Compositions and methods of inhibiting sodium voltage-gated channel alpha subunit 9 (SCN9A) expression
By using double-stranded ribonucleic acid (dsRNA) agents to target SCN9A mRNA, the problem of selectively inhibiting the expression of sodium voltage-gated channel α subunit 9 (SCN9A) in existing technologies has been solved, achieving selective inhibition of the SCN9A gene and providing a new method for treating SCN9A-related diseases and pain.
Patent Information
- Application Number
- CN202480073719.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-09-29
- Filing Date
- 2024-11-20
- Publication Date
- 2026-06-23
Smart Images

Figure SMS_1 
Figure SMS_5 
Figure SMS_11
Abstract
Description
Technical Field
[0001] This invention relates in part to compositions and methods that can be used to suppress the expression of the sodium voltage-gated channel α subunit 9 (SCN9A) gene. BACKGROUND
[0003] Neuronal sodium channels are encoded by a family of genes, one of which is called sodium voltage-gated channel α subunit 9 (SCN9A). Studies have found that SCN9A is expressed to varying degrees in all 27 different tissues. The highest expression of SCN9A in non-neuronal tissues is found in the testes, placenta, and colon. Nav1.7 is the sodium channel protein expressed by the SCN9A gene. Genetic studies have linked sodium channel isoforms to human pain syndromes. Pain signals transmitted to the brain are facilitated by Nav1.7 pain receptors, which are preferentially expressed on neurons belonging to the peripheral nervous system. Loss-of-function mutations in Nav1.7 result in analgesia, while enhancement-of-function mutations result in hyperalgesia. Due to the high conservation of functional regions among different sodium channels, there are few reports of small molecule inhibitors exhibiting meaningful selectivity for Nav1.7 in sodium channel isoforms. Achieving penetration of selective small molecule Nav1.7 inhibitors into the central nervous system is also challenging.
[0004] Therefore, siRNA therapy that silences SCN9A represents a new approach to treating SCN9A-related diseases and providing patients with a variety of effective pain relief methods. Summary of the Invention
[0005] In general, this disclosure provides novel SCN9A gene-specific RNAi agents, compositions comprising SCN9A RNAi agents, and methods for inhibiting SCN9A gene expression in vitro and / or in vivo using the SCN9A RNAi agents and compositions comprising SCN9A RNAi agents described herein. The SCN9A RNAi agents described herein can selectively and effectively reduce, inhibit, or silence SCN9A gene expression in subjects (e.g., human or animal subjects).
[0006] According to one aspect of the present invention, a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of sodium voltage-gated channel α subunit 9 (SCN9A) is provided, wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 1, 3, 5 or 7 by no more than 1, 2 or 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO: 2, 4, 6 or 8 by no more than 1, 2 or 3 nucleotides, wherein the sense strand and the antisense strand may be partially, substantially, or completely complementary.
[0007] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region partially complementary to the mRNA encoding SCN9A, the complementary region comprising at least 15, 16, 17, 18, or 19 consecutive nucleotides with 0, 1, 2, 3, 4, or 5 mismatches. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region complementary to the target region of the SCN9A mRNA transcript, the complementary region comprising at least 15, 16, 17, 18, or 19 consecutive nucleotides with 0, 1, 2, 3, 4, or 5 mismatches.
[0008] In some embodiments, the SCN9A mRNA transcript is SEQ ID NO: 1.
[0009] In some embodiments, the target region of the SCN9A mRNA transcript is SEQ ID. The nucleotides of NO:1 are 281-301, 287-307, 289-309, 320-340, 339-359, 356-376, 368-388, 371-391, 387-407, 389-409, 390-410, 452-472, 476-496, 499-519, 553-573, 556-576, 558-578, 559-579, 564-584, 568-588, 569-589, 579-599, 580-600, 581-601, 583-603, 584-604, 603-623, 604-624, 606-626, and 6. 08-628, 609-629, 614-634, 618-638, 622-642, 625-645, 626-646, 627-647, 628-648, 629-649, 630-650, 632-652, 633-653, 635-655, 636-656, 637-657, 638-658, 639-659, 640-660, 642-662, 643-663, 652-672, 653-673, 658-678, 660-680, 663-683, 676-696, 679-699, 685-705, 688-708, 68 9-709, 692-712, 694-714, 695-715, 697-717, 705-725, 709-729, 711-731, 712-732, 713-733, 715-735, 749-769, 751-771, 761-781, 764-784, 786-806, 796-816, 799-819, 802-822, 829-849, 859-879, 863-883, 865-885, 868-888, 869-889, 870-890, 871-891, 874-894, 1036-1056, 1039-1059 1066-1086, 1068-1088, 1069-1089, 1071-1091, 1072-1092, 1073-1093, 1099-1119, 1149-1169, 1156-1176, 1158-1178, 1160-1180, 1179-1199, 1220-1240, 1223-1243, 1225-1245, 1230-1250, 1286-1306, 1298-1318, 1302-1322, 1304-1324, 1318-1338, 1347-1367, 1351-1371, 1352-1372,1357-1377、1366-1386、1371-1391、1374-1394、1379-1399、1384-1404、1385-1405、1427-1447、1428-1448、1429-1449、1431-1451、1432-1452、1433-1453、1455-1475、1459-1479、1460-1480、1461-1481、1525-1545、1528-1548、1529-1549、1531-1551、1532-1552、1561-1581、1582-1602、1598-1618、1628-1648、1636-1656、1647-1667、1670-1690、1671-1691、1673-1693、1674-1694、1676-1696、1682-1702、1683-1703、1684-1704、1690-1710、1695-1715、1702-1722、1703-1723、1706-1726、1823-1843、1828-1848、1870-1890、1911-1931、1914-1934、1917-1937、1919-1939、1920-1940、1946-1966、1949-1969、1950-1970、1951-1971、1952-1972、1955-1975、1956-1976、1976-1996、1978-1998、1979-1999、1981-2001、1983-2003、1991-2011、1995-2015、1997-2017、2012-2032、2017-2037、2020-2040、2024-2044、2140-2160、2147-2167、2152-2172、2278-2298、2290-2310、2292-2312、2293-2313、2301-2321、2321-2341、2323-2343、2326-2346、2355-2375、2360-2380、2365-2385、2370-2390、2371-2391、2373-2393、2377-2397、2378-2398、2395-2415、2403-2423、2405-2425、2412-2432、2417-2437、2436-2456、2439-2459、2448-2468、2449-2469、2450-2470、2454-2474、2455-2475、2457-2477、2472-2492、2474-2494、2475-2495、2485-2505、2493-2513、2504-2524、2507-2527、2514-2534、2515-2535、2516-2536、2522-2542、2524-2544、2525-2545、2526-2546、2530-2550、2531-2551、2535-2555、2540-2560、2542-2562、2543-2563、2544-2564、2551-2571、2552-2572、2553-2573、2565-2585、2566-2586、2567-2587、2569-2589、2573-2593、2602-2622、2611-2631、2615-2635、2618-2638、2624-2644、2627-2647、2629-2649、2636-2656、2638-2658、2639-2659、2641-2661、2648-2668、2652-2672、2659-2679、2662-2682、2664-2684、2669-2689、2671-2691、2675-2695、2684-2704、2688-2708、2691-2711、2693-2713、2694-2714、2696-2716、2697-2717、2698-2718、2709-2729、2732-2752、2734-2754、2738-2758、2739-2759、2740-2760、2745-2765、2759-2779、2761-2781、2788-2808、2820-2840、2821-2841、2841-2861、2842-2862、2847-2867、2848-2868、2850-2870、2851-2871、2854-2874、2855-2875、2858-2878、2859-2879、2860-2880、2861-2881、2862-2882、2863-2883、3122-3142、3124-3144、3127-3147、3128-3148、3129-3149、3133-3153、3134-3154、3136-3156、3139-3159、3141-3161、3142-3162、3170-3190、3171-3191、3172-3192、3173-3193、3176-3196、3177-3197、3178-3198、3179-3199、3180-3200、3182-3202、3183-3203、3184-3204、3185-3205、3203-3223、3204-3224、3206-3226、3209-3229、3210-3230、3214-3234、3215-3235、3218-3238、3220-3240、3221-3241、3223-3243、282-300、288-306、290-308、321-339、340-358、357-375、369-387、372-390、388-406、390-408、391-409、453-471、477-495、500-518、554-572、557-575、559-577、560-578、565-583、569-587、570-588、580-598、581-599、582-600、584-602、585-603、604-622、605-623、607-625、609-627、610-628、615-633、619-637、623-641、626-644、627-645、628-646、629-647、630-648、631-649、633-651、634-652、636-654、637-655、638-656、639-657、640-658、641-659、643-661、644-662、653-671、654-672、659-677、661-679、664-682、677-695、680-698、686-704、689-707、690-708、693-711、695-713、696-714、698-716、706-724、710-728、712-730、713-731、714-732、716-734、750-768、752-770、762-780、765-783、787-805、797-815、800-818、803-821、830-848、860-878、864-882、866-884、869-887、870-888、871-889、872-890、875-893、1037-1055、1040-1058、1067-1085、1069-1087、1070-1088、1072-1090、1073-1091、1074-1092、1100-1118、1150-1168、1157-1175、1159-1177、1161-1179、1180-1198、1221-1239、1224-1242、1226-1244、1231-1249、1287-1305、1299-1317、1303-1321、1305-1323、1319-1337、1348-1366、1352-1370、1353-1371、1358-1376、1367-1385、1372-1390、1375-1393、1380-1398、1385-1403、1386-1404、1428-1446、1429-1447、1430-1448、1432-1450、1433-1451、1434-1452、1456-1474、1460-1478、1461-1479、1462-1480、1526-1544、1529-1547、1530-1548、1532-1550、1533-1551、1562-1580、1583-1601、1599-1617、1629-1647、1637-1655、1648-1666、1671-1689、1672-1690、1674-1692、1675-1693、1677-1695、1683-1701、1684-1702、1685-1703、1691-1709、1696-1714、1703-1721、1704-1722、1707-1725、1824-1842、1829-1847、1871-1889、1912-1930、1915-1933、1918-1936、1920-1938、1921-1939、1947-1965、1950-1968、1951-1969、1952-1970、1953-1971、1956-1974、1957-1975、1977-1995、1979-1997、1980-1998、1982-2000、1984-2002、1992-2010、1996-2014、1998-2016、2013-2031、2018-2036、2021-2039、2025-2043、2141-2159、2148-2166、2153-2171、2279-2297、2291-2309、2293-2311、2294-2312、2302-2320、2322-2340、2324-2342、2327-2345、2356-2374、2361-2379、2366-2384、2371-2389、2372-2390、2374-2392、2378-2396、2379-2397、2396-2414、2404-2422、2406-2424、2413-2431、2418-2436、2437-2455、2440-2458、2449-2467、2450-2468、2451-2469、2455-2473、2456-2474、2458-2476、2473-2491、2475-2493、2476-2494、2486-2504、2494-2512、2505-2523、2508-2526、2515-2533、2516-2534、2517-2535、2523-2541、2525-2543、2526-2544、2527-2545、2531-2549、2532-2550、2536-2554、2541-2559、2543-2561、2544-2562、2545-2563、2552-2570、2553-2571、2554-2572、2566-2584、2567-2585、2568-2586、2570-2588、2574-2592、2603-2621、2612-2630、2616-2634、2619-2637、2625-2643、2628-2646、2630-2648、2637-2655、2639-2657、2640-2658、2642-2660、2649-2667、2653-2671、2660-2678、2663-2681、2665-2683、2670-2688、2672-2690、2676-2694、2685-2703、2689-2707、2692-2710、2694-2712、2695-2713、2697-2715、2698-2716、2699-2717、2710-2728、2733-2751、2735-2753、2739-2757、2740-2758、2741-2759、2746-2764、2760-2778、2762-2780、2789-2807、2821-2839、2822-2840、2842-2860、2843-2861、2848-2866、2849-2867、2851-2869、2852-2870、2855-2873、2856-2874、2859-2877、2860-2878、2861-2879、2862-2880、2863-2881、2864-2882、3123-3141、3125-3143、3128-3146、3129-3147、3130-3148、3134-3152、3135-3153、3137-3155、3140-3158、3142-3160、3143-3161、3171-3189、3172-3190、3173-3191、3174-3192、3177-3195、3178-3196、3179-3197、3180-3198、3181-3199、3183-3201、3184-3202、3185-3203、3186-3204、3204-3222、3205-3223、3207-3225、3210-3228、3211-3229、3215-3233、3216-3234、3219-3237、3221-3239、3222-3240、3224-3242、279-303、285-309、287-311、318-342、337-361、354-378、366-390、369-393、385-409、387-411、388-412、450-474、474-498、497-521、551-575、554-578、556-580、557-581、562-586、566-590、567-591、577-601、578-602、579-603、581-605、582-606、601-625、602-626、604-628、606-630、607-631、612-636、616-640、620-644、623-647、624-648、625-649、626-650、627-651、628-652、630-654、631-655、633-657、634-658、635-659、636-660、637-661、638-662、640-664、641-665、650-674、651-675、656-680、658-682、661-685、674-698、677-701、683-707、686-710、687-711、690-714、692-716、693-717、695-719、703-727、707-731、709-733、710-734、711-735、713-737、747-771、749-773、759-783、762-786、784-808、794-818、797-821、800-824、827-851、857-881、861-885、863-887、866-890、867-891、868-892、869-893、872-896、1034-1058、1037-1061、1064-1088、1066-1090、1067-1091、1069-1093、1070-1094、1071-1095、1097-1121、1147-1171、1154-1178、1156-1180、1158-1182、1177-1201、1218-1242、1221-1245、1223-1247、1228-1252、1284-1308、1296-1320、1300-1324、1302-1326、1316-1340、1345-1369、1349-1373、1350-1374、1355-1379、1364-1388、1369-1393、1372-1396、1377-1401、1382-1406、1383-1407、1425-1449、1426-1450、1427-1451、1429-1453、1430-1454、1431-1455、1453-1477、1457-1481、1458-1482、1459-1483、1523-1547、1526-1550、1527-1551、1529-1553、1530-1554、1559-1583、1580-1604、1596-1620、1626-1650、1634-1658、1645-1669、1668-1692、1669-1693、1671-1695、1672-1696、1674-1698、1680-1704、1681-1705、1682-1706、1688-1712、1693-1717、1700-1724、1701-1725、1704-1728、1821-1845、1826-1850、1868-1892、1909-1933、1912-1936、1915-1939、1917-1941、1918-1942、1944-1968、1947-1971、1948-1972、1949-1973、1950-1974、1953-1977、1954-1978、1974-1998、1976-2000、1977-2001、1979-2003、1981-2005、1989-2013、1993-2017、1995-2019、2010-2034、2015-2039、2018-2042、2022-2046、2138-2162、2145-2169、2150-2174、2276-2300、2288-2312、2290-2314、2291-2315、2299-2323、2319-2343、2321-2345、2324-2348、2353-2377、2358-2382、2363-2387、2368-2392、2369-2393、2371-2395、2375-2399、2376-2400、2393-2417、2401-2425、2403-2427、2410-2434、2415-2439、2434-2458、2437-2461、2446-2470、2447-2471、2448-2472、2452-2476、2453-2477、2455-2479、2470-2494、2472-2496、2473-2497、2483-2507、2491-2515、2502-2526、2505-2529、2512-2536、2513-2537、2514-2538、2520-2544、2522-2546、2523-2547、2524-2548、2528-2552、2529-2553、2533-2557、2538-2562、2540-2564、2541-2565、2542-2566、2549-2573、2550-2574、2551-2575、2563-2587、2564-2588、2565-2589、2567-2591、2571-2595、2600-2624、2609-2633、2613-2637、2616-2640、2622-2646、2625-2649、2627-2651、2634-2658、2636-2660、2637-2661、2639-2663、2646-2670、2650-2674、2657-2681、2660-2684、2662-2686、2667-2691、2669-2693、2673-2697、2682-2706、2686-2710、2689-2713、2691-2715、2692-2716、2694-2718、2695-2719、2696-2720、2707-2731、2730-2754、2732-2756、2736-2760、2737-2761、2738-2762、2743-2767、2757-2781、2759-2783、2786-2810、2818-2842、2819-2843、2839-2863、2840-2864、2845-2869、2846-2870、2848-2872、2849-2873、2852-2876、2853-2877、2856-2880、2857-2881、2858-2882、2859-2883、2860-2884、2861-2885、3120-3144、3122-3146、3125-3149、3126-3150、3127-3151、3131-3155、3132-3156、3134-3158、3137-3161、3139-3163、3140-3164、3168-3192、3169-3193、3170-3194、3171-3195、3174-3198、3175-3199、3176-3200、3177-3201、3178-3202、3180-3204、3181-3205、3182-3206、3183-3207、3201-3225、3202-3226、3204-3228、3207-3231、3208-3232、3212-3236、3213-3237、3216-3240、3218-3242、3219-3243、3221-3245、276-306、282-312、284-314、315-345、334-364、351-381、363-393、366-396、382-412、384-414、385-415、447-477、471-501、494-524、548-578、551-581、553-583、554-584、559-589、563-593、564-594、