombinant protein; lane 3 is the supernatant of E. coli-pET-32a(+) disrupted by sonication; lane M is the marker).
[0028] Figure 6 Water contact angle measurement and X-ray photoelectron spectroscopy analysis of recombinant protein Glhyd694 (A: water contact angle analysis: a: 20 mM Tris-HCl solution coated slide; b: pET-32a(+) carrier protein coated slide; c: recombinant protein Glhyd694 coated slide; B: XPS detection results).
[0029] Figure 7 The images show the results of emulsification performance testing of recombinant protein Glhyd694 (A is an image of the emulsion system after 24 hours and 72 hours at room temperature; B is a microscopic image of oil droplets under a 20× eyepiece after 72 hours).
[0030] Figure 8 The image shows the verification results of the Glhyd694 gene silencing transformants (A is the PCR amplification of the hygromycin resistance gene fragment; B is the relative expression level of the Glhyd694 gene in wild-type M281 and Glhyd694 silencing strains).
[0031] Figure 9The stress response diagrams for the wild-type M281 and Glhyd694 silenced strains are shown (A shows the growth of the strains after 5 days of culture on PDA medium under different abiotic stresses; B shows the relative growth inhibition rate of all strains under different stresses).
[0032] Figure 10 Images of Ganoderma lucidum strains under cell wall stress (SEM and TEM images: A: SEM; B: TEM).
[0033] Figure 11 The effect of adding recombinant protein Glhyd694 to the exogenous Glhyd694 silent strain on the resistance to cell wall stress is shown in the figure (A is the effect on the resistance to cell wall stress; B is the statistical result of the relative inhibition rate of mycelial growth). Detailed Implementation
[0034] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. Unless otherwise described in detail, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, or are performed according to the kit and product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.
[0035] The Ganoderma lucidum strain ZJ-1 used in this application was published in the academic journal Edible Fungi of China before the application date (Liu Dongmei, Sun Xueyan, Yan Biyun, Chen Zequn, Diao Wentong, Liang Chengyuan. Isolation, identification and biological characteristics analysis of a wild Ganoderma lucidum strain. Edible Fungi of China, 2022, 41(11):18-23.). This strain can be obtained by those skilled in the art through public channels.
[0036] Example 1
[0037] Amplification of the Glhyd694 gene, a hydrophobic protein from Ganoderma lucidum
[0038] A hydrophobic protein gene, Glhyd694, was screened from Ganoderma lucidum. Based on the Glhyd694 gene sequence, primers were designed using Primer Premier 5.0. The forward primer sequence was Glhyd694-F: 5′-ATGTTCGCTCGCTTCGCT-3′ (SEQ ID NO.3); the reverse primer sequence was Glhyd694-R: 5′-TTAGAGCTGGACGGGAAC-3′ (SEQ ID NO.4). Total RNA was extracted from Ganoderma lucidum mycelia using the KK Ultrafast Plant Total RNA Extraction Kit and reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper). PCR amplification was performed using the cDNA as a template, and the amplification products were detected by 1% agarose gel electrophoresis. Figure 1 The PCR product was purified using a purification kit from Sangon Biotech (Shanghai) Co., Ltd. to obtain the target fragment. The purified target fragment was ligated into the TA / Blunt-Zero vector, and the ligation product was then transformed into *E. coli* DH5α competent cells via heat shock. Single colonies of the transformed cells were picked, and positive clones were verified by PCR. The positive clone samples were then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results showed that the obtained Glhyd694 gene nucleotide sequence was 312 bp, as shown in SEQ ID NO.1, and its corresponding amino acid sequence is shown in SEQ ID NO.2.