574-604、575-605、576-606、578-608、579-609、598-628、599-629、601-631、603-633、604-634、609-639、613-643、617-647、620-650、621-651、622-652、623-653、624-654、625-655、627-657、628-658、630-660、631-661、632-662、633-663、634-664、635-665、637-667、638-668、647-677、648-678、653-683、655-685、658-688、671-701、674-704、680-710、683-713、684-714、687-717、689-719、690-720、692-722、700-730、704-734、706-736、707-737、708-738、710-740、744-774、746-776、756-786、759-789、781-811、791-821、794-824、797-827、824-854、854-884、858-888、860-890、863-893、864-894、865-895、866-896、869-899、1031-1061、1034-1064、1061-1091、1063-1093、1064-1094、1066-1096、1067-1097、1068-1098、1094-1124、1144-1174、1151-1181、1153-1183、1155-1185、1174-1204、1215-1245、1218-1248、1220-1250、1225-1255、1281-1311、1293-1323、1297-1327、1299-1329、1313-1343、1342-1372、1346-1376、1347-1377、1352-1382、1361-1391、1366-1396、1369-1399、1374-1404、1379-1409、1380-1410、1422-1452、1423-1453、1424-1454、1426-1456、1427-1457、1428-1458、1450-1480、1454-1484、1455-1485、1456-1486、1520-1550、1523-1553、1524-1554、1526-1556、1527-1557、1556-1586、1577-1607、1593-1623、1623-1653、1631-1661、1642-1672、1665-1695、1666-1696、1668-1698、1669-1699、1671-1701、1677-1707、1678-1708、1679-1709、1685-1715、1690-1720、1697-1727、1698-1728、1701-1731、1818-1848、1823-1853、1865-1895、1906-1936、1909-1939、1912-1942、1914-1944、1915-1945、1941-1971、1944-1974、1945-1975、1946-1976、1947-1977、1950-1980、1951-1981、1971-2001、1973-2003、1974-2004、1976-2006、1978-2008、1986-2016、1990-2020、1992-2022、2007-2037、2012-2042、2015-2045、2019-2049、2135-2165、2142-2172、2147-2177、2273-2303、2285-2315、2287-2317、2288-2318、2296-2326、2316-2346、2318-2348、2321-2351、2350-2380、2355-2385、2360-2390、2365-2395、2366-2396、2368-2398、2372-2402、2373-2403、2390-2420、2398-2428、2400-2430、2407-2437、2412-2442、2431-2461、2434-2464、2443-2473、2444-2474、2445-2475、2449-2479、2450-2480、2452-2482、2467-2497、2469-2499、2470-2500、2480-2510、2488-2518、2499-2529、2502-2532、2509-2539、2510-2540、2511-2541、2517-2547、2519-2549、2520-2550、2521-2551、2525-2555、2526-2556、2530-2560、2535-2565、2537-2567、2538-2568、2539-2569、2546-2576、2547-2577、2548-2578、2560-2590、2561-2591、2562-2592、2564-2594、2568-2598、2597-2627、2606-2636、2610-2640、2613-2643、2619-2649、2622-2652、2624-2654、2631-2661、2633-2663、2634-2664、2636-2666、2643-2673、2647-2677、2654-2684、2657-2687、2659-2689、2664-2694、2666-2696、2670-2700、2679-2709、2683-2713、2686-2716、2688-2718、2689-2719、2691-2721、2692-2722、2693-2723、2704-2734、2727-2757、2729-2759、2733-2763、2734-2764、2735-2765、2740-2770、2754-2784、2756-2786、2783-2813、2815-2845、2816-2846、2836-2866、2837-2867、2842-2872、2843-2873、2845-2875、2846-2876、2849-2879、2850-2880、2853-2883、2854-2884、2855-2885、2856-2886、2857-2887、2858-2888、3117-3147、3119-3149、3122-3152、3123-3153、3124-3154、3128-3158、3129-3159、3131-3161、3134-3164、3136-3166、3137-3167、3165-3195、3166-3196、3167-3197、3168-3198、3171-3201、3172-3202、3173-3203、3174-3204、3175-3205、3177-3207、3178-3208、3179-3209、3180-3210、3198-3228、3199-3229、3201-3231、3204-3234、3205-3235、3209-3239、3210-3240、3213-3243、3215-3245、3216-3246、3218-3248、283-301、289-307、291-309、322-340、341-359、358-376、370-388、373-391、389-407、391-409、392-410、454-472、478-496、501-519、555-573、558-576、560-578、561-579、566-584、570-588、571-589、581-599、582-600、583-601、585-603、586-604、605-623、606-624、608-626、610-628、611-629、616-634、620-638、624-642、627-645、628-646、629-647、630-648、631-649、632-650、634-652、635-653、637-655、638-656、639-657、640-658、641-659、642-660、644-662、645-663、654-672、655-673、660-678、662-680、665-683、678-696、681-699、687-705、690-708、691-709、694-712、696-714、697-715、699-717、707-725、711-729、713-731、714-732、715-733、717-735、751-769、753-771、763-781、766-784、788-806、798-816、801-819、804-822、831-849、861-879、865-883、867-885、870-888、871-889、872-890、873-891、876-894、1038-1056、1041-1059、1068-1086、1070-1088、1071-1089、1073-1091、1074-1092、1075-1093、1101-1119、1151-1169、1158-1176、1160-1178、1162-1180、1181-1199、1222-1240、1225-1243、1227-1245、1232-1250、1288-1306、1300-1318、1304-1322、1306-1324、1320-1338、1349-1367、1353-1371、1354-1372、1359-1377、1368-1386、1373-1391、1376-1394、1381-1399、1386-1404、1387-1405、1429-1447、1430-1448、1431-1449、1433-1451、1434-1452、1435-1453、1457-1475、1461-1479、1462-1480、1463-1481、1527-1545、1530-1548、1531-1549、1533-1551、1534-1552、1563-1581、1584-1602、1600-1618、1630-1648、1638-1656、1649-1667、1672-1690、1673-1691、1675-1693、1676-1694、1678-1696、1684-1702、1685-1703、1686-1704、1692-1710、1697-1715、1704-1722、1705-1723、1708-1726、1825-1843、1830-1848、1872-1890、1913-1931、1916-1934、1919-1937、1921-1939、1922-1940、1948-1966、1951-1969、1952-1970、1953-1971、1954-1972、1957-1975、1958-1976、1978-1996、1980-1998、1981-1999、1983-2001、1985-2003、1993-2011、1997-2015、1999-2017、2014-2032、2019-2037、2022-2040、2026-2044、2142-2160、2149-2167、2154-2172、2280-2298、2292-2310、2294-2312、2295-2313、2303-2321、2323-2341、2325-2343、2328-2346、2357-2375、2362-2380、2367-2385、2372-2390、2373-2391、2375-2393、2379-2397、2380-2398、2397-2415、2405-2423、2407-2425、2414-2432、2419-2437、2438-2456、2441-2459、2450-2468、2451-2469、2452-2470、2456-2474、2457-2475、2459-2477、2474-2492、2476-2494、2477-2495、2487-2505、2495-2513、2506-2524、2509-2527、2516-2534、2517-2535、2518-2536、2524-2542、2526-2544、2527-2545、2528-2546、2532-2550、2533-2551、2537-2555、2542-2560、2544-2562、2545-2563、2546-2564、2553-2571、2554-2572、2555-2573、2567-2585、2568-2586、2569-2587、2571-2589、2575-2593、2604-2622、2613-2631、2617-2635、2620-2638、2626-2644、2629-2647、2631-2649、2638-2656、2640-2658、2641-2659、2643-2661、2650-2668、2654-2672、2661-2679、2664-2682、2666-2684、2671-2689、2673-2691、2677-2695、2686-2704, 2690-2708, 2693-2711, 2695-2713, 2696-2714, 2698-2716, 2699-2717, 2700-2718, 2711-2729, 2734-2752, 2736-2754, 2740-2758, 2741-2759, 2742-2760, 2747-2765, 2761-2779, 2763-2781, 279 0-2808, 2822-2840, 2823-2841, 2843-2861, 2844-2862, 2849-2867, 2850-2868, 2852-2870, 2853-2871, 2856-2874, 2857-2875, 2860-2878, 2861-2879, 2862-2880, 2863-2881, 2864-2882, 2865-2883, 3124-31 42, 3126-3144, 3129-3147, 3130-3148, 3131-3149, 3135-3153, 3136-3154, 3138-3156, 3141-3159, 3143-3161, 3144-3162, 3172-3190, 3173-3191, 3174-3192, 3175-3193, 3178-3196, 3179-3197, 3180-3198, 3 Any one of the following: 181-3199, 3182-3200, 3184-3202, 3185-3203, 3186-3204, 3187-3205, 3205-3223, 3206-3224, 3208-3226, 3211-3229, 3212-3230, 3216-3234, 3217-3235, 3220-3238, 3222-3240, 3223-3241, or 3225-3243.
[0010] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a region similar to SEQ ID NO: Nucleotides of 1: 281-301, 287-307, 289-309, 320-340, 339-359, 356-376, 368-388, 371-391, 387-407, 389-409, 390-410, 452-472, 476-496, 499-519, 553-573, 556-576, 558-578, 559-579, 564-584, 568-588, 569-589, 579-599, 580-600, 581-601, 583-603, 584-604, 603-623, 604-624, 606-626. 608-628, 609-629, 614-634, 618-638, 622-642, 625-645, 626-646, 627-647, 628-648, 629-649, 630-650, 632-652, 633-653, 635-655, 636-656, 637-657, 638-658, 639-659, 640-660, 642-662, 643-663, 652-672, 653-673, 658-678, 660-680, 663-683, 676-696, 679-699, 685-705, 688-70 8, 689-709, 692-712, 694-714, 695-715, 697-717, 705-725, 709-729, 711-731, 712-732, 713-733, 715-735, 749-769, 751-771, 761-781, 764-784, 786-806, 796-816, 799-819, 802-822, 829-849, 859-879, 863-883, 865-885, 868-888, 869-889, 870-890, 871-891, 874-894, 1036-1056, 10 39-1059, 1066-1086, 1068-1088, 1069-1089, 1071-1091, 1072-1092, 1073-1093, 1099-1119, 1149-1169, 1156-1176, 1158-1178, 1160-1180, 1179-1199, 1220-1240, 1223-1243, 1225-1245, 1230-1250, 1286-1306, 1298-1318, 1302-1322, 1304-1324, 1318-1338, 1347-1367, 1351-1371,1352-1372、1357-1377、1366-1386、1371-1391、1374-1394、1379-1399、1384-1404、1385-1405、1427-1447、1428-1448、1429-1449、1431-1451、1432-1452、1433-1453、1455-1475、1459-1479、1460-1480、1461-1481、1525-1545、1528-1548、1529-1549、1531-1551、1532-1552、1561-1581、1582-1602、1598-1618、1628-1648、1636-1656、1647-1667、1670-1690、1671-1691、1673-1693、1674-1694、1676-1696、1682-1702、1683-1703、1684-1704、1690-1710、1695-1715、1702-1722、1703-1723、1706-1726、1823-1843、1828-1848、1870-1890、1911-1931、1914-1934、1917-1937、1919-1939、1920-1940、1946-1966、1949-1969、1950-1970、1951-1971、1952-1972、1955-1975、1956-1976、1976-1996、1978-1998、1979-1999、1981-2001、1983-2003、1991-2011、1995-2015、1997-2017、2012-2032、2017-2037、2020-2040、2024-2044、2140-2160、2147-2167、2152-2172、2278-2298、2290-2310、2292-2312、2293-2313、2301-2321、2321-2341、2323-2343、2326-2346、2355-2375、2360-2380、2365-2385、2370-2390、2371-2391、2373-2393、2377-2397、2378-2398、2395-2415、2403-2423、2405-2425、2412-2432、2417-2437、2436-2456、2439-2459、2448-2468、2449-2469、2450-2470、2454-2474、2455-2475、2457-2477、2472-2492、2474-2494、2475-2495、2485-2505、2493-2513、2504-2524、2507-2527、2514-2534、2515-2535、2516-2536、2522-2542、2524-2544、2525-2545、2526-2546、2530-2550、2531-2551、2535-2555、2540-2560、2542-2562、2543-2563、2544-2564、2551-2571、2552-2572、2553-2573、2565-2585、2566-2586、2567-2587、2569-2589、2573-2593、2602-2622、2611-2631、2615-2635、2618-2638、2624-2644、2627-2647、2629-2649、2636-2656、2638-2658、2639-2659、2641-2661、2648-2668、2652-2672、2659-2679、2662-2682、2664-2684、2669-2689、2671-2691、2675-2695、2684-2704、2688-2708、2691-2711、2693-2713、2694-2714、2696-2716、2697-2717、2698-2718、2709-2729、2732-2752、2734-2754、2738-2758、2739-2759、2740-2760、2745-2765、2759-2779、2761-2781、2788-2808、2820-2840、2821-2841、2841-2861、2842-2862、2847-2867、2848-2868、2850-2870、2851-2871、2854-2874、2855-2875、2858-2878、2859-2879、2860-2880、2861-2881、2862-2882、2863-2883、3122-3142、3124-3144、3127-3147、3128-3148、3129-3149、3133-3153、3134-3154、3136-3156、3139-3159、3141-3161、3142-3162、3170-3190、3171-3191、3172-3192、3173-3193、3176-3196、3177-3197、The nucleotide sequence 3178-3198, 3179-3199, 3180-3200, 3182-3202, 3183-3203, 3184-3204, 3185-3205, 3203-3223, 3204-3224, 3206-3226, 3209-3229, 3210-3230, 3214-3234, 3215-3235, 3218-3238, 3220-3240, 3221-3241, or 3223-3243 consists of at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by no more than 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences listed in SEQ ID NO:2. The corresponding nucleotide sequences differ by at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.
[0011] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a region similar to SEQ ID NO: Nucleotides of 1: 282-300, 288-306, 290-308, 321-339, 340-358, 357-375, 369-387, 372-390, 388-406, 390-408, 391-409, 453-471, 477-495, 500-518, 554-572, 557-575, 559-577, 560-578, 565-583, 569-587, 570-588, 580-598, 581-599, 582-600, 584-602, 585-603, 604-622, 605-623, 607-625, 6 09-627, 610-628, 615-633, 619-637, 623-641, 626-644, 627-645, 628-646, 629-647, 630-648, 631-649, 633-651, 634-652, 636-654, 637-655, 638-656, 639-657, 640-658, 641-659, 643-661, 644-662, 653-671, 654-672, 659-677, 661-679, 664-6.82, 677-695, 680-698, 686-704, 689-70 7, 690-708, 693-711, 695-713, 696-714, 698-716, 706-724, 710-728, 712-730, 713-731, 714-732, 716-734, 750-768, 752-770, 762-780, 765-783, 787-805, 797-815, 800-818, 803-821, 830-848, 860-878, 864-882, 866-884, 869-887, 870-888, 871-889, 872-890, 875-893, 1037-1055, 10 40-1058, 1067-1085, 1069-1087, 1070-1088, 1072-1090, 1073-1091, 1074-1092, 1100-1118, 1150-1168, 1157-1175, 1159-1177, 1161-1179, 1180-1198, 1221-1239, 1224-1242, 1226-1244, 1231-1249, 1287-1305, 1299-1317, 1303-1321, 1305-1323, 1319-1337, 1348-1366, 1352-1370,1353-1371、1358-1376、1367-1385、1372-1390、1375-1393、1380-1398、1385-1403、1386-1404、1428-1446、1429-1447、1430-1448、1432-1450、1433-1451、1434-1452、1456-1474、1460-1478、1461-1479、1462-1480、1526-1544、1529-1547、1530-1548、1532-1550、1533-1551、1562-1580、1583-1601、1599-1617、1629-1647、1637-1655、1648-1666、1671-1689、1672-1690、1674-1692、1675-1693、1677-1695、1683-1701、1684-1702、1685-1703、1691-1709、1696-1714、1703-1721、1704-1722、1707-1725、1824-1842、1829-1847、1871-1889、1912-1930、1915-1933、1918-1936、1920-1938、1921-1939、1947-1965、1950-1968、1951-1969、1952-1970、1953-1971、1956-1974、1957-1975、1977-1995、1979-1997、1980-1998、1982-2000、1984-2002、1992-2010、1996-2014、1998-2016、2013-2031、2018-2036、2021-2039、2025-2043、2141-2159、2148-2166、2153-2171、2279-2297、2291-2309、2293-2311、2294-2312、2302-2320、2322-2340、2324-2342、2327-2345、2356-2374、2361-2379、2366-2384、2371-2389、2372-2390、2374-2392、2378-2396、2379-2397、2396-2414、2404-2422、2406-2424、2413-2431、2418-2436、2437-2455、2440-2458、2449-2467、2450-2468、2451-2469、2455-2473、2456-2474、2458-2476、2473-2491、2475-2493、2476-2494、2486-2504、2494-2512、2505-2523、2508-2526、2515-2533、2516-2534、2517-2535、2523-2541、2525-2543、2526-2544、2527-2545、2531-2549、2532-2550、2536-2554、2541-2559、2543-2561、2544-2562、2545-2563、2552-2570、2553-2571、2554-2572、2566-2584、2567-2585、2568-2586、2570-2588、2574-2592、2603-2621、2612-2630、2616-2634、2619-2637、2625-2643、2628-2646、2630-2648、2637-2655、2639-2657、2640-2658、2642-2660、2649-2667、2653-2671、2660-2678、2663-2681、2665-2683、2670-2688、2672-2690、2676-2694、2685-2703、2689-2707、2692-2710、2694-2712、2695-2713、2697-2715、2698-2716、2699-2717、2710-2728、2733-2751、2735-2753、2739-2757、2740-2758、2741-2759、2746-2764、2760-2778、2762-2780、2789-2807、2821-2839、2822-2840、2842-2860、2843-2861、2848-2866、2849-2867、2851-2869、2852-2870、2855-2873、2856-2874、2859-2877、2860-2878、2861-2879、2862-2880、2863-2881、2864-2882、3123-3141、3125-3143、3128-3146、3129-3147、3130-3148、3134-3152、3135-3153、3137-3155、3140-3158、3142-3160、3143-3161、3171-3189、3172-3190、3173-3191、3174-3192、3177-3195、3178-3196、The nucleotide sequence 3179-3197, 3180-3198, 3181-3199, 3183-3201, 3184-3202, 3185-3203, 3186-3204, 3204-3222, 3205-3223, 3207-3225, 3210-3228, 3211-3229, 3215-3233, 3216-3234, 3219-3237, 3221-3239, 3222-3240, or 3224-3242 consists of at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any of the nucleotide sequences SEQ ID NO. The corresponding nucleotide sequence of NO:2 differs from the sequence of other nucleotides by at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.
[0012] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a region similar to SEQ ID NO: Nucleotides of 1: 279-303, 285-309, 287-311, 318-342, 337-361, 354-378, 366-390, 369-393, 385-409, 387-411, 388-412, 450-474, 474-498, 497-521, 551-575, 554-578, 556-580, 557-581, 562-586, 566-590, 567-591, 577-601, 578-602, 579-603, 581-605, 582-606, 601-625, 602-626, 604-628. 606-630, 607-631, 612-636, 616-640, 620-644, 623-647, 624-648, 625-649, 626-650, 627-651, 628-652, 630-654, 631-655, 633-657, 634-658, 635-659, 636-660, 637-661, 638-662, 640-664, 641-665, 650-674, 651-675, 656-680, 658-682, 661-685, 674-698, 677-701, 683-707, 686-71 0, 687-711, 690-714, 692-716, 693-717, 695-719, 703-727, 707-731, 709-733, 710-734, 711-735, 713-737, 747-771, 749-773, 759-783, 762-786, 784-808, 794-818, 797-821, 800-824, 827-851, 857-881, 861-885, 863-887, 866-890, 867-891, 868-892, 869-893, 872-896, 1034-1058, 10 37-1061, 1064-1088, 1066-1090, 1067-1091, 1069-1093, 1070-1094, 1071-1095, 1097-1121, 1147-1171, 1154-1178, 1156-1180, 1158-1182, 1177-1201, 1218-1242, 1221-1245, 1223-1247, 1228-1252, 1284-1308, 1296-1320, 1300-1324, 1302-1326, 1316-1340, 1345-1369, 1349-1373,1350-1374、1355-1379、1364-1388、1369-1393、1372-1396、1377-1401、1382-1406、1383-1407、1425-1449、1426-1450、1427-1451、1429-1453、1430-1454、1431-1455、1453-1477、1457-1481、1458-1482、1459-1483、1523-1547、1526-1550、1527-1551、1529-1553、1530-1554、1559-1583、1580-1604、1596-1620、1626-1650、1634-1658、1645-1669、1668-1692、1669-1693、1671-1695、1672-1696、1674-1698、1680-1704、1681-1705、1682-1706、1688-1712、1693-1717、1700-1724、1701-1725、1704-1728、1821-1845、1826-1850、1868-1892、1909-1933、1912-1936、1915-1939、1917-1941、1918-1942、1944-1968、1947-1971、1948-1972、1949-1973、1950-1974、1953-1977、1954-1978、1974-1998、1976-2000、1977-2001、1979-2003、1981-2005、1989-2013、1993-2017、1995-2019、2010-2034、2015-2039、2018-2042、2022-2046、2138-2162、2145-2169、2150-2174、2276-2300、2288-2312、2290-2314、2291-2315、2299-2323、2319-2343、2321-2345、2324-2348、2353-2377、2358-2382、2363-2387、2368-2392、2369-2393、2371-2395、2375-2399、2376-2400、2393-2417、2401-2425、2403-2427、2410-2434、2415-2439、2434-2458、2437-2461、2446-2470、2447-2471、2448-2472、2452-2476、2453-2477、2455-2479、2470-2494、2472-2496、2473-2497、2483-2507、2491-2515、2502-2526、2505-2529、2512-2536、2513-2537、2514-2538、2520-2544、2522-2546、2523-2547、2524-2548、2528-2552、2529-2553、2533-2557、2538-2562、2540-2564、2541-2565、2542-2566、2549-2573、2550-2574、2551-2575、2563-2587、2564-2588、2565-2589、2567-2591、2571-2595、2600-2624、2609-2633、2613-2637、2616-2640、2622-2646、2625-2649、2627-2651、2634-2658、2636-2660、2637-2661、2639-2663、2646-2670、2650-2674、2657-2681、2660-2684、2662-2686、2667-2691、2669-2693、2673-2697、2682-2706、2686-2710、2689-2713、2691-2715、2692-2716、2694-2718、2695-2719、2696-2720、2707-2731、2730-2754、2732-2756、2736-2760、2737-2761、2738-2762、2743-2767、2757-2781、2759-2783、2786-2810、2818-2842、2819-2843、2839-2863、2840-2864、2845-2869、2846-2870、2848-2872、2849-2873、2852-2876、2853-2877、2856-2880、2857-2881、2858-2882、2859-2883、2860-2884、2861-2885、3120-3144、3122-3146、3125-3149、3126-3150、3127-3151、3131-3155、3132-3156、3134-3158、3137-3161、3139-3163、3140-3164、3168-3192、3169-3193、3170-3194、3171-3195、3174-3198、3175-3199、The nucleotide sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences 3176-3200, 3177-3201, 3178-3202, 3180-3204, 3181-3205, 3182-3206, 3183-3207, 3201-3225, 3202-3226, 3204-3228, 3207-3231, 3208-3232, 3212-3236, 3213-3237, 3216-3240, 3218-3242, 3219-3243, or 3221-3245, and the antisense strand contains the same as SEQ ID NO:2. The corresponding nucleotide sequence differs from the given sequence by at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.
[0013] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a region similar to SEQ ID NO: 1. Nucleotides 276-306, 282-312, 284-314, 315-345, 334-364, 351-381, 363-393, 366-396, 382-412, 384-414, 385-415, 447-477, 471-501, 494-524, 548-578, 551-581, 553-583, 554-584, 559-589, 563-593, 564-594, 574-604, 575-605, 576-606, 578-608, 579-609, 598-628, 599-629, 601-631 603-633, 604-634, 609-639, 613-643, 617-647, 620-650, 621-651, 622-652, 623-653, 624-654, 625-655, 627-657, 628-658, 630-660, 631-661, 632-662, 633-663, 634-664, 635-665, 637-667, 638-668, 647-677, 648-678, 653-683, 655-685, 658-688, 671-701, 674-704, 680-710, 68 3-713, 684-714, 687-717, 689-719, 690-720, 692-722, 700-730, 704-734, 706-736, 707-737, 708-738, 710-740, 744-774, 746-776, 756-786, 759-789, 781-811, 791-821, 794-824, 797-827, 824-854, 854-884, 858-888, 860-890, 863-893, 864-894, 865-895, 866-896, 869-899, 1031- 1061, 1034-1064, 1061-1091, 1063-1093, 1064-1094, 1066-1096, 1067-1097, 1068-1098, 1094-1124, 1144-1174, 1151-1181, 1153-1183, 1155-1185, 1174-1204, 1215-1245, 1218-1248, 1220-1250, 1225-1255, 1281-1311, 1293-1323, 1297-1327, 1299-1329, 1313-1343, 1342-1372,1346-1376、1347-1377、1352-1382、1361-1391、1366-1396、1369-1399、1374-1404、1379-1409、1380-1410、1422-1452、1423-1453、1424-1454、1426-1456、1427-1457、1428-1458、1450-1480、1454-1484、1455-1485、1456-1486、1520-1550、1523-1553、1524-1554、1526-1556、1527-1557、1556-1586、1577-1607、1593-1623、1623-1653、1631-1661、1642-1672、1665-1695、1666-1696、1668-1698、1669-1699、1671-1701、1677-1707、1678-1708、1679-1709、1685-1715、1690-1720、1697-1727、1698-1728、1701-1731、1818-1848、1823-1853、1865-1895、1906-1936、1909-1939、1912-1942、1914-1944、1915-1945、1941-1971、1944-1974、1945-1975、1946-1976、1947-1977、1950-1980、1951-1981、1971-2001、1973-2003、1974-2004、1976-2006、1978-2008、1986-2016、1990-2020、1992-2022、2007-2037、2012-2042、2015-2045、2019-2049、2135-2165、2142-2172、2147-2177、2273-2303、2285-2315、2287-2317、2288-2318、2296-2326、2316-2346、2318-2348、2321-2351、2350-2380、2355-2385、2360-2390、2365-2395、2366-2396、2368-2398、2372-2402、2373-2403、2390-2420、2398-2428、2400-2430、2407-2437、2412-2442、2431-2461、2434-2464、2443-2473、2444-2474、2445-2475、2449-2479、2450-2480、2452-2482、2467-2497、2469-2499、2470-2500、2480-2510、2488-2518、2499-2529、2502-2532、2509-2539、2510-2540、2511-2541、2517-2547、2519-2549、2520-2550、2521-2551、2525-2555、2526-2556、2530-2560、2535-2565、2537-2567、2538-2568、2539-2569、2546-2576、2547-2577、2548-2578、2560-2590、2561-2591、2562-2592、2564-2594、2568-2598、2597-2627、2606-2636、2610-2640、2613-2643、2619-2649、2622-2652、2624-2654、2631-2661、2633-2663、2634-2664、2636-2666、2643-2673、2647-2677、2654-2684、2657-2687、2659-2689、2664-2694、2666-2696、2670-2700、2679-2709、2683-2713、2686-2716、2688-2718、2689-2719、2691-2721、2692-2722、2693-2723、2704-2734、2727-2757、2729-2759、2733-2763、2734-2764、2735-2765、2740-2770、2754-2784、2756-2786、2783-2813、2815-2845、2816-2846、2836-2866、2837-2867、2842-2872、2843-2873、2845-2875、2846-2876、2849-2879、2850-2880、2853-2883、2854-2884、2855-2885、2856-2886、2857-2887、2858-2888、3117-3147、3119-3149、3122-3152、3123-3153、3124-3154、3128-3158、3129-3159、3131-3161、3134-3164、3136-3166、3137-3167、3165-3195、3166-3196、3167-3197、3168-3198、3171-3201、The sequence comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any of the nucleotide sequences 3172-3202, 3173-3203, 3174-3204, 3175-3205, 3177-3207, 3178-3208, 3179-3209, 3180-3210, 3198-3228, 3199-3229, 3201-3231, 3204-3234, 3205-3235, 3209-3239, 3210-3240, 3213-3243, 3215-3245, 3216-3246, or 3218-3248, and the antisense strand contains the same sequence as SEQ ID NO:2. The corresponding nucleotide sequence differs from the given sequence by at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.
[0014] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a region similar to SEQ ID NO: Nucleotides of 1: 283-301, 289-307, 291-309, 322-340, 341-359, 358-376, 370-388, 373-391, 389-407, 391-409, 392-410, 454-472, 478-496, 501-519, 555-573, 558-576, 560-578, 561-579, 566-584, 570-588, 571-589, 581-599, 582-600, 583-601, 585-603, 586-604, 605-623, 606-624, 608-626. 610-628, 611-629, 616-634, 620-638, 624-642, 627-645, 628-646, 629-647, 630-648, 631-649, 632-650, 634-652, 635-653, 637-655, 638-656, 639-657, 640-658, 641-659, 642-660, 644-662, 645-663, 654-672, 655-673, 660-678, 662-680, 665-683, 678-696, 681-699, 687-705, 690-70 8, 691-709, 694-712, 696-714, 697-715, 699-717, 707-725, 711-729, 713-731, 714-732, 715-733, 717-735, 751-769, 753-771, 763-781, 766-784, 788-806, 798-816, 801-819, 804-822, 831-849, 861-879, 865-883, 867-885, 870-888, 871-889, 872-890, 873-891, 876-894, 1038-1056, 10 41-1059, 1068-1086, 1070-1088, 1071-1089, 1073-1091, 1074-1092, 1075-1093, 1101-1119, 1151-1169, 1158-1176, 1160-1178, 1162-1180, 1181-1199, 1222-1240, 1225-1243, 1227-1245, 1232-1250, 1288-1306, 1300-1318, 1304-1322, 1306-1324, 1320-1338, 1349-1367, 1353-1371,1354-1372、1359-1377、1368-1386、1373-1391、1376-1394、1381-1399、1386-1404、1387-1405、1429-1447、1430-1448、1431-1449、1433-1451、1434-1452、1435-1453、1457-1475、1461-1479、1462-1480、1463-1481、1527-1545、1530-1548、1531-1549、1533-1551、1534-1552、1563-1581、1584-1602、1600-1618、1630-1648、1638-1656、1649-1667、1672-1690、1673-1691、1675-1693、1676-1694、1678-1696、1684-1702、1685-1703、1686-1704、1692-1710、1697-1715、1704-1722、1705-1723、1708-1726、1825-1843、1830-1848、1872-1890、1913-1931、1916-1934、1919-1937、1921-1939、1922-1940、1948-1966、1951-1969、1952-1970、1953-1971、1954-1972、1957-1975、1958-1976、1978-1996、1980-1998、1981-1999、1983-2001、1985-2003、1993-2011、1997-2015、1999-2017、2014-2032、2019-2037、2022-2040、2026-2044、2142-2160、2149-2167、2154-2172、2280-2298、2292-2310、2294-2312、2295-2313、2303-2321、2323-2341、2325-2343、2328-2346、2357-2375、2362-2380、2367-2385、2372-2390、2373-2391、2375-2393、2379-2397、2380-2398、2397-2415、2405-2423、2407-2425、2414-2432、2419-2437、2438-2456、2441-2459、2450-2468、2451-2469、2452-2470、2456-2474、2457-2475、2459-2477、2474-2492、2476-2494、2477-2495、2487-2505、2495-2513、2506-2524、2509-2527、2516-2534、2517-2535、2518-2536、2524-2542、2526-2544、2527-2545、2528-2546、2532-2550、2533-2551、2537-2555、2542-2560、2544-2562、2545-2563、2546-2564、2553-2571、2554-2572、2555-2573、2567-2585、2568-2586、2569-2587、2571-2589、2575-2593、2604-2622、2613-2631、2617-2635、2620-2638、2626-2644、2629-2647、2631-2649、2638-2656、2640-2658、2641-2659、2643-2661、2650-2668、2654-2672、2661-2679、2664-2682、2666-2684、2671-2689、2673-2691、2677-2695、2686-2704、2690-2708、2693-2711、2695-2713、2696-2714、2698-2716、2699-2717、2700-2718、2711-2729、2734-2752、2736-2754、2740-2758、2741-2759、2742-2760、2747-2765、2761-2779、2763-2781、2790-2808、2822-2840、2823-2841、2843-2861、2844-2862、2849-2867、2850-2868、2852-2870、2853-2871、2856-2874、2857-2875、2860-2878、2861-2879、2862-2880、2863-2881、2864-2882、2865-2883、3124-3142、3126-3144、3129-3147、3130-3148、3131-3149、3135-3153、3136-3154、3138-3156、3141-3159、3143-3161、3144-3162、3172-3190、3173-3191、3174-3192、3175-3193、3178-3196、3179-3197、The antisense strand comprises at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from any of the nucleotide sequences 3180-3198, 3181-3199, 3182-3200, 3184-3202, 3185-3203, 3186-3204, 3187-3205, 3205-3223, 3206-3224, 3208-3226, 3211-3229, 3212-3230, 3216-3234, 3217-3235, 3220-3238, 3222-3240, 3223-3241, or 3225-3243, and differs from any of these nucleotide sequences by 0, 1, 2, or 3 nucleotides. The corresponding nucleotide sequence differs from the given sequence by at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.