[0039] Example 2
[0040] qRT-PCR analysis of the hydrophobic protein Glhyd694 gene at different developmental stages of Ganoderma lucidum
[0041] Ganoderma lucidum ZJ-1 was cultured for fruiting in the laboratory. The culture medium consisted of 20% sawdust, 58% cottonseed hulls, 20% wheat bran, 1% sucrose, and 1% gypsum, with a moisture content of approximately 55%–60%. Samples were taken from the mycelial stage (G1), primordium stage (G2), young fruiting body stage (G3), and mature fruiting body stage (G4) of Ganoderma lucidum ZJ-1, with three samples taken from each stage. Following the standard operating procedure of the KK Ultrafast Plant Total RNA Extraction Kit, total RNA was extracted from different parts of Ganoderma lucidum. The RNA was uniformly diluted to 200 ng / µL using nuclease-free water and reverse transcribed into cDNA using the HiScript III RT SuperMix for qPCR (+gDNAwiper) reverse transcription kit. Using β-tubulin as an internal control and reverse-transcribed cDNA as a template, the cDNA was diluted 5-fold and used for qRT-PCR to determine the relative expression level of the hydrophobic protein Glhyd694 gene in Ganoderma lucidum at stages G1, G2, G3, and G4. The primers for quantifying the internal control are as follows: qBTU-F: CAGTTCACGGCGATGTTCA (SEQ ID NO.5); qBTU-R: CGACGGTAGCATCCTGGTA (SEQ ID NO.6); the primers for quantifying the gene are as follows: q694-F: TCGAGGATTCCAACTCTGCG (SEQ ID NO.7); q694-R: GCTGCACTGGAGACCAATCT (SEQ ID NO.8). The qPCR reaction system was 10 μL: 0.5 μL each of upstream and downstream primers, 5 μL of Taq Pro Universal SYBR qPCR Master Mix, 1 μL of cDNA, and 3 μL of ddH2O. PCR was performed using a Bio-Rad CFX Opus 96 real-time PCR instrument. The program was: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 10 s, and 60℃ annealing and extension for a total of 30 s, for a total of 40 cycles. qRT-PCR results showed that the hydrophobic protein Glhyd694 gene was specifically expressed in the hyphal stage. Figure 2 ).
[0042] Example 3
[0043] Construction of a heterologous expression vector for the recombinant hydrophobic protein Glhyd694
[0044] Based on the cDNA sequence of the hydrophobic protein gene Glhyd-694 and the pET-32a(+) vector sequence, primers containing homologous arms were designed using Primer Premier 5.0 software: pET-694-F: GCTGAATATCGGATCCGAATTCGGTTCCTGCAACACTGGGG (SEQ ID NO.9); pET-694-R: GTGGTGGTGGTGGTGCTCGAGTTAGAGCTGGACGGGAACGC (SEQ ID NO.10). The Glhyd694 gene was cloned using Phanta Max super-Fidelity high-fidelity enzyme to obtain the Glhyd694 target fragment without the signal peptide and containing homologous arms. Figure 3 (A) The pET-32a(+) plasmid was double-digested with EcoRI and XhoI restriction endonucleases, and the linearized vector was obtained after gel extraction. The purified target gene fragment and the linearized vector were ligated into the linearized vector using Novizan Exnase II enzyme, and the resulting cells were heat-shocked into E. coli DH5α. Single clones were picked for colony PCR verification, and positive clones were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After sequencing confirmation, the colonies carrying the recombinant plasmid were expanded, and the plasmid was extracted and verified by EcoRI and XhoI digestion, yielding the expected target band (…). Figure 3 The plasmid (B) with correct sequencing and enzyme digestion was transformed into Escherichia coli BL21(DE3) strain.
[0045] Example 4
[0046] Induction, purification, and Western blotting verification of recombinant hydrophobic protein Glhyd694
[0047] The BL21(DE3) strain containing the recombinant plasmid was inoculated into 20 mL of LB liquid medium containing 100 μg / mL Amp and cultured overnight at 37°C and 220 rpm with shaking. The inoculum was then transferred to 400 mL of the same LB liquid medium at a 1% (v / v) inoculation rate and cultured at 37°C and 220 rpm with shaking until OD (dose retardation). 600When the pH value reached 0.4–0.6, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.1 mM, and expression was induced at 16°C and 120 rpm for 20 h. After induction, the bacterial culture was divided into 4 tubes, and the bacterial cells were collected by centrifugation at 8000 rpm for 10 min. The cells were resuspended in PBS buffer and washed twice. The bacterial cells were recovered under the same centrifugation conditions, and residual culture medium was removed. The bacterial pellet in each tube was resuspended in 20 mL of equilibration buffer (0.5 M NaCl, 20 mM Tris-HCl, pH 7.4), and the protease inhibitor PMSF was added to a final concentration of 1 mM. The cells were then sonicated in an ice-water bath (130 W, 20 min, 6 s on / 6 s off). After disruption, the cells were centrifuged at 4°C and 12000 rpm for 20 min, and the supernatant and pellet were collected. At the same time, BL21(DE3) strain carrying the empty vector pET-32a(+) was treated in the same way as a negative control. SDS-PAGE was used to analyze samples before and after induction to verify the expression level and solubility of the target protein. Figure 4 In the A-type protein, compared with the empty vector pET-32a(+), the recombinant protein showed a distinct band of approximately 26 kDa in both the supernatant and the precipitate, which is consistent with the predicted size of the recombinant protein.