[0015] In some embodiments, the antisense strand comprises at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides, said consecutive nucleotides being related to SEQ ID NO:1 Nucleotides 281-301, 287-307, 289-309, 320-340, 339-359, 356-376, 368-388, 371-391, 387-407, 389-409, 390-410, 452-472, 476-496, 499-519, 553-573, 556-576, 558-578, 559-579, 564-584, 568-588, 569-589, 579-599, 580-600, 581-601, 583-603, 584-604, 603-623, 604-624, 606- 626, 608-628, 609-629, 614-634, 618-638, 622-642, 625-645, 626-646, 627-647, 628-648, 629-649, 630-650, 632-652, 633-653, 635-655, 636-656, 637-657, 638-658, 639-659, 640-660, 642-662, 643-663, 652-672, 653-673, 658-678, 660-680, 663-683, 676-696, 679-699, 685-7 05, 688-708, 689-709, 692-712, 694-714, 695-715, 697-717, 705-725, 709-729, 711-731, 712-732, 713-733, 715-735, 749-769, 751-771, 761-781, 764-784, 786-806, 796-816, 799-819, 802-822, 829-849, 859-879, 863-883, 865-885, 868-888, 869-889, 870-890, 871-891, 874-8 94, 1036-1056, 1039-1059, 1066-1086, 1068-1088, 1069-1089, 1071-1091, 1072-1092, 1073-1093, 1099-1119, 1149-1169, 1156-1176, 1158-1178, 1160-1180, 1179-1199, 1220-1240, 1223-1243, 1225-1245, 1230-1250, 1286-1306, 1298-1318, 1302-1322, 1304-1324, 1318-1338,1347-1367、1351-1371、1352-1372、1357-1377、1366-1386、1371-1391、1374-1394、1379-1399、1384-1404、1385-1405、1427-1447、1428-1448、1429-1449、1431-1451、1432-1452、1433-1453、1455-1475、1459-1479、1460-1480、1461-1481、1525-1545、1528-1548、1529-1549、1531-1551、1532-1552、1561-1581、1582-1602、1598-1618、1628-1648、1636-1656、1647-1667、1670-1690、1671-1691、1673-1693、1674-1694、1676-1696、1682-1702、1683-1703、1684-1704、1690-1710、1695-1715、1702-1722、1703-1723、1706-1726、1823-1843、1828-1848、1870-1890、1911-1931、1914-1934、1917-1937、1919-1939、1920-1940、1946-1966、1949-1969、1950-1970、1951-1971、1952-1972、1955-1975、1956-1976、1976-1996、1978-1998、1979-1999、1981-2001、1983-2003、1991-2011、1995-2015、1997-2017、2012-2032、2017-2037、2020-2040、2024-2044、2140-2160、2147-2167、2152-2172、2278-2298、2290-2310、2292-2312、2293-2313、2301-2321、2321-2341、2323-2343、2326-2346、2355-2375、2360-2380、2365-2385、2370-2390、2371-2391、2373-2393、2377-2397、2378-2398、2395-2415、2403-2423、2405-2425、2412-2432、2417-2437、2436-2456、2439-2459、2448-2468、2449-2469、2450-2470、2454-2474、2455-2475、2457-2477、2472-2492、2474-2494、2475-2495、2485-2505、2493-2513、2504-2524、2507-2527、2514-2534、2515-2535、2516-2536、2522-2542、2524-2544、2525-2545、2526-2546、2530-2550、2531-2551、2535-2555、2540-2560、2542-2562、2543-2563、2544-2564、2551-2571、2552-2572、2553-2573、2565-2585、2566-2586、2567-2587、2569-2589、2573-2593、2602-2622、2611-2631、2615-2635、2618-2638、2624-2644、2627-2647、2629-2649、2636-2656、2638-2658、2639-2659、2641-2661、2648-2668、2652-2672、2659-2679、2662-2682、2664-2684、2669-2689、2671-2691、2675-2695、2684-2704、2688-2708、2691-2711、2693-2713、2694-2714、2696-2716、2697-2717、2698-2718、2709-2729、2732-2752、2734-2754、2738-2758、2739-2759、2740-2760、2745-2765、2759-2779、2761-2781、2788-2808、2820-2840、2821-2841、2841-2861、2842-2862、2847-2867、2848-2868、2850-2870、2851-2871、2854-2874、2855-2875、2858-2878、2859-2879、2860-2880、2861-2881、2862-2882、2863-2883、3122-3142、3124-3144、3127-3147、3128-3148、3129-3149、3133-3153、3134-3154、3136-3156、3139-3159、3141-3161、3142-3162、3170-3190、3171-3191、3172-3192、3173-3193、3176-3196、3177-3197、3178-3198、3179-3199、3180-3200、3182-3202、3183-3203、3184-3204、3185-3205、3203-3223、3204-3224、3206-3226、3209-3229、3210-3230、3214-3234、3215-3235、3218-3238、3220-3240、3221-3241、3223-3243、282-300、288-306、290-308、321-339、340-358、357-375、369-387、372-390、388-406、390-408、391-409、453-471、477-495、500-518、554-572、557-575、559-577、560-578、565-583、569-587、570-588、580-598、581-599、582-600、584-602、585-603、604-622、605-623、607-625、609-627、610-628、615-633、619-637、623-641、626-644、627-645、628-646、629-647、630-648、631-649、633-651、634-652、636-654、637-655、638-656、639-657、640-658、641-659、643-661、644-662、653-671、654-672、659-677、661-679、664-682、677-695、680-698、686-704、689-707、690-708、693-711、695-713、696-714、698-716、706-724、710-728、712-730、713-731、714-732、716-734、750-768、752-770、762-780、765-783、787-805、797-815、800-818、803-821、830-848、860-878、864-882、866-884、869-887、870-888、871-889、872-890、875-893、1037-1055、1040-1058、1067-1085、1069-1087、1070-1088、1072-1090、1073-1091、1074-1092、1100-1118、1150-1168、1157-1175、1159-1177、1161-1179、1180-1198、1221-1239、1224-1242、1226-1244、1231-1249、1287-1305、1299-1317、1303-1321、1305-1323、1319-1337、1348-1366、1352-1370、1353-1371、1358-1376、1367-1385、1372-1390、1375-1393、1380-1398、1385-1403、1386-1404、1428-1446、1429-1447、1430-1448、1432-1450、1433-1451、1434-1452、1456-1474、1460-1478、1461-1479、1462-1480、1526-1544、1529-1547、1530-1548、1532-1550、1533-1551、1562-1580、1583-1601、1599-1617、1629-1647、1637-1655、1648-1666、1671-1689、1672-1690、1674-1692、1675-1693、1677-1695、1683-1701、1684-1702、1685-1703、1691-1709、1696-1714、1703-1721、1704-1722、1707-1725、1824-1842、1829-1847、1871-1889、1912-1930、1915-1933、1918-1936、1920-1938、1921-1939、1947-1965、1950-1968、1951-1969、1952-1970、1953-1971、1956-1974、1957-1975、1977-1995、1979-1997、1980-1998、1982-2000、1984-2002、1992-2010、1996-2014、1998-2016、2013-2031、2018-2036、2021-2039、2025-2043、2141-2159、2148-2166、2153-2171、2279-2297、2291-2309、2293-2311、2294-2312、2302-2320、2322-2340、2324-2342、2327-2345、2356-2374、2361-2379、2366-2384、2371-2389、2372-2390、2374-2392、2378-2396、2379-2397、2396-2414、2404-2422、2406-2424、2413-2431、2418-2436、2437-2455、2440-2458、2449-2467、2450-2468、2451-2469、2455-2473、2456-2474、2458-2476、2473-2491、2475-2493、2476-2494、2486-2504、2494-2512、2505-2523、2508-2526、2515-2533、2516-2534、2517-2535、2523-2541、2525-2543、2526-2544、2527-2545、2531-2549、2532-2550、2536-2554、2541-2559、2543-2561、2544-2562、2545-2563、2552-2570、2553-2571、2554-2572、2566-2584、2567-2585、2568-2586、2570-2588、2574-2592、2603-2621、2612-2630、2616-2634、2619-2637、2625-2643、2628-2646、2630-2648、2637-2655、2639-2657、2640-2658、2642-2660、2649-2667、2653-2671、2660-2678、2663-2681、2665-2683、2670-2688、2672-2690、2676-2694、2685-2703、2689-2707、2692-2710、2694-2712、2695-2713、2697-2715、2698-2716、2699-2717、2710-2728、2733-2751、2735-2753、2739-2757、2740-2758、2741-2759、2746-2764、2760-2778、2762-2780、2789-2807、2821-2839、2822-2840、2842-2860、2843-2861、2848-2866、2849-2867、2851-2869、2852-2870、2855-2873、2856-2874、2859-2877、2860-2878、2861-2879、2862-2880、2863-2881、2864-2882、3123-3141、3125-3143、3128-3146、3129-3147、3130-3148、3134-3152、3135-3153、3137-3155、3140-3158、3142-3160、3143-3161、3171-3189、3172-3190、3173-3191、3174-3192、3177-3195、3178-3196、3179-3197、3180-3198、3181-3199、3183-3201、3184-3202、3185-3203、3186-3204、3204-3222、3205-3223、3207-3225、3210-3228、3211-3229、3215-3233、3216-3234、3219-3237、3221-3239、3222-3240、3224-3242、279-303、285-309、287-311、318-342、337-361、354-378、366-390、369-393、385-409、387-411、388-412、450-474、474-498、497-521、551-575、554-578、556-580、557-581、562-586、566-590、567-591、577-601、578-602、579-603、581-605、582-606、601-625、602-626、604-628、606-630、607-631、612-636、616-640、620-644、623-647、624-648、625-649、626-650、627-651、628-652、630-654、631-655、633-657、634-658、635-659、636-660、637-661、638-662、640-664、641-665、650-674、651-675、656-680、658-682、661-685、674-698、677-701、683-707、686-710、687-711、690-714、692-716、693-717、695-719、703-727、707-731、709-733、710-734、711-735、713-737、747-771、749-773、759-783、762-786、784-808、794-818、797-821、800-824、827-851、857-881、861-885、863-887、866-890、867-891、868-892、869-893、872-896、1034-1058、1037-1061、1064-1088、1066-1090、1067-1091、1069-1093、1070-1094、1071-1095、1097-1121、1147-1171、1154-1178、1156-1180、1158-1182、1177-1201、1218-1242、1221-1245、1223-1247、1228-1252、1284-1308、1296-1320、1300-1324、1302-1326、1316-1340、1345-1369、1349-1373、1350-1374、1355-1379、1364-1388、1369-1393、1372-1396、1377-1401、1382-1406、1383-1407、1425-1449、1426-1450、1427-1451、1429-1453、1430-1454、1431-1455、1453-1477、1457-1481、1458-1482、1459-1483、1523-1547、1526-1550、1527-1551、1529-1553、1530-1554、1559-1583、1580-1604、1596-1620、1626-1650、1634-1658、1645-1669、1668-1692、1669-1693、1671-1695、1672-1696、1674-1698、1680-1704、1681-1705、1682-1706、1688-1712、1693-1717、1700-1724、1701-1725、1704-1728、1821-1845、1826-1850、1868-1892、1909-1933、1912-1936、1915-1939、1917-1941、1918-1942、1944-1968、1947-1971、1948-1972、1949-1973、1950-1974、1953-1977、1954-1978、1974-1998、1976-2000、1977-2001、1979-2003、1981-2005、1989-2013、1993-2017、1995-2019、2010-2034、2015-2039、2018-2042、2022-2046、2138-2162、2145-2169、2150-2174、2276-2300、2288-2312、2290-2314、2291-2315、2299-2323、2319-2343、2321-2345、2324-2348、2353-2377、2358-2382、2363-2387、2368-2392、2369-2393、2371-2395、2375-2399、2376-2400、2393-2417、2401-2425、2403-2427、2410-2434、2415-2439、2434-2458、2437-2461、2446-2470、2447-2471、2448-2472、2452-2476、2453-2477、2455-2479、2470-2494、2472-2496、2473-2497、2483-2507、2491-2515、2502-2526、2505-2529、2512-2536、2513-2537、2514-2538、2520-2544、2522-2546、2523-2547、2524-2548、2528-2552、2529-2553、2533-2557、2538-2562、2540-2564、2541-2565、2542-2566、2549-2573、2550-2574、2551-2575、2563-2587、2564-2588、2565-2589、2567-2591、2571-2595、2600-2624、2609-2633、2613-2637、2616-2640、2622-2646、2625-2649、2627-2651、2634-2658、2636-2660、2637-2661、2639-2663、2646-2670、2650-2674、2657-2681、2660-2684、2662-2686、2667-2691、2669-2693、2673-2697、2682-2706、2686-2710、2689-2713、2691-2715、2692-2716、2694-2718、2695-2719、2696-2720、2707-2731、2730-2754、2732-2756、2736-2760、2737-2761、2738-2762、2743-2767、2757-2781、2759-2783、2786-2810、2818-2842、2819-2843、2839-2863、2840-2864、2845-2869、2846-2870、2848-2872、2849-2873、2852-2876、2853-2877、2856-2880、2857-2881、2858-2882、2859-2883、2860-2884、2861-2885、3120-3144、3122-3146、3125-3149、3126-3150、3127-3151、3131-3155、3132-3156、3134-3158、3137-3161、3139-3163、3140-3164、3168-3192、3169-3193、3170-3194、3171-3195、3174-3198、3175-3199、3176-3200、3177-3201、3178-3202、3180-3204、3181-3205、3182-3206、3183-3207、3201-3225、3202-3226、3204-3228、3207-3231、3208-3232、3212-3236、3213-3237、3216-3240、3218-3242、3219-3243、3221-3245、276-306、282-312、284-314、315-345、334-364、351-381、363-393、366-396、382-412、384-414、385-415、447-477、471-501、494-524、548-578、551-581、553-583、554-584、559-589、563-593、564-594、574-604、575-605、576-606、578-608、579-609、598-628、599-629、601-631、603-633、604-634、609-639、613-643、617-647、620-650、621-651、622-652、623-653、624-654、625-655、627-657、628-658、630-660、631-661、632-662、633-663、634-664、635-665、637-667、638-668、647-677、648-678、653-683、655-685、658-688、671-701、674-704、680-710、683-713、684-714、687-717、689-719、690-720、692-722、700-730、704-734、706-736、707-737、708-738、710-740、744-774、746-776、756-786、759-789、781-811、791-821、794-824、797-827、824-854、854-884、858-888、860-890、863-893、864-894、865-895、866-896、869-899、1031-1061、1034-1064、1061-1091、1063-1093、1064-1094、1066-1096、1067-1097、1068-1098、1094-1124、1144-1174、1151-1181、1153-1183、1155-1185、1174-1204、1215-1245、1218-1248、1220-1250、1225-1255、1281-1311、1293-1323、1297-1327、1299-1329、1313-1343、1342-1372、1346-1376、1347-1377、1352-1382、1361-1391、1366-1396、1369-1399、1374-1404、1379-1409、1380-1410、1422-1452、1423-1453、1424-1454、1426-1456、1427-1457、1428-1458、1450-1480、1454-1484、1455-1485、1456-1486、1520-1550、1523-1553、1524-1554、1526-1556、1527-1557、1556-1586、1577-1607、1593-1623、1623-1653、1631-1661、1642-1672、1665-1695、1666-1696、1668-1698、1669-1699、1671-1701、1677-1707、1678-1708、1679-1709、1685-1715、1690-1720、1697-1727、1698-1728、1701-1731、1818-1848、1823-1853、1865-1895、1906-1936、1909-1939、1912-1942、1914-1944、1915-1945、1941-1971、1944-1974、1945-1975、1946-1976、1947-1977、1950-1980、1951-1981、1971-2001、1973-2003、1974-2004、1976-2006、1978-2008、1986-2016、1990-2020、1992-2022、2007-2037、2012-2042、2015-2045、2019-2049、2135-2165、2142-2172、2147-2177、2273-2303、2285-2315、2287-2317、2288-2318、2296-2326、2316-2346、2318-2348、2321-2351、2350-2380、2355-2385、2360-2390、2365-2395、2366-2396、2368-2398、2372-2402、2373-2403、2390-2420、2398-2428、2400-2430、2407-2437、2412-2442、2431-2461、2434-2464、2443-2473、2444-2474、2445-2475、2449-2479、2450-2480、2452-2482、2467-2497、2469-2499、2470-2500、2480-2510、2488-2518、2499-2529、2502-2532、2509-2539、2510-2540、2511-2541、2517-2547、2519-2549、2520-2550、2521-2551、2525-2555、2526-2556、2530-2560、2535-2565、2537-2567、2538-2568、2539-2569、2546-2576、2547-2577、2548-2578、2560-2590、2561-2591、2562-2592、2564-2594、2568-2598、2597-2627、2606-2636、2610-2640、2613-2643、2619-2649、2622-2652、2624-2654、2631-2661、2633-2663、2634-2664、2636-2666、2643-2673、2647-2677、2654-2684、2657-2687、2659-2689、2664-2694、2666-2696、2670-2700、2679-2709、2683-2713、2686-2716、2688-2718、2689-2719、2691-2721、2692-2722、2693-2723、2704-2734、2727-2757、2729-2759、2733-2763、2734-2764、2735-2765、2740-2770、2754-2784、2756-2786、2783-2813、2815-2845、2816-2846、2836-2866、2837-2867、2842-2872、2843-2873、2845-2875、2846-2876、2849-2879、2850-2880、2853-2883、2854-2884、2855-2885、2856-2886、2857-2887、2858-2888、3117-3147、3119-3149、3122-3152、3123-3153、3124-3154、3128-3158、3129-3159、3131-3161、3134-3164、3136-3166、3137-3167、3165-3195、3166-3196、3167-3197、3168-3198、3171-3201、3172-3202、3173-3203、3174-3204、3175-3205、3177-3207、3178-3208、3179-3209、3180-3210、3198-3228、3199-3229、3201-3231、3204-3234、3205-3235、3209-3239、3210-3240、3213-3243、3215-3245、3216-3246、3218-3248、283-301、289-307、291-309、322-340、341-359、358-376、370-388、373-391、389-407、391-409、392-410、454-472、478-496、501-519、555-573、558-576、560-578、561-579、566-584、570-588、571-589、581-599、582-600、583-601、585-603、586-604、605-623、606-624、608-626、610-628、611-629、616-634、620-638、624-642、627-645、628-646、629-647、630-648、631-649、632-650、634-652、635-653、637-655、638-656、639-657、640-658、641-659、642-660、644-662、645-663、654-672、655-673、660-678、662-680、665-683、678-696、681-699、687-705、690-708、691-709、694-712、696-714、697-715、699-717、707-725、711-729、713-731、714-732、715-733、717-735、751-769、753-771、763-781、766-784、788-806、798-816、801-819、804-822、831-849、861-879、865-883、867-885、870-888、871-889、872-890、873-891、876-894、1038-1056、1041-1059、1068-1086、1070-1088、1071-1089、1073-1091、1074-1092、1075-1093、1101-1119、1151-1169、1158-1176、1160-1178、1162-1180、1181-1199、1222-1240、1225-1243、1227-1245、1232-1250、1288-1306、1300-1318、1304-1322、1306-1324、1320-1338、1349-1367、1353-1371、1354-1372、1359-1377、1368-1386、1373-1391、1376-1394、1381-1399、1386-1404、1387-1405、1429-1447、1430-1448、1431-1449、1433-1451、1434-1452、1435-1453、1457-1475、1461-1479、1462-1480、1463-1481、1527-1545、1530-1548、1531-1549、1533-1551、1534-1552、1563-1581、1584-1602、1600-1618、1630-1648、1638-1656、1649-1667、1672-1690、1673-1691、1675-1693、1676-1694、1678-1696、1684-1702、1685-1703、1686-1704、1692-1710、1697-1715、1704-1722、1705-1723、1708-1726、1825-1843、1830-1848、1872-1890、1913-1931、1916-1934、1919-1937、1921-1939、1922-1940、1948-1966、1951-1969、1952-1970、1953-1971、1954-1972、1957-1975、1958-1976、1978-1996、1980-1998、1981-1999、1983-2001、1985-2003、1993-2011、1997-2015、1999-2017、2014-2032、2019-2037、2022-2040、2026-2044、2142-2160、2149-2167、2154-2172、2280-2298、2292-2310、2294-2312、2295-2313、2303-2321、2323-2341、2325-2343、2328-2346、2357-2375、2362-2380、2367-2385、2372-2390、2373-2391、2375-2393、2379-2397、2380-2398、2397-2415、2405-2423、2407-2425、2414-2432、2419-2437、2438-2456、2441-2459、2450-2468、2451-2469、2452-2470、2456-2474、2457-2475、2459-2477、2474-2492、2476-2494、2477-2495、2487-2505、2495-2513、2506-2524、2509-2527、2516-2534、2517-2535、2518-2536、2524-2542、2526-2544、2527-2545、2528-2546、2532-2550、2533-2551、2537-2555、2542-2560、2544-2562、2545-2563、2546-2564、2553-2571、2554-2572、2555-2573、2567-2585、2568-2586、2569-2587、2571-2589、2575-2593、2604-2622、2613-2631、2617-2635、2620-2638、2626-2644、2629-2647、2631-2649、2638-2656、2640-2658、2641-2659、2643-2661、2650-2668、2654-2672、2661-2679、2664-2682、2666-2684, 2671-2689, 2673-2691, 2677-2695, 2686-2704, 2690-2708, 2693-2711, 2695-2713, 2696-2714, 2698-2716, 2699-2717, 2700-2718, 2711-2729, 2734-2752, 2736-2754, 2740-2758, 2741-2759, 2742-2760, 2747- 2765, 2761-2779, 2763-2781, 2790-2808, 2822-2840, 2823-2841, 2843-2861, 2844-2862, 2849-2867, 2850-2868, 2852-2870, 2853-2871, 2856-2874, 2857-2875, 2860-2878, 2861-2879, 2862-2880, 2863-2881, 2864-2882, 2 865-2883, 3124-3142, 3126-3144, 3129-3147, 3130-3148, 3131-3149, 3135-3153, 3136-3154, 3138-3156, 3141-3159, 3143-3161, 3144-3162, 3172-3190, 3173-3191, 3174-3192, 3175-3193, 3178-3196, 3179-3197, 3180-31 The complementary sequences of 98, 3181-3199, 3182-3200, 3184-3202, 3185-3203, 3186-3204, 3187-3205, 3205-3223, 3206-3224, 3208-3226, 3211-3229, 3212-3230, 3216-3234, 3217-3235, 3220-3238, 3222-3240, 3223-3241, or 3225-3243 differ by 0, 1, 2, or 3 nucleotides.
[0016] In some embodiments, the dsRNA agent comprises at least one modified nucleotide. In some embodiments, all or substantially all nucleotides of the antisense strand are modified nucleotides. In some embodiments, all or substantially all nucleotides of both the sense and antisense strands are modified nucleotides. In some embodiments, at least one modified nucleotide includes: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seco nucleotide mimic, locked nucleotide, open-ring nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debase nucleotide, ribitol, reverse nucleotide, reverse abase nucleotide, reverse 2'-OMe nucleotide, reverse 2'-deoxynucleotide, isomannitol nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotide including 5'-thiophosphate group, 5'-phosphonate modified nucleotide, nucleotide modified with 5'-phosphate or 5'-phosphate mimic, or terminal nucleotide linked to a cholesterol derivative or dodecanoic acid bisdecamide group, 2'-amino modified nucleotide, phosphoramide, or non-natural bases including nucleotides.
[0017] In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides, 2'-fluoronucleotides, and UNA-modified nucleotides, wherein fewer than 6 of the modified nucleotides are 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 3 or 5 2'-fluoronucleotides, preferably 5 2'-fluoronucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, wherein fewer than 4 of the modified nucleotides are 2'-fluoronucleotides. In some embodiments, the sense strand comprises 3 2'-fluoronucleotides. In some embodiments, the antisense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methylnucleotides and 2'-fluoronucleotides, wherein at least 14 of the modified nucleotides are 2'-O-methylnucleotides, and the nucleotides at positions 2, 5, 7, 11, 12, 14, and / or 16, counting from the first matching position at the 5' end of the antisense strand, are independently 2'-fluoronucleotides. In some embodiments, the antisense strand comprises at least one UNA-modified nucleotide and five 2'-fluoronucleotides. In some embodiments, the antisense strand comprises one UNA-modified nucleotide at position 7, counting from the first matching position at the 5' end, and five 2'-fluoronucleotides at positions 2, 5, 12, 14, and 16, with the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises one UNA-modified nucleotide at position 7, counting from the first matching position at the 5' end, and five 2'-fluoronucleotides at positions 2, 5, 11, 14, and 16, with the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 7, 12, 14, and 16, counting from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the antisense strand comprises five 2'-fluoronucleotides at positions 2, 7, 11, 14, and 16, counting from the first matching position at the 5' end, with the remainder being 2'-O-methylnucleotides. In some embodiments, the sense strand comprises 15 or more modified nucleotides independently selected from 2'-O-methyl nucleotides and 2'-fluoro nucleotides, preferably, wherein at least 18 of the modified nucleotides are 2'-O-methyl nucleotides, and the nucleotides at positions 9, 11 and / or 13, counting from the first matching position from the 3' end of the sense strand, are 2'-fluoro nucleotides.
[0018] In some embodiments, the dsRNA agent comprises one or more nucleotides modified with a 5'-phosphate or a 5'-phosphate mimic. In some embodiments, the phosphate mimic is 5'-vinylphosphonate (VP). In some embodiments, a 5'-phosphate or 5'-phosphate mimic modified nucleotide is introduced at the 5' end of the antisense strand.
[0019] In some embodiments, the phosphate mimicry of the 5'-terminal nucleotide has a fragment represented by the following formula:
[0020] Where: Q8 is O, S, SO, SO2, PR 16 R 17 Or NR 11 ;R 16 and R 17 Independently selected from (=O), (=S), OH, SH, C1-C6 alkyl and NR 18 R 19 ; Ra and Rc are each independently selected from hydroxyl or protected hydroxyl, mercapto or protected mercapto, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, protected or optionally substituted amino, native or modified nucleoside; and R b For O, S, or NR 12 R 12 Protected by hydrogen, C1-C6 alkyl and amino groups; The substituents in the substituted amino group are selected from: optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl, acetyl; R 11 R 18 and R 19 Independently selected from H, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, methanesulfonyl, and sulfonic acid groups; Each substituent group comprises one or more optional substituents independently selected from the following: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkyl mercapto, and CN; “ "" indicates a bond attached to a fragment of the 5'-terminal nucleotide. In some embodiments, Q8 is bonded to the 4'-carbon or 5'-carbon of the sugar or sugar-substituted portion of the 5'-terminal nucleotide.
[0021] In some embodiments, the dsRNA agent contains an E-vinylphosphonate nucleotide at the 5' end of the guide strand.
[0022] In some embodiments, the dsRNA reagent comprises a 5'-phosphate mimic nucleotide represented by formula (VIII) or its stereoisomer or racemate at the 5'-end of the guide strand: Formula (VIII) Where: Q8 represents O, S, SO, SO2, and PR. 16 R 17 or NR11 ;R 16 and R 17 Independently, it can be (=O), (=S), OH, SH, C1-C6 alkyl, or NR. 18 R 19 Ra and Rc are each independently selected from hydroxyl or protected hydroxyl, mercapto or protected mercapto, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, protected or optionally substituted amino, native or modified nucleosides; and R b For O, S, or NR 12 R 12 Protected by hydrogen, C1-C6 alkyl, or amino groups; Q1 and Q2 are each independently H, halogen, -CN, or optionally substituted C1-C6 alkyl groups; The substituents in the substituted amino group are selected from: optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl, acetyl; R 11 R 18 and R 19 Independently, it is H, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, methanesulfonyl, and sulfonic acid groups; Z is a nucleoside containing a sugar or a sugar-substituted portion; T3 is an internucleotide linker used to link the 5'-terminal nucleotide of formula (VIII) or its stereoisomers to an existing guide chain; Each substituent comprises one or more substituents, optionally independently selected from: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkyl mercapto, CN.
[0023] In one specific embodiment, Q8 in formula (VIII) is S, SO, or SO2. In one specific embodiment, Q1 and Q2 in formula (VIII) are each independently H. In one specific embodiment, the sugar or sugar substitution moiety in formula (VIII) includes a 5-membered furanyl ring, a non-furanyl ring, or a 5-6 membered carbon ring system or an open system. In one specific embodiment, the sugar substitution moiety in formula (VIII) is selected from morpholinyl, cyclohexenyl, cyclohexyl, cyclopentyl, pyranyl, or cyclohexanol. In one specific embodiment, the sugar moiety in formula (VIII) is a furanyl sugar. In one specific embodiment, the sugar or sugar substitution moiety in formula (VIII) includes an open-ring nucleobase analog (UNA) or a glycerol nucleobase analog (GNA). In one specific embodiment, the sugar or sugar substitution moiety in formula (VIII) includes locked nucleic acid (LNA) or bridging nucleic acid (BNA). In one specific embodiment, Q8 in formula (VIII) is bonded to the 4'-carbon or 5'-carbon of the sugar or sugar substitution moiety. In one particular embodiment, Rb in formula (VIII) is oxygen. In one particular embodiment, Ra and Rc in formula (VIII) are each independently selected from OH, SH, NH2, or NHSO2CH3.
[0024] In some embodiments, the dsRNA agent is contained in the 5-strand of the guide strand. - The terminal includes a nucleotide modified with a 5'-phosphate mimic, wherein the 5'-phosphate mimic is any of the following structures or its stereoisomers or racemates:
[0025] “ "Represents the existing bootstrap chain 5" The part connected at the end.
[0026] In some embodiments, the internucleotide linker is independently selected from phosphodiester linkers, phosphotriester linkers, or thiophosphate linkers, dithiophosphate linkers, alkylphosphonates, aminophosphonates, phosphonates, phosphonites, thiophosphatamides, or phosphatamides. To illustrate a 5'-phosphate-mimicking modified nucleotide having a phosphodiester linker, a non-limiting example is Phos-15-1. It has the following structure: .
[0027] In some embodiments, the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linker groups. In some embodiments, the one or more targeting groups or linker groups target receptors mediated to CNS tissues or liver tissues, such as hydrophilic ligands or lipophilic moieties. In some embodiments, the one or more targeting groups or linker groups target brain tissues or spinal cord tissues, such as the striatum or dorsal root ganglia. In some embodiments, the one or more targeting groups or linker groups bind to a sense strand. In some embodiments, the dsRNA agent comprises a targeting group that binds to the 5' end of the sense strand. In some embodiments, the dsRNA agent comprises a targeting group that binds to the 3' end of the sense strand. In some embodiments, the targeting group or linker group comprises N-acetylgalactosamine (GalNAc).
[0028] In some embodiments, the targeting group has a structure as shown in formula (X): Formula (X) Each n'' is independently selected from 1 or 2.
[0029] In some embodiments, the targeting group has the following structure:
[0030] In some embodiments, the dsRNA agent includes a targeting group conjugated to the 5' end of the sense strand; preferably, the targeting group is GLO-1 to GLO-16 and GLS-1 as described above. To GLS-16 Any of the above, more preferably, the targeting group is the aforementioned GLS-15 .
[0031] In some embodiments, one or more lipophilic portions are attached to one or more end or internal locations on at least one chain. In some embodiments, one or more lipophilic portions are attached to one or more internal locations on at least one chain via a connector or carrier. In some embodiments, internal locations include all locations except for the two end locations of each end of at least one chain. In some embodiments, internal locations include all locations except for the three end locations of each end of at least one chain. In some embodiments, internal locations do not include the cleavage site region of the sense chain. In some embodiments, internal locations include all locations except for positions 9-11 counting from the first matching position at the 3' end of the sense chain. In some embodiments, internal locations include all locations except for positions 11-13 counting from the first matching position at the 3' end of the sense chain. In some embodiments, internal locations do not include the cleavage site region of the sense chain. In some embodiments, internal locations do not include the cleavage site region of the antisense chain. In some embodiments, internal locations include all locations except for positions 12-14 counting from the 5' end of the antisense chain. In some embodiments, the internal positions include all positions except for positions 11-13 from the 3' end of the sense chain and positions 12-14 from the 5' end of the antisense chain (all counting from the first matching position).
[0032] In some embodiments, the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound. In some embodiments, the lipophilic moiety is selected from the group consisting of lipids, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O-(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytriphenylmethyl, or phenoxazine. In some embodiments, the lipophilic moiety comprises saturated or unsaturated C4-C... 30 The hydrocarbon chain, and optional functional groups selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. In some embodiments, the lipophilic moiety comprises saturated or unsaturated C6-C groups. 18 Hydrocarbon chain. In some embodiments, the lipophilic portion comprises a saturated or unsaturated C16 hydrocarbon chain.