[0048] Equilibrate the Ni-NTA column with 20 mL of equilibration buffer, add the supernatant collected after disruption (slow flow rate to ensure binding), and collect the final flow-through. Elute with a gradient of elution buffers containing 20 mM, 50 mM, 100 mM, 200 mM, and 250 mM imidazole (0.5 M NaCl, imidazole, 20 mM Tris-HCl, pH 7.4). Detect the eluent with Coomassie Brilliant Blue G-250 until it no longer turns blue, then switch to the next concentration. Perform SDS-PAGE validation on the collected flow-through and eluent. Based on the SDS-PAGE results, ultrafilter the eluent in a 3 kDa ultrafiltration tube at no more than 6000 rpm, centrifuge at low temperature until only 1 mL of solution remains, add 10 mL of 20 mM Tris-HCl solution, and continue centrifugation. Repeat this process three times for buffer replacement. Results are as follows. Figure 4 As shown in Figure B, 100 mM, 200 mM, and 250 mM imidazole elution buffers can elute the recombinant protein. Western blotting was performed on the purified recombinant protein; after incubation with Anti-His antibody, a clear, specific protein band appeared at approximately 26 kDa. Figure 5 The band size was consistent with the SDS-PAGE results, further confirming that the recombinant protein Glhyd694 was successfully expressed in Escherichia coli BL21(DE3).
[0049] Example 5
[0050] Water contact angle experiment of recombinant hydrophobic protein Glhyd694
[0051] The surface modification ability of the purified recombinant hydrophobic protein Glhyd694 was evaluated by water contact angle (WCA) measurement. Hydrophilic glass slides were used as the hydrophilic substrate. 300–400 μL of a 100 μg / mL recombinant protein solution was evenly spread on the slide surface and incubated overnight at room temperature. The next day, the treated slide surface was gently rinsed with deionized water to remove unbound protein, and then allowed to air dry at room temperature. Slides treated with pET-32a(+) empty carrier protein solution and 20 mM Tris-HCl solution were used as controls. The water contact angle of all treated samples was measured using a JY-82C contact angle meter. During measurement, 5 μL of distilled water was added to the sample surface, and three different areas of each sample were selected for parallel measurements. The average value was taken as the final water contact angle value. Figure 6 As shown in Figure A, compared with slides treated with Tris-HCl solution and pET-32(+) protein solution, the water droplets formed after adding 5 μL of distilled water to the slide surface treated with recombinant hydrophobic protein Glhyd694 were more rounded and had a stronger three-dimensional effect, with a significantly increased water contact angle. Specifically, the WCA value of the slide after coating with recombinant protein was 113.67°, which was 54.3% higher than the WCA value of the empty carrier protein pET-32(+) treatment group and 168.53% higher than the WCA value of the 20 mM Tris-HCl buffer treatment group. This indicates that the recombinant hydrophobic protein Glhyd694 can successfully modify the hydrophilic slide surface into a hydrophobic surface, confirming its good self-assembly properties and surface modification ability.
[0052] Example 6
[0053] XPS experiments on recombinant hydrophobic protein Glhyd694
[0054] Because hydrophobic proteins possess significant self-assembly properties, they can alter interfacial hydrophilicity or hydrophobicity by forming complete protein films. X-ray photoelectron spectroscopy (XPS) was performed to determine the elemental composition of silicon wafer surfaces with and without recombinant protein coating. A 100 μg / mL recombinant protein solution was spread onto 0.5 cm × 0.5 cm silicon wafers and left to stand overnight at room temperature, then rinsed with deionized water and dried at room temperature. Silicon wafers treated with 20 mM Tris-HCl buffer served as controls. The elemental composition of the silicon wafer surfaces was analyzed using a Thermo Fisher ESCALAB 250Xi instrument. Figure 6As shown in Figure B, compared with the control, the silicon wafer surface modified with recombinant protein Glhyd694 showed varying degrees of decrease in Si and O element content, with Si2p signal intensity decreasing by 47.81% and O1s decreasing by 15.01%. However, the content of N and C elements, representing proteins, increased significantly, with N1s signal intensity increasing by 118.91% and C1s signal intensity increasing by 36.87%. These results further demonstrate that recombinant protein Glhyd694 does indeed possess self-assembly properties and successfully assembled into a protein film on the hydrophobic silicon wafer surface, altering the elemental composition of the silicon wafer surface.