[0033] In some embodiments, the lipophilic portion is conjugated by a carrier that replaces one or more nucleotides in an internal location or double-stranded region. In some embodiments, the carrier is a cyclic group selected from pyrrolidinyl, pyrazolinyl, pyrazolinyl, imidazolinyl, imidazolinyl, piperidinyl, piperazinyl, [1,3]dioxacyclopentyl, oxazolinyl, isoxazolinyl, morpholinyl, thiazolinyl, isothiazolinyl, quinoxolinyl, pyridazinoneyl, tetrahydrofuranyl, and decahydronaphthyl; or a non-cyclic portion based on a serine or diethanolamine backbone.
[0034] In some embodiments, the lipophilic moiety is conjugated to a double-stranded RNAi agent via a linker comprising an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide bond, click reaction product, or carbamate. In some embodiments, the lipophilic moiety is conjugated to a nucleotide, sugar moiety, or nucleoside internucleotide bond. In some embodiments, the lipophilic moiety or targeting ligand is bound via a biolytic linker selected from DNA, RNA, disulfides, amides, galactosamine, glucosamine, glucose, galactose, mannose, or combinations thereof.
[0035] In some embodiments, the antisense strand includes an invab residue at its 3' end. In some embodiments, the sense strand includes one or two invab residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, each end of the sense strand includes an invab residue. In some embodiments, each end of the sense strand includes an imann residue. In some embodiments, the dsRNA agent has two blunt ends. In some embodiments, at least one strand includes a 3' overhang of at least one nucleotide. In some embodiments, at least one strand includes a 3' overhang of at least two nucleotides.
[0036] In some embodiments, the antisense strand includes a reverse abase residue at its 3' end. In some embodiments, the sense strand includes one or two reverse abase residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, the 3' and 5' ends of the sense strand each independently include a reverse abase residue. In some embodiments, the 3' and 5' ends of the sense strand each independently include an imann residue. In some embodiments, the sense strand includes two reverse abase residues at its 3' and 5' ends, and the residue at the 3' or 5' end further binds to a targeting group, preferably the aforementioned GLS-15. In some embodiments, the sense chain includes a reverse abase-free residue at the 3' end, and the 5' end is further bound to a targeting group, preferably the aforementioned GLS-15. In some embodiments, the sense strand includes two Imann residues at the 3' and 5' ends, and the residues at the 3' or 5' end are further conjugated to a targeting group, preferably the aforementioned GLS-15. .
[0037] In some embodiments, at least one linker of the sense strand and / or antisense strand is a phosphodiester (PO) bond. In some embodiments, at least one linker of the sense strand and / or antisense strand is a modified linker. In some embodiments, at least one linker of the sense strand and / or antisense strand is a phosphate thioester (PS) bond. In some embodiments, the dsRNA agent includes at least one phosphate thioester nucleoside interlinking bond. In some embodiments, the sense strand includes at least one phosphate thioester nucleoside interlinking bond. In some embodiments, the antisense strand includes at least one phosphate thioester nucleoside interlinking bond. In some embodiments, the sense strand includes 1, 2, 3, 4, 5, or 6 phosphate thioester nucleoside interlinking bonds. In some embodiments, the antisense strand includes 1, 2, 3, 4, 5, or 6 phosphate thioester nucleoside interlinking bonds. In some embodiments, at least one phosphate thioester (PS) bond is introduced at the 5' end, 3' end, or both ends of the sense strand and / or antisense strand. In some embodiments, one, two, three, four, five, or six phosphate-thioester (PS) bonds are introduced at the 5' end, 3' end, or both ends of the sense strand and / or antisense strand. In some embodiments, the 5' end of the antisense strand includes two phosphate-thioester nucleoside bonds. In some embodiments, the 3' end of the antisense strand includes two phosphate-thioester nucleoside bonds. In some embodiments, the 5' end and the 3' end of the antisense strand independently include two phosphate-thioester nucleoside bonds. In some embodiments, at least two modified or unmodified nucleotides at one or both ends of the antisense strand are linked by phosphate-thioester bonds. In some embodiments, three modified or unmodified nucleotides at one or both ends of the antisense strand are linked by phosphate-thioester bonds. In some embodiments, at least two modified or unmodified nucleotides at one or both ends of the sense strand are linked by phosphate-thioester bonds. In some embodiments, three modified or unmodified nucleotides at one or both ends of the sense strand are linked by phosphate-thioester bonds. In some embodiments, the three modified or unmodified nucleotides at the 5' end of the sense strand are linked by a phosphate thioester bond, and the two modified or unmodified nucleotides at the 3' end of the sense strand are linked by a phosphate thioester bond. In some embodiments, one or more inverted abase residues or one or more Imann residues are attached to any one or both ends of the sense strand by a phosphate thioester bond. In some embodiments, the targeting group is further attached to any end of the sense strand by a phosphate thioester bond. In some embodiments, the targeting group is further attached to the 5' end of the sense strand by a phosphate thioester bond.
[0038] In some embodiments, the sense strand sequence of the SCN9A dsRNA agent of the present invention can be represented by formula (I):
[0039] 5′-(N′ L ) n′ N′ L N′ L N′ N1N′ N2 N′ N3 N′ N4 N′ L N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ (I)
[0040] in: Each N′ F Represents nucleotides with 2'-fluorine modification; each N′ N1 、N′ N2 、N′ N3 、N′ N4 、N′ N5 and N′ N6 Independently representing modified or unmodified nucleotides; each N′ L The nucleotides are independently represented as modified or unmodified nucleotides, but not as nucleotides with 2'-fluorine modification, and m′ and n′ are each independently integers from 0 to 7.
[0041] In some embodiments, the modified nucleotide is a modified nucleotide as defined above.
[0042] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide or a 2'-F modified nucleotide.
[0043] In some embodiments, N′ N4 and N′ N5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0044] In some embodiments, N′ N2 and N′ N4 Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0045] In some embodiments, N′ N4 and N′ N5 Each of these independently represents a 2'-fluorinated nucleotide, m' being 2, and each N′ L 、N′ N1 、N′ N2 、N′ N3 and N′ N6 Independently represents 2'-O-methyl nucleotide.
[0046] In some embodiments, N′ N2 and N′ N4Each of these represents a 2'-fluorinated nucleotide independently, m' being 4, and each N′ L 、N′ N1 、N′ N3 、N′ N5 and N′ N6 Independently represents 2'-O-methyl nucleotide.
[0047] In some embodiments, m′ is 4 and n′ is 3.
[0048] In some embodiments, m′ is 2 and n′ is 3, or m′ is 2 and n′ is 4, or m′ is 2 and n′ is 5.
[0049] In some embodiments, the antisense strand sequence of the SCN9A dsRNA agent of the present invention can be independently represented by formula (II): 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M9 N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′ (II) in: Each N F Represents nucleotides with 2'-fluorine modification; each N M1 N M2 N M3 N M4 N M5 N M6 N M7 N M8 and N M9 Independently representing modified or unmodified nucleotides; each N L and N Z Independently represents a modified or unmodified nucleotide, but not a nucleotide with 2'-fluorine modification; and n is an integer from 0 to 7.
[0050] In some embodiments, the modified nucleotide is a modified nucleotide as defined above.
[0051] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide, a 2'-F modified nucleotide, an UNA modified nucleotide, or a nucleotide containing a phosphate ester mimic.
[0052] In some embodiments, each N M1 N M2 N M3 N M4 N M5 N M6 N M7 N M8 N M9 and N Z Independently represents a 2'-fluorine modified nucleotide, a 2'-O-methyl nucleotide, an UNA modified nucleotide, or a nucleotide containing a phosphate ester mimic.
[0053] In some embodiments, each N L Independently represents 2'-O-methyl nucleotide.
[0054] In some embodiments, N M2 N M3 and N M6 Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0055] In some embodiments, N M2 N M6 and N M9 Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0056] In some embodiments, N M2 N M3 and N M7 Each independently represents a 2'-fluorinated nucleotide, and N M6 This indicates a nucleotide modified with UNA.
[0057] In some embodiments, N M2 N M7 and N M9 Each independently represents a 2'-fluorinated nucleotide, and N M6 This indicates a nucleotide modified with UNA.
[0058] In some embodiments, N M2 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide, and each N M1 N M4 N M5 N M7 N M8 and N LIndependently represents 2'-O-methyl nucleotide.
[0059] In some embodiments, N M2 N M3 and N M7 Each independently represents a 2'-fluorinated nucleotide, N M6 This indicates a nucleotide modified with UNA, and N M1 N M4 N M5 N M8 and N L Each can be used independently to represent a 2'-O-methyl nucleotide.
[0060] In some embodiments, N Z This represents a nucleotide modified with a 5'-phosphonate.
[0061] In some embodiments, N Z It is a vinylphosphonate-modified nucleotide.
[0062] In some embodiments, N Z It is a Vpu It has a structure .
[0063] In some embodiments, N Z Choose from the following groups: , , , , , , , , , or its stereoisomers or racemates.
[0064] In some embodiments, n is 1, or n is 2, or n is 3.
[0065] In some embodiments, the SCN9A dsRNA duplex of the present invention can be represented by formula (III), and the complementary region comprises at least 15 consecutive nucleotides, wherein: Meaningful chain: 5′-(N′) L ) n′ N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ L N′ F N′ L N′ N5N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ Antisense chain: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N M9 N M4 N L N M5 N M6 N L N M7 N M8 N L N F N z -5′ (III) in: Each chain is approximately 17 to 30 nucleotides in length; Each N F and N′ F Independently represents a nucleotide modified with 2'-fluorine; N M1 N M2 N M3 N M4 N M5、 N M6 N M7 N M8 N M9 、N′ N1 、N′ N2 、N′ N3 、N′ N4 、N′ N5 and N′ N6 Each N represents a modified or unmodified nucleotide independently; z N L and N′ L Each nucleotide represents a modified or unmodified nucleotide independently, but not a nucleotide with 2'-fluorine modification, and m′, n′, and n are each an independent integer from 0 to 7.
[0066] In some embodiments, the modified nucleotide is a modified nucleotide as defined above.
[0067] In some embodiments, the modified nucleotide is a 2'-OMe modified nucleotide, a 2'-F modified nucleotide, an UNA modified nucleotide, or a nucleotide containing a phosphate ester mimic.
[0068] In some embodiments, each N′ N1 、N′ N2 、N′ N3 、N′ N4 、N′ N5 and N′ N6 Independently represents a 2'-fluorine modified nucleotide or a 2'-O-methyl nucleotide.
[0069] In some embodiments, each N′ L and N L Independently represents 2'-O-methyl nucleotide.
[0070] In some embodiments, each N M1 N M2 N M3 N M4 N M5 N M6 N M7 N M8 N M9 and N Z Independently represents a 2'-fluorine modified nucleotide, a 2'-O-methyl nucleotide, an UNA modified nucleotide, or a nucleotide containing a phosphate ester mimic.
[0071] In some embodiments, N′ N2 and N′ N4 Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0072] In some embodiments, N′ N4 and N′ N5 Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0073] In some embodiments, N′ N4 and N′ N5 Each of these independently represents a 2'-fluorinated nucleotide, m' being 2, and each N′ L 、N′ N1 、N′ N2 、N′ N3 and N′ N6 Independently represents 2'-O-methyl nucleotide.
[0074] In some embodiments, N′ N2 and N′ N4 Each of these represents a 2'-fluorinated nucleotide independently, m' being 4, and each N′ L 、N′N1 、N′ N3 、N′ N5 and N′ N6 Independently represents 2'-O-methyl nucleotide.
[0075] In some embodiments, N M2 N M3 and N M6 Each independently represents a 2'-fluorinated nucleotide; in one embodiment, N M2 N M3 and N M6 All are nucleotides modified with 2'-fluorine.
[0076] In some embodiments, N M2 N M3 and N M7 Each independently represents a 2'-fluorinated nucleotide, and N M6 This indicates a nucleotide modified with UNA.
[0077] In some embodiments, N M2 N M6 and N M9 Each can be used independently to represent a nucleotide modified with 2'-fluorine.
[0078] In some embodiments, N M2 N M7 and N M9 Each independently represents a 2'-fluorinated nucleotide, and N M6 This indicates a nucleotide modified with UNA.
[0079] In some embodiments, N Z This represents a nucleotide modified with a 5'-phosphonate.
[0080] In some embodiments, N Z It is a vinylphosphonate-modified nucleotide.
[0081] In some embodiments, N Z It is a Vpu It has a structure .
[0082] In some embodiments, N Z Groups selected from the following: , , , , , , , , , or its stereoisomers or racemates.
[0083] In some embodiments, n′ is 1 and m′ is 2, n′ is 2 and m′ is 2, or n′ is 1 and m′ is 4, or n′ is 3 and m′ is 2, or n′ is 3 and m′ is 4, or n′ is 4 and m′ is 2, or n′ is 5 and m′ is 2.
[0084] In some embodiments, n is 1, or n is 2, or n is 3.
[0085] In some embodiments of formula (II) or (III), the antisense strand includes a reverse abase residue at its 3' end. In some embodiments of formula (I) or (III), the sense strand includes one or two reverse abase residues and / or one or two imann residues at its 3' and / or 5' ends. In some embodiments, the 3' and 5' ends of the sense strand each independently include a reverse abase residue. In some embodiments of formula (I) or (III), the 3' end of the sense strand each independently includes a reverse abase residue. In some embodiments of formula (I) or (III), the 3' and 5' ends of the sense strand each independently include an imann residue. In some embodiments of formula (I) or (III), the sense strand includes a reverse abase residue at its 3' end, and the 5' end is further bound to a targeting group, which mediates delivery to central nervous system tissue or liver tissue, such as a hydrophilic ligand, optionally the aforementioned GLS-15. In some embodiments of formula (I) or (III), the sense chain includes an inverted abase-free residue at both the 3' and 5' ends, and the residue at the 3' or 5' end further binds to a targeting group that mediates delivery to central nervous system tissue or liver tissue, such as a hydrophilic ligand, optionally the aforementioned GLS-15. In some embodiments of formula (I) or (III), the sense chain includes an imann residue at both the 3' and 5' ends, and the residue at the 3' or 5' end is further conjugated to a targeting group (e.g., a hydrophilic ligand) mediating delivery to central nervous system tissue or liver tissue, optionally being the aforementioned GLS-15. In some embodiments, the above-described dsRNA agent has two blunt ends. In some embodiments of formula (I), (II), or (III), at least one strand includes a 3' overhang of at least one nucleotide. In some embodiments of formula (I), (II), or (III), at least one strand includes a 3' overhang of at least two nucleotides.
[0086] In some embodiments of formula (I), (II) or (III), N M1 N M2 N M3 NM4 N M5 N M6 N M7 N M8 N M9 、N′ N1 、N′ N2 、N′ N3 、N′ N4 、N′ N5 、N′ N6 、N′ L N L and N z Each nucleotide is independently linked to an adjacent nucleotide via a phosphodiester (PO) bond. In some embodiments of formula (I), (II), or (III), N M1 N M2 N M3 N M4 N M5 N M6 N M7 N M8 N M9 、N′ N1 N ′N2 、N′ N3 、N′ N4 、N′ N5 、N′ N6 、N′ L N L and N z At least one of the nucleotides is linked to an adjacent nucleotide via a phosphate thioester (PS) bond. In some embodiments of formula (I), (II), or (III) above, including a reverse abase residue, an imann residue, and / or a targeting group, the linking bonds at positions 1-10 of the terminal position of each end of the chain independently contain 1, 2, 3, 4, 5, or 6 phosphate thioester (PS) bonds. In some embodiments of formula (I), (II), or (III) above, including a reverse abase residue, an imann residue, and / or a targeting group, the linking bonds at positions 1-5 of the terminal position of each end of the chain independently contain 1, 2, or 3 phosphate thioester (PS) bonds. In some embodiments of formula (I), (II), or (III) above, including a reverse abase residue, an imann residue, and / or a targeting group, the linking bonds at positions 1-3 of the terminal position of each end of the chain independently contain 1 or 2 phosphate thioester (PS) bonds.
[0087] In some embodiments, any of the meaningful chains in Table 1 may be further modified according to the pattern shown in formula (I) or (III) above.
[0088] In some embodiments, any of the antisense chains in Table 1 may be further modified according to the pattern shown in formula (II) or (III) above.
[0089] In some embodiments, any of the double strands in Table 1 may be further modified according to the pattern shown in formula (III) above.
[0090] In some embodiments, the antisense strand length of the dsRNA agent is independently 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the sense strand length of the dsRNA agent is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, both the sense and antisense strands are 23 nucleotides long. In some embodiments, both the sense and antisense strands are 21 nucleotides long.
[0091] In some embodiments of the above-described dsRNA agent, the SCN9A mRNA transcript is SEQ ID NO: 1.
[0092] In some embodiments, the dsRNA agent targets the corresponding portions of the SCN9A mRNA transcripts disclosed in Table 1 and / or the target regions of the aforementioned SCN9A mRNA transcripts.
[0093] In some embodiments of the above-described dsRNA agents, the partially complementary region to the mRNA encoding SCN9A comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides, wherein the complementarity of the consecutive nucleotides to the target region of any of the above-described SCN9A mRNA transcripts differs by no more than 0, 1, 2, or 3 nucleotides.
[0094] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotides 2 to 18 of the antisense strand comprise a region complementary to the SCN9A mRNA transcript, the complementary region comprising at least 15, 16, or 17 consecutive nucleotides differing by 0, 1, 2, or 3 nucleotides from one of the antisense sequences listed in one of Tables 1-3, and optionally includes a targeting ligand.
[0095] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region partially complementary to the mRNA encoding SCN9A, and the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides differing from any of the antisense sequences listed in Tables 1-3 by no more than 1, 2, or 3 nucleotides. In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the antisense strand comprises a region partially complementary to the mRNA encoding SCN9A, and the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides from the antisense sequences listed in any of Tables 1-3.
[0096] In some embodiments, the antisense strand of the dsRNA agent is at least substantially complementary to any of the target regions of SEQ ID NO: 1, and is preferably provided in any of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent is completely complementary to any of the target regions of SEQ ID NO: 1, and is preferably provided in any of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense strand sequence as described in any of Tables 1-3, wherein the sense strand sequence is at least substantially complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises a sense strand sequence as described in any of Tables 1-3, wherein the sense strand sequence is completely complementary to the antisense strand sequence in the dsRNA agent. In some embodiments, the dsRNA agent comprises an antisense strand sequence as described in any of Tables 1-3. In some embodiments, the dsRNA agent comprises a sequence listed as a double-stranded sequence in any of Tables 1-3.
[0097] In some embodiments, the modified sense chain has any of the modification patterns described in Tables 2-3. In some embodiments, the modified antisense chain has any of the modification patterns described in Tables 2-3. In some embodiments, the modified sense chain is any of the modified sense chain sequences described in Tables 2-3. In some embodiments, the modified antisense chain is any of the modified antisense chain sequences described in Tables 2-3.
[0098] According to one aspect of the invention, a composition is provided comprising any of the embodiments described above regarding the dsRNA agents of the invention. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents. In some embodiments, the composition is packaged in a kit, container, package, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous administration, intrathecal administration, intracranial administration, intraventricular administration, intracerebral administration, or intravenous (IV) administration.
[0099] According to another aspect of the invention, a cell is provided comprising any embodiment of the dsRNA agent described above. In some embodiments, the cell is a mammalian cell, optionally a human cell. In some embodiments, the cell is a neuron (e.g., a primary sensory neuron).
[0100] According to another aspect of the present invention, a method for inhibiting SCN9A gene expression in cells is provided, the method comprising: (i) preparing cells containing an effective amount of any embodiment of the dsRNA agent of the present invention described above or any embodiment of the composition of the present invention described above. In some embodiments, the method further comprises: (ii) maintaining the prepared cells for a sufficient time to allow degradation of the mRNA transcript of the SCN9A gene, thereby inhibiting SCN9A gene expression in the cells. In some embodiments, the cells are in a subject, and the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the cells are in a subject, and the dsRNA agent is administered to the subject intravenously. In some embodiments, the cells are in a subject, and the dsRNA agent is administered to the subject intracranially or intrathecally. In some embodiments, the cells are in a subject, and the dsRNA agent is administered to the subject intrathecally, intraventricularly, or intracerebrally. In some embodiments, the method further includes assessing SCN9A gene inhibition after administration of a dsRNA agent to a subject, wherein the assessment method includes: (i) determining one or more physiological characteristics of the subject’s SCN9A-related disease or condition, and (ii) comparing the determined physiological characteristics with pre-treatment baseline physiological characteristics of the SCN9A-related disease or condition and / or control physiological characteristics of the SCN9A-related disease or condition, wherein the comparison indicates the presence or absence of one or more of the subject’s SCN9A gene expression inhibition. In some embodiments, the physiological characteristic is one or more of the following: the level of SCN9A mRNA, SCN9A protein, or another parameter functionally related to SCN9A expression levels. The reduction in SCN9A expression can also be indirectly assessed by measuring a decrease in SCN9A biological activity, such as a decrease in one or more of the following: the level of SCN9A mRNA, SCN9A protein, or another parameter functionally related to SCN9A expression levels, etc.
[0101] Another aspect of this disclosure provides a method for identifying whether a subject has or is at risk of developing a disease or condition characterized by enlarged neuronal endosomes and for selecting a treatment method for the subject, the method comprising: a) obtaining a nucleic acid sample from the subject; b) identifying whether the subject has a sodium voltage-gated channel α subunit 9 (SCN9A) mutation, which is associated with enlarged neuronal endosomes with SCN9A mutations; and c) selecting a sodium voltage-gated channel α subunit 9 (SCN9A)-targeting double-stranded RNA inhibitor (dsRNAi) and administering it to the subject in an amount sufficient to reduce the level of SCN9A in the subject's neurons, thereby identifying whether the subject has or is at risk of developing a disease or condition characterized by enlarged neuronal endosomes and for selecting a treatment method for the subject.
[0102] According to another aspect of the present invention, a method for inhibiting SCN9A gene expression in a subject is provided, the method comprising administering to the subject an effective amount of an embodiment of the above-described dsRNA agent of the present invention or an embodiment of the above-described composition of the present invention. In some embodiments, the dsRNA agent is administered to the subject subcutaneously. In some embodiments, the dsRNA agent is administered to the subject intravenously. In some embodiments, the dsRNA agent is administered to the subject intracranially, intrathecally, intraventricularly, or intracerebrally. In some embodiments, the method further comprises: assessing the inhibition of the SCN9A gene after administration of the dsRNA agent, wherein the assessment method comprises: (i) determining one or more physiological characteristics of the subject’s SCN9A-related disease or condition, and (ii) comparing the determined physiological characteristics with pre-treatment baseline physiological characteristics of the SCN9A-related disease or condition and / or control physiological characteristics of the SCN9A-related disease or condition, wherein the comparison indicates the presence or absence of one or more of the subject’s SCN9A gene expression inhibition. In some embodiments, SCN9A gene expression can be assessed based on the level or changes in the level of any variable associated with SCN9A gene expression, such as the level of SCN9A mRNA, SCN9A protein, or another parameter functionally related to SCN9A expression levels. A reduction in SCN9A expression can also be indirectly assessed by measuring reductions in acute pain, chronic pain, dependence on analgesics, symptoms of erythromelalgia, wild-type SCN9A transcripts, mutant SCN9A transcripts, variant SCN9A transcripts, splice isoforms of SCN9A transcripts, and / or overexpressed SCN9A transcripts (relative to healthy subjects).
[0103] According to another aspect of the present invention, a method for treating a disease or condition associated with the presence of the SCN9A protein is provided, the method comprising: administering to a subject an effective amount of any of the above-described embodiments of the dsRNA agents of the present invention or any of the above-described compositions of the present invention to inhibit SCN9A gene expression. In some embodiments, the disease, condition, or condition associated with SCN9A is selected from the group consisting of: pain, such as acute or chronic pain (e.g., inflammatory pain, neuropathic pain, nociceptive pain, postoperative pain, persistent pain, hyperalgesia, desensitization, analgesia, Gerhardt's disease, Mitchell's disease, or Weir-Mitchell's disease, spontaneous pain (e.g., primary or secondary erythromelalgia), paroxysmal extreme pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with, for example, cancer, arthritis, diabetes, trauma, and viral infection), or other conditions associated with SCN9A expression.
[0104] In some embodiments, the method further includes administering an additional treatment regimen to the subject. In some embodiments, the additional treatment regimen includes treating an SCN9A-related disease or condition. In some embodiments, the additional treatment regimen includes administering one or more SCN9A antisense polynucleotides of the present invention to the subject, administering a non-SCN9AdsRNA therapeutic agent to the subject, and behavioral modification of the subject. In some embodiments, the additional treatment regimen is one or more of the following: nonsteroidal anti-inflammatory drugs (NSAIDs), acetaminophen, opioids or corticosteroids, acupuncture, therapeutic massage, dorsal root ganglion stimulation, spinal cord stimulation, or local analgesics disclosed herein or known in the art. In some embodiments, the dsRNA agent is administered subcutaneously to the subject. In some embodiments, the dsRNA agent is administered intravenously to the subject. In some embodiments, the dsRNA agent is administered intracranially, intrathecally, intraventricularly, or intracerebrally to the subject. In some embodiments, a dsRNA agent and a non-SCN9A dsRNA therapeutic agent may be administered to the subject simultaneously and / or in the same combination, or a non-SCN9A dsRNA therapeutic agent may be administered to the subject as part of a single composition or at different times and / or by another method known in the art or described herein. In some embodiments, the method further includes determining the efficacy of the double-stranded RNA (dsRNA) agent administered to the subject. In some embodiments, the method for determining the therapeutic effect on the subject includes: (i) determining one or more physiological characteristics of the subject’s SCN9A-related disease or condition, and (ii) comparing the determined physiological characteristics to pre-treatment baseline physiological characteristics of the SCN9A-related disease or condition, wherein the comparison indicates the presence, absence, and efficacy level of the double-stranded RNA (dsRNA) agent administered to the subject. In some embodiments, SCN9A gene expression may be assessed based on the level or change in the level of any variable associated with SCN9A gene expression, such as the level of SCN9A mRNA, SCN9A protein, or another parameter functionally related to the SCN9A expression level.
[0105] According to another aspect of the present invention, a method for reducing SCN9A protein levels in a subject is provided, the method comprising administering to the subject an effective amount of any of the above-described dsRNA agents of the present invention or any of the above-described compositions of the present invention to reduce SCN9A gene expression levels, compared to a pre-treatment baseline level of SCN9A protein in the subject. In some embodiments, the dsRNA agent is administered subcutaneously to the subject, or intracranially, intrathecally, intraventricularly, or intracerebrally, or intravenously.
[0106] According to another aspect of the invention, a method is provided to alter the physiological characteristics of a subject's SCN9A-related disease or condition compared to a pre-treatment baseline physiological characteristic. The method comprises administering to the subject an effective amount of any of the above-described dsRNA agents of the invention or any of the above-described compositions of the invention to alter the physiological characteristics of the subject's SCN9A-related disease or condition. In some embodiments, the dsRNA agent is administered subcutaneously, intracranially, intrathecally, intraventricularly, or intracerebrally to the subject, or intravenously. In some embodiments, the physiological characteristic is one or more of the following: the level of SCN9A mRNA, SCN9A protein, or another parameter functionally related to the subject's SCN9A expression level, etc.
[0107] According to another aspect of the invention, the above-described dsRNA agent is provided for a method of treating a disease or condition associated with the presence of the SCN9A protein. In some embodiments, the disease or condition is one or more of the following: pain, such as acute or chronic pain (e.g., inflammatory pain, neuropathic pain, nociceptive pain, postoperative pain, persistent pain, hyperalgesia, analgesia, Gerhardt's disease, Mitchell's disease, or Weir-Mitchell's disease), spontaneous pain (e.g., primary or secondary erythromelalgia), paroxysmal extreme pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with, for example, cancer, arthritis, diabetes, trauma, and viral infections), or other conditions associated with SCN9A expression.
[0108] According to another aspect of the invention, an antisense polynucleotide agent for inhibiting SCN9A protein expression is provided, the agent comprising 10 to 30 consecutive nucleotides, wherein at least one consecutive nucleotide is a modified nucleotide, and wherein the nucleotide sequence of the agent is approximately 80% complementary over its entire length to an equivalent region of the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the equivalent region is any target region of SEQ ID NO: 1, and the complementary sequence is a sequence provided in one of Tables 1-3. In some embodiments, the antisense polynucleotide agent comprises one of the antisense sequences provided in one of Tables 1-3.
[0109] According to another aspect of the invention, a composition comprising any of the above-described antisense polynucleotide agents is provided. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition further comprises one or more additional therapeutic agents for treating SCN9A-related diseases or conditions. In some embodiments, the composition is packaged in a kit, container, package, dispenser, pre-filled syringe, or vial. In some embodiments, the composition is formulated for subcutaneous, intrathecal, intracranial, intraventricular, intracerebral, or intravenous administration.
[0110] According to another aspect of the invention, a cell comprising any of the aforementioned antisense polynucleotide agents is provided. In some embodiments, the cell is a mammalian cell, optionally a human cell.
[0111] According to another aspect of the present invention, a method for inhibiting SCN9A gene expression in cells is provided, the method comprising: (i) preparing an antisense polynucleotide agent comprising an effective amount of any of the above embodiments. In some embodiments, the method further comprises (ii) maintaining the cells prepared in (i) for a sufficient time to allow degradation of the mRNA transcript of the SCN9A gene, thereby inhibiting the expression of the SCN9A gene in the cells.
[0112] According to another aspect of the present invention, a method for inhibiting SCN9A gene expression in a subject is provided, the method comprising administering to the subject an effective amount of any of the above-described antisense polynucleotide agents.
[0113] According to another aspect of the invention, a method for treating a disease or condition associated with the presence of the SCN9A protein is provided, the method comprising administering to a subject an effective amount of any of the antisense polynucleotide agents described above or any of the above-described compositions of the invention to inhibit SCN9A gene expression. In some embodiments, the disease or condition is one or more of the following: pain, such as acute or chronic pain (e.g., inflammatory pain, neuropathic pain, nociceptive pain, postoperative pain, persistent pain, hyperalgesia, analgesia, Gerhardt's disease, Mitchell's disease or Weir-Mitchell's disease, spontaneous pain (e.g., primary or secondary erythromelalgia), paroxysmal extreme pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with, for example, cancer, arthritis, diabetes, trauma, and viral infections), or other conditions associated with SCN9A expression.
[0114] According to another aspect of the present invention, a method for reducing SCN9A protein levels in a subject is provided, the method comprising administering to the subject an effective amount of any of the above-described antisense polynucleotide agents or any of the above-described compositions of the present invention to reduce SCN9A gene expression levels, compared to a pre-treatment baseline level of SCN9A protein in the subject. In some embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously, intracranially, intrathecally, intravenously, intracerebrally, or intravenously.
[0115] According to another aspect of the invention, an antisense polynucleotide agent for inhibiting SCN9A gene expression is provided, the agent comprising 10 to 30 consecutive nucleotides, wherein at least one of the consecutive nucleotides is a modified nucleotide, and wherein the nucleotide sequence of the agent is complementary to about 80% or about 85% of the equivalent region of the nucleotide sequence of SEQ ID NO: 1 over its entire length.
[0116] According to another aspect of the invention, a method is provided to alter the physiological characteristics of a subject's SCN9A-related disease or condition compared to a pre-treatment baseline physiological characteristic of the subject. The method comprises administering to the subject an effective amount of any of the above-described antisense polynucleotide agents or compositions of the invention to alter the physiological characteristics of the subject's SCN9A disease or condition. In some embodiments, the antisense polynucleotide agent is administered to the subject subcutaneously, intrathecally, or intravenously. In some embodiments, the physiological characteristic is one or more of the following: the level of SCN9A mRNA, SCN9A protein, or another parameter functionally related to SCN9A expression levels, etc.
[0117] SEQUENCE SUMMARY
[0118] SEQ ID NO: 1 and SEQ ID NO: 2 (reverse complementary) are human sodium voltage-gated channel α subunit 9 (SCN9A) mRNA [NCBI reference sequence: NM_001365536.1].
[0119] SEQ ID NO: 3 and SEQ ID NO: 4 (reverse complementary) are predicted cynomolgus monkey sodium voltage-gated channel α subunit 9 (SCN9A) mRNA [NCBI reference sequence: XM_045367186.1].
[0120] SEQ ID NO: 5 and SEQ ID NO: 6 (reverse complementary) are predicted rhesus monkey sodium voltage-gated channel α subunit 9 (SCN9A) mRNA [NCBI reference sequence: XM_028830805.1].
[0121] SEQ ID NO: 7 and SEQ ID NO: 8 (reverse complementary) are rat sodium voltage-gated channel α subunit 9 (SCN9A) mRNA [NCBI reference sequence: NM_133289.2].
[0122] SEQ ID NO:9-668, as shown in Table 1, is a sense chain sequence.
[0123] SEQ ID NO:669-1328, as shown in Table 1, is an antisense sequence.
[0124] Table 2 shows the chemically modified SEQ ID NO: 1329-1658.