[0055] Example 7
[0056] Emulsifying properties of recombinant hydrophobic protein Glhyd694
[0057] The emulsifying properties of the recombinant hydrophobic protein Glhyd694 were evaluated by observing the stability and microscopic morphology of the emulsion system. 1 mL of recombinant hydrophobic protein solution, empty vector pET-32a(+) protein solution, and bovine serum albumin (BSA) control solution (all concentrations 100 μg / mL) were added to 2 mL glass vials. Subsequently, 80 μL of soybean oil was added to each treatment, and the mixture was homogenized by sonication for 1 min at room temperature (130 W, 3 s on / 3 s off) to form an emulsion. The emulsions were allowed to stand at room temperature, and images of their appearance and microscopic observations were taken after 24 h and 72 h, respectively. Figure 7 As shown in Figure A, after 24 hours of standing, there were no significant differences among the groups; after 72 hours of standing, the control group without hydrophobic proteins and other emulsion systems showed obvious stratification, while the emulsion system formed by the dispersion of recombinant protein Glhyd694 remained stable, with significantly better stability than the BSA group. Microscopic observation ( Figure 7 Figure B shows that, compared with other systems, recombinant protein Glhyd694 forms more emulsion droplets with smaller particle sizes. These results indicate that recombinant protein Glhyd694 has good emulsifying activity and emulsion stability, demonstrating excellent emulsifying performance.
[0058] Example 8
[0059] Construction of a silencing vector for the hydrophobic protein Glhyd694 in Ganoderma lucidum
[0060] Based on the cDNA sequence of the hydrophobic protein gene Glhyd-694 and the sequence of the silencing vector pAN7-ura3-dual, primers containing homologous arms, RNAi-694-F: actcttcatccccctggtaccGTTCTCTTCTCCCTCCCCATCC (SEQ ID NO.11) and RNAi-694-R: gcgcacaggcggagaactagtCTGGCCGGTGATGTCCTGC (SEQ ID NO.12), were designed using Primer Premier 5.0 software to amplify the Glhyd694 fragment containing homologous arms. The amplification products were detected by electrophoresis and purified. The silencing vector pAN7-ura3-dual was double-digested with BcuI and KpnI restriction endonucleases, and the linearized vector was obtained by gel extraction. The purified target gene fragment and the linearized vector were ligated using Exnase II enzyme for homologous recombination, and the resulting cells were heat-shock transformed into E. coli DH5α. Single clones were selected for colony PCR verification, and clones that tested positive by PCR were sequenced. After confirming the sequencing results were correct, the colonies carrying the recombinant plasmid were amplified and cultured, and then the plasmid was extracted for later use.
[0061] Example 9
[0062] Liposome-mediated transformation of Ganoderma lucidum protoplasts
[0063] The protoplasts of Ganoderma lucidum strain ZJ-1 were prepared as follows: Ganoderma lucidum ZJ-1 mycelial blocks were inoculated onto PDA medium lined with sterile cellophane and cultured statically at 28℃ for 5 days. Fresh mycelia were scraped and added to PDB liquid medium, homogenized, and cultured at 28℃ with shaking for 3–5 days (180 rpm). Mycelia were collected by centrifugation at 8000 rpm for 15 min at room temperature, rinsed twice with sterile water, and collected by centrifugation each time. After drying the surface moisture of the mycelia, they were transferred to 50 mL sterile centrifuge tubes. 1 mL of 1.5% lysozyme solution was added to every 300 mg of wet mycelia, and the mycelia were gently dispersed by pipetting. The tubes were placed in a 32℃ water bath for 3 h of enzymatic hydrolysis, gently shaken once every 30 min to ensure complete hydrolysis. The hydrolysate was filtered through sterile cotton to remove undigested mycelial residue. The filtrate was rinsed twice with 0.6 M mannitol solution. The filtrate was dispensed into 1.5 mL sterile centrifuge tubes and centrifuged at 4℃ for 5000 rpm. Centrifuge at rpm for 15 min, discard the supernatant and collect the protoplast precipitate; wash the precipitate once with 0.6 M mannitol solution, centrifuge again, resuspend in an appropriate amount of the same solution, calculate the protoplast concentration using a hemocytometer, and dilute to 10⁻⁶. 6 ~10 7Cells / mL were evenly spread on regeneration plates (PDA + 0.6 M mannitol). The plates were incubated at 28 °C until protoplasts regenerated and formed single colonies. Single colonies were picked and observed under a microscope to screen for monokaryotic hyphae, which were named M281.
[0064] Using the same protoplast preparation method described above, protoplasts of Ganoderma M281 were prepared. The protoplast concentration was calculated using a hemocytometer and diluted to 10⁻⁶. 6 ~10 7 Prepare 5 μL of recombinant plasmid with 5 μL of liposomes (Lipofectamine 3000, Invitrogen) and incubate at 4°C for 0.5–1 h. Then, add 100 μL of protoplasts to the incubated mixture and incubate again at 4°C for 0.5–1 h. Spread the incubated mixture onto CYM regeneration medium (2% glucose, 1% maltose, 0.2% yeast extract, 0.2% peptone, 0.05% MgSO4·7H2O, 0.46% KH2PO4, 0.6 M mannitol) containing 100 μg / mL hygromycin in a clean bench and incubate at 28°C inverted mode for approximately two weeks, observing cell growth.
[0065] Example 10
[0066] Validation of the hydrophobic protein Glhyd694 silencing strain
[0067] White mycelial blocks were picked from CYM medium and transferred to PDA plates containing 100 μg / mL hygromycin resistance for secondary screening, repeated twice. Genomic DNA was extracted from the transformants obtained from the secondary screening and amplified by PCR using primers Hpt-F: CTCGGAGGGCGAAGAATCTC (SEQ ID NO.13) and Hpt-R: AATACGAGGTCGCCAACATC (SEQ ID NO.14). Figure 8As shown in Figure A, the three transformants RNAi-694-12, RNAi-694-14, and RNAi-694-16 all amplified the expected hygromycin-specific band. This result proves that the silencing vector of the Glhyd694 gene has been successfully integrated into the genome of Ganoderma M281. To further verify the gene silencing effect of the screened transformants, total RNA was extracted from M281 and its RNAi-694-12, RNAi-694-14, and RNAi-694-16 transformants, and reverse transcribed, followed by qRT-PCR analysis. Statistical analysis showed that the expression levels of Glhyd694 in the RNAi-694-12, RNAi-694-14, and RNAi-694-16 silenced transformants were significantly different from the control group, with silencing efficiencies of 39.6%, 33.1%, and 41.1%, respectively. Figure 8 (B). The results in summary indicate that the silenced strain of the Glhyd694 gene was successfully constructed.
[0068] Example 11
[0069] Stress experiment on silenced strain Glhyd694
[0070] To assess the effects of cell wall stress, cell membrane stress, oxidative stress, and salt stress on mycelial growth, mycelial blocks with a diameter of 7 mm were taken from wild-type strains M281 and silenced strain Glhyd694. These blocks were inoculated into the center of normal PDA medium and PDA medium supplemented with Congo red (CR) (400 mg / L), sodium dodecyl sulfate (SDS) (0.01%), hydrogen peroxide (8 mM), and sodium chloride (0.2 M). The media were incubated at 28°C inverted for 5 days. After incubation, colony diameters were measured and photographed. The relative inhibition rate of mycelial growth was calculated using the formula (Dc-Dt) / Dc×100% (where Dc is the colony diameter of the blank control and Dt is the colony diameter after treatment). Each group was replicated at least three times. The results showed that on normal PDA medium, there was no significant difference in mycelial morphology between the silenced transformants and M281 mycelia. Figure 9 (A). Compared with normal PDA culture conditions, the growth of Glhyd694 silent transformants was inhibited under stress conditions ( Figure 9(B) Under cell membrane stress induced by 0.01% SDS and oxidative stress induced by 8 mM H2O2, the growth inhibition rates of the three silenced strains RNAi-694-12, RNAi-694-14, and RNAi-694-16 were significantly higher than those of strain M281. Under cell wall stress induced by Congo red (CR) (400 mg / L) and salt stress induced by 0.2 M NaCl, the overall growth inhibition rates of the silenced strains were higher than those of strain M281, with RNAi-694-14 and RNAi-694-16 showing statistically significant differences. These results indicate that the Glhyd694 gene has an effect on Ganoderma lucidum under cell membrane stress, cell wall stress, oxidative stress, and salt stress.