[0125] SEQ ID NO:2063-2136, 2137-2244 are shown in Table 3. The delivery molecule is indicated as "GLX-__" at the 3' or 5' end of each sense strand. Detailed Implementation
[0126] This invention includes, but is not limited to, double-stranded (ds) RNAi agents that inhibit the expression of the sodium voltage-gated channel α subunit 9 (SCN9A) gene. This invention also includes compositions comprising an SCN9A RNAi agent and methods of using said compositions. The SCN9A RNAi agents disclosed herein can be attached to a delivery compound for delivery to cells, including CNS (e.g., brain) cells and hepatocytes. Pharmaceutical compositions of this invention may comprise at least one dsRNAi SCN9A agent and a delivery compound. In some embodiments of the compositions and methods of this invention, the delivery compound is a GalNAc-containing delivery compound. The SCN9A RNAi agent delivered to cells inhibits SCN9A gene expression, thereby reducing the activity of the SCN9A protein product of this gene in cells. The dsRNAi agents of this invention can be used to treat diseases and conditions related to SCN9A.
[0127] In some embodiments of the invention, reducing SCN9A expression in cells or subjects treats diseases or conditions associated with SCN9A expression in cells or subjects. In some embodiments, dsRNA leads to a reduction in SCN9A gene mRNA in one or more of the hippocampus, striatum, cortex, cerebellum, thalamus, hypothalamus, and spinal cord. Non-limiting examples of diseases and conditions that can be treated by reducing SCN9A activity include: pain, such as acute or chronic pain (e.g., inflammatory pain, neuropathic pain, nociceptive pain, postoperative pain, persistent pain, hyperalgesia, desensitization, analgesia, Gerhardt's disease, Mitchell's disease, or Weir-Mitchell's disease), spontaneous pain (e.g., primary or secondary erythromelalgia), paroxysmal extreme pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with conditions such as cancer, arthritis, diabetes, trauma, and viral infections), or other conditions where reducing the level and activity of the SCN9A protein is medically beneficial.
[0128] As used herein, “G,” “C,” “A,” and “U” typically represent nucleotides containing guanine, cytosine, adenine, and uracil as bases, respectively. However, it should be understood that the term “ribonucleotide” or “nucleotide” can also refer to modified nucleotides (described further below) or substitutional portions. Those skilled in the art will understand that guanine, cytosine, adenine, and uracil can be substituted with other portions without significantly altering the base-pairing properties of the oligonucleotide containing such substituted portions. For example, but not limited to, nucleotides containing inosine as a base can pair with nucleotides containing adenine, cytosine, or uracil. Therefore, in the nucleotide sequences of this invention, nucleotides containing uracil, guanine, or adenine can be substituted with nucleotides containing, for example, inosine. Sequences containing such substitutional portions are embodiments of this invention.
[0129] As used herein, “sodium voltage-gated channel α subunit 9” is used interchangeably with the term “SCN9A” to refer to the natural gene encoding the sodium voltage-gated channel α subunit 9, which is derived from any vertebrate or mammal, including but not limited to humans, cattle, chickens, rodents, mice, rats, pigs, sheep, primates, monkeys, and guinea pigs, unless otherwise stated. The term also refers to fragments and variants of natural SCN9A that retain at least one in vivo or in vitro activity of natural SCN9A. The amino acid sequence of the reference sequence and the complete coding sequence of the human SCN9A gene can be found, for example, in GenBank Ref Seq Accession No. NM_001365536.1 (SEQ ID NO:1 and SEQ ID NO:2). Mammal orthologs of the human SCN9A gene can be found, for example, in GenBank reference sequence XM_045367186.1, cynomolgus monkey (SEQ ID NO:3 and SEQ ID NO:4), GenBank reference sequence XM_028830805.1, rhesus monkey (SEQ ID NO:5 and SEQ ID NO:6), GenBank reference sequence NM_133289.2, and rat (SEQ ID NO:7 and SEQ ID NO:8). Other examples of SCN9A mRNA sequences are readily available using public databases such as GenBank, UniProt, Ensembl, and OMIM.
[0130] The following describes how to prepare and use compositions comprising single-stranded SCN9A (ssRNA) and dsRNA to inhibit SCN9A gene expression, as well as compositions and methods for treating diseases and conditions caused by or regulated by SCN9A gene expression. The term "RNAi" is also known in the art and may be referred to as "siRNA".
[0131] As used herein, the term "RNAi" refers to an agent containing RNA and mediating targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. As is known in the art, an RNAi target region, also defined as a "target area" or "target portion," is a continuous portion of the nucleotide sequence of an mRNA molecule formed during gene transcription, including messenger RNA (mRNA), which is the product of RNA processing of the primary transcript. The target portion or target region of the sequence will be at least long enough to serve as a substrate for RNAi-guided cleavage in or near that portion. The length of the target sequence can be 8-30 nucleotides (including end values), 10-30 nucleotides (including end values), 12-25 nucleotides (including end values), 15-23 nucleotides (including end values), 16-23 nucleotides (including end values), or 18-23 nucleotides (including end values), including all shorter lengths within each of these ranges. In some embodiments of the invention, the target sequence is 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the target sequence is 9 to 26 nucleotides in length (including end values), encompassing all subranges and integers therebetween. For example, although not intended to be limiting, in some embodiments of the invention, the target sequence is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, and this sequence is completely complementary or at least substantially complementary to at least a portion of the RNA transcript of the SCN9A gene. Some aspects of the invention include pharmaceutical compositions comprising one or more SCN9A dsRNA agents and a pharmaceutically acceptable carrier. In some embodiments of the present invention, as described herein, SCN9A RNAi inhibits the expression of the SCN9A protein.
[0132] As used herein, "dsRNA agent" refers to a composition containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that are capable of degrading or inhibiting the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. While not wishing to be limited to a particular theory, the dsRNA agents of this invention may function through RNA interference mechanisms (i.e., by interacting with RNA interference pathways in mammalian cells, such as RNA-induced silencing complexes or RISC) or through any alternative mechanisms or pathways. Methods well known in the art for silencing genes in plant, invertebrate, and vertebrate cells [see, for example (Sharp et al., GenesDev. 2001, 15:485; Bernstein, et al., (2001) Nature 409:363; Nykanen, et al., (2001) Cell 107:309; and Elbashir, et al., (2001) Genes Dev. 15:188)], the contents of which are incorporated herein by reference in their entirety. Gene silencing procedures known in the art can be used in conjunction with the disclosures provided herein to suppress SCN9A expression.
[0133] The dsRNA agents disclosed herein consist of a sense strand and an antisense strand, including but not limited to: short interfering RNA (siRNA), RNAi agents, microRNAs (miRNAs), short hairpin RNAs (shRNAs), and cleavage enzyme substrates. The antisense strand of the dsRNA agents described herein is at least partially complementary to the target mRNA. dsRNA double-stranded structures of varying lengths are known in the art for the purpose of inhibiting target gene expression. For example, dsRNAs with double-stranded structures of 19, 20, 21, 22, and 23 base pairs are known to effectively induce RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). Shorter or longer RNA double-stranded structures are also known in the art to effectively induce RNA interference. In some embodiments, the sense and antisense strands may be the same or different in length. In some embodiments, each strand is no more than 40 nucleotides long. In some embodiments, each strand is no more than 30 nucleotides long. In some embodiments, each strand is no more than 25 nucleotides long. In some embodiments, each strand is no more than 23 nucleotides long. In some embodiments, the length of each strand does not exceed 21 nucleotides. In some embodiments, the lengths of the sense and antisense strands of the RNAi agent can be 15 to 49 nucleotides, respectively. In some embodiments, the length of the antisense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of the sense strand is independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. As used herein, the terms "double-stranded region," "double-stranded region," and "complementary region" are used interchangeably and refer to regions known in the art where the sense strand and antisense strand are complementary or substantially complementary. In some embodiments, both the sense strand and antisense strand are 21 nucleotides in length. In some embodiments, the sense strand and antisense strand are complementary or substantially complementary, and the length of the complementary region is 15 to 23 nucleotides. In some embodiments, the length of the complementary region is 19-21 nucleotides. In some embodiments, the length of the complementary region is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.In some embodiments of the invention, the SCN9A dsRNA may comprise at least one strand of at least 21 nt in length, or may have a shorter double strand based on any of the sequences listed in Tables 1-3, but may also be effective if it has 1, 2, 3, or 4 fewer nucleotides at one or both ends compared to the dsRNAs listed in Tables 1-3. In some embodiments of the invention, the SCN9A dsRNA agent may have a partial sequence of at least 15, 16, 17, 18, 19, 20, or more consecutive nucleotides from one or more sequences in Tables 1-3, and its ability to inhibit SCN9A gene expression differs from the inhibition level produced by dsRNA containing the complete sequence by no more than 5%, 10%, 15%, 20%, 25%, or 30%. The sense sequences, antisense sequences, and duplexes disclosed in Tables 1-3 may be referred to herein as “parental” sequences. This means that the sequences disclosed in Tables 1-3 may be modified, shortened, lengthened, or substituted as described herein, and the resulting sequences retain all or at least a portion of the efficacy of their parental sequences in the methods and compositions of this invention. The sense and antisense strands included in the dsRNA of this invention are independently selected. The term “independently selected” as used herein means that each of two or more similar elements can be selected independently of the selection of other elements. For example, although not intended to be limiting, the “elements” of the two strands to be included in the duplex can be selected when preparing the dsRNA of this invention. One selected element, i.e., the sense sequence, may be SEQ ID NO:1629 (as shown in Table 2), while the other selected element, i.e., the antisense sequence, may be SEQ ID NO:1959, or may be SEQ ID NO:1959 modified, shortened, lengthened, and / or containing one, two, or three substitutions compared to its parental sequence SEQ ID NO:1959. It should be understood that the duplexes of the present invention do not necessarily include both the sense and antisense sequences shown in pairs in Tables 1-3. Each sense and antisense sequence in the tables is followed by its SEQ ID NO.
[0134] Some embodiments of the compositions and methods of the present invention include single-stranded RNA in the composition and / or administered to a subject. For example, the antisense strand listed in any of the tables in Tables 1-3 may be a composition or a composition administered to a subject to reduce SCN9A peptide activity and / or SCN9A gene expression in the subject. Table 1 shows the core extension base sequences of the antisense and sense strands of certain SCN9A dsRNA agents. Single-stranded antisense molecules that may be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as “single-stranded antisense agents” or “antisense polynucleotide agents”. Single-stranded sense molecules that may be included in certain compositions of the present invention and / or administered in certain methods of the present invention are referred to herein as “single-stranded sense agents” or “sense polynucleotide agents”. The term “base sequence” is used herein to refer to a polynucleotide sequence that is not chemically modified or delivers a compound. For example, the sense strand GAUUGUUUACAUGAUGGUCAA (SEQ ID NO: 309) shown in Table 1 is the base sequence of SEQ ID NO: 1629 in Table 2 and SEQ ID NO: 2031 in Table 3, where SEQ ID NO: 1629 and SEQ ID NO: 2031 show their chemical modifications and delivery compounds. The sequences disclosed herein can be assigned identifiers. For example, a single-stranded sense sequence can be identified as “sense strand SS#”; a single-stranded antisense sequence can be identified as “antisense strand AS#”; and a double-stranded sequence including both sense and antisense strands can be identified as “double-stranded AD# / AV#”.
[0135] Table 1 includes positive and antisense strands and provides the identifiers for the bistrands formed by the positive and antisense strands in the same row of Table 1. In some embodiments of the invention, the antisense sequence includes nucleobase u or nucleobase a at antisense sequence position 1. In some embodiments of the invention, the antisense sequence includes nucleobase u at antisense sequence position 1. As used herein, the term "matching position" in positive and antisense strands refers to the "paired" position in each strand when the two strands are bistranded. For example, in a 21-nucleobase positive strand and a 21-nucleobase antisense strand, the nucleobase at position 1 of the positive strand and the nucleobase at position 21 of the antisense strand are at a "matching position". In yet another non-limiting example, in a 23-nucleobase sense strand and a 23-nucleobase antisense strand, nucleobase 2 of the sense strand and position 22 of the antisense strand are at a matching position. In yet another non-limiting example, in both the 18-base sense strand and the 18-base antisense strand, the base at position 1 of the sense strand and the base at position 18 of the antisense strand are at a matching position, and the base 4 of the sense strand and the base 15 of the antisense strand are at a matching position. Those skilled in the art will understand how to identify matching positions in both double-stranded and paired sense and antisense strands.
[0136] The first column in Table 1 represents a bichain AV# containing the meaningful and antisense sequences from the same row. For example, Table 1 discloses a bichain designated as bichain AV# AV02028.um, which contains the meaningful chain SEQ ID NO: 9 and the antisense chain SEQ ID NO: 669. Therefore, each row in Table 1 identifies a bichain of the present invention, each bichain containing the meaningful and antisense sequences shown in the same row, with the assignment identifier for each bichain displayed in the first column of that row.
[0137] In some embodiments of the method of the present invention, an RNAi agent comprising any one of the polynucleotide sequences shown in Tables 1-3 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises a duplex comprising at least one base sequence listed in Table 1, including sequence modifications of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24. In some embodiments of the method of the present invention, an RNAi agent comprising any one of the polynucleotide sequences shown in Tables 1-3 is attached to a delivery molecule, a non-limiting example of which is a GalNAc compound or GLS-15. Delivery of compounds.
[0138] Table 1: Unmodified SCN9A RNAi agent antisense and sense strand sequences. All sequences are shown in 5' to 3' orientation. Double-stranded AV# is the number assigned to the two strands in the same row of the table.
[0139]
[0140] Table 2 shows the antisense and sense sequences of certain chemically modified SCN9A RNAi agents of the present invention. In some embodiments of the method of the present invention, the RNAi agent having the polynucleotide sequences shown in Table 2 is administered to cells and / or a subject. In some embodiments of the method of the present invention, the RNAi agent having the polynucleotide sequences shown in Table 2 is administered to a subject. In some embodiments of the present invention, the RNAi agent administered to the subject comprises the double strand identified in the first row of Table 2 and includes sequence modifications in the sense and antisense sequences shown in the third and sixth columns of the same row of Table 2, respectively. In some embodiments of the method of the present invention, the sequences shown in Table 2 may be attached to (also referred to herein as “conjugated to”) a compound capable of delivering the RNAi agent to the cells and / or tissues of a subject. Non-limiting examples of delivery compounds that may be used in some embodiments of the present invention are compounds containing GalNAc or containing (GLS-15) The compounds are listed in Table 2. In Table 2, the first column represents the double-stranded AV# of the base sequence shown in Table 1. Table 2 discloses the double-stranded AV# and also shows the chemical modifications contained in the sense and antisense sequences of the double strands. For example, Table 1 shows the single-stranded base sequences SEQ ID NO: 9 (sense) and SEQ ID NO: 669 (antisense), which together constitute a double-stranded structure, identified as: double-stranded AV# AV02028.um. Table 2 lists the double-stranded AV# AV02028, indicating that the double strands of SEQ ID NO: 1329 and SEQ ID NO: 1659 contain the base sequences of SEQ ID NO: 9 and SEQ ID NO: 669, respectively, but have the chemical modifications shown in the sense and antisense sequences shown in columns 3 and 6, respectively. The “sense strand SS#” in the second column of Table 2 is the assignment identifier for the sense sequence (including modifications) shown in column 3 of the same row. Table 2 shows the allocation identifier for the “Antisense AS#” in column 5, which is the antisense sequence (including modifications) shown in column 6. Table 2: Antisense and sense sequences of chemically modified SCN9A RNAi agents. All sequences are indicated from 5' to 3'. These sequences are used in certain contexts described herein. IN VITRO Test research.
[0141]
[0142] Table 3 shows the antisense and sense sequences of certain chemically modified SCN9A RNAi agents of the present invention. In some embodiments of the methods of the present invention, the RNAi agents shown in Table 3 are administered to cells and / or subjects. In some embodiments of the methods of the present invention, RNAi agents having the polynucleotide sequences shown in Table 3 are administered to subjects. In some embodiments of the present invention, the RNAi agent administered to the subject comprises the double strand identified in the first row of Table 3 and comprises sequence modification and / or delivery compounds in the sense and antisense sequences shown in the third and sixth columns of the same row of Table 3, respectively. These sequences are used in certain contexts described elsewhere herein. IN VIVO Testing and research. In some embodiments of the invention and methods, the sequences shown in Table 3 may be linked (also referred to herein as “conjugated to”) to a compound for delivery, a non-limiting example of which is a compound containing GalNAc, wherein the delivery compound is identified as “GLX-n” on the sense strand in the third column of Table 3. As used herein, “GLX-n” is used to represent “GLS-n”. The term "GLX-n" or "GLO-n" refers to a delivery compound ("X" can be "S" or "O") that can be attached to the 3' end of an oligonucleotide during synthesis. As used herein and shown in Table 3, "GLX-n" is used to indicate that the attached GalNAc-containing compound is compound GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 Any one of GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, the structure of each compound being provided elsewhere herein. Those skilled in the art will be able to prepare