[0071] Example 12
[0072] Observation of the silenced strain Glhyd694 under cell wall stress using scanning electron microscopy and transmission electron microscopy
[0073] To understand the effects of the Glhyd694 gene on hyphal morphology and cell wall structure under cell wall stress, strains M281 and the silenced strain RNAi-694-16 were inoculated onto PDA medium containing 400 mg / L Congo red and cultured at 28°C for 5 days. 1×3 mm hyphal blocks were cut, fixed overnight at 4°C with commercial fixative from Seville Biotechnology, and then sent to Seville Biotechnology for scanning electron microscopy (SEM) and transmission electron microscopy (TEM) observation. SEM samples underwent post-fixation, gradient dehydration, critical drying, and conductivity treatment before being observed and images acquired using a SU8100 scanning electron microscope. SEM results showed that the hyphae of the silenced strain RNAi-694-16 were more slender than those of the wild-type strain M281. Figure 10 (A). TEM samples were post-fixed, dehydrated in a gradient, infiltration-embedded, polymerized, ultrathinly sectioned, and stained before being observed and images acquired using an HT7800 transmission electron microscope. TEM results showed no significant difference in cell wall thickness between the two strains. Figure 10 (B) In summary, under Congo red-induced cell wall stress, Glhyd694 mainly participates in maintaining normal hyphal morphology and does not regulate the structural thickness of hyphal cell walls.
[0074] Example 13
[0075] Effects of exogenous addition of recombinant protein Glhyd694 on the growth of Ganoderma lucidum mycelium under cell wall stress
[0076] The recombinant protein Glhyd694 was expressed and purified according to the method in Example 4, with the only modification being the adjustment of the NaCl concentration in the elution buffer to 0.2 M. The elution buffer at a concentration of 200 mM imidazole was collected and used directly for subsequent experiments without further concentration. An experimental and control group were set up, both using 9 cm diameter PDA plates containing 400 mg / L Congo red (simulating cell wall stress). In the experimental group, 600 μL of recombinant protein Glhyd694 at a concentration of 100 μg / mL was evenly spread on the surface of the PDA plate, while the control group was spread with the same volume and composition of elution buffer (without recombinant protein). Each experiment had three biological replicates. Subsequently, hyphal blocks of the silenced Glhyd694 strain were inoculated into the control and experimental plates, respectively, and cultured at 28°C in the dark for 14 days. The colony diameter was then measured. The results showed that, compared with the control group, the hyphal growth rate of the three silenced Glhyd694 strains in the experimental plates was significantly increased. Figure 11 This indicates that the exogenous addition of recombinant protein Glhyd694 can effectively enhance the tolerance of Ganoderma lucidum hyphae to cell wall stress.
[0077] The above description is illustrative only and not restrictive of the present invention. Those skilled in the art will understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all such modifications, variations or equivalents will fall within the protection scope of the present invention.
Claims
1. A Ganoderma lucidum hydrophobic protein Glhyd694 gene, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.
1.
2. The Ganoderma lucidum hydrophobic protein Glhyd694 encoded by the Ganoderma lucidum hydrophobic protein Glhyd694 gene according to claim 1, characterized in that, Its amino acid sequence is shown in SEQ ID NO.
2.
3. A recombinant expression vector, characterized in that, It contains the gene as described in claim 1.
4. A recombinant host cell, characterized in that, It includes the recombinant expression vector as described in claim 3.
5. A method for preparing the Ganoderma lucidum hydrophobic protein Glhyd694 according to claim 2, characterized in that, Includes the following steps: (1) Construct a recombinant expression vector containing the gene described in claim 1; (2) The recombinant expression vector is transformed into host cells to obtain recombinant host cells; (3) The recombinant host cells are cultured to express the Ganoderma lucidum hydrophobic protein Glhyd694; (4) The hydrophobic protein Glhyd694 of Ganoderma lucidum was isolated and purified from the culture product.
6. The application of the Ganoderma lucidum hydrophobic protein Glhyd694 as described in claim 2 in the preparation of surface hydrophobic modified materials or in the self-assembly of films on the surface of materials.
7. The use of the Ganoderma lucidum hydrophobic protein Glhyd694 as described in claim 2 as an emulsifier or emulsion stabilizer.
8. A method for improving the resistance of Ganoderma lucidum mycelium to cell wall stress, characterized in that, The method includes the step of contacting the Ganoderma lucidum hydrophobic protein Glhyd694 as described in claim 2 with Ganoderma lucidum mycelium, wherein the Ganoderma lucidum mycelium knocks out the Ganoderma lucidum hydrophobic protein Glhyd694 gene or reduces the expression of Ganoderma lucidum hydrophobic protein Glhyd694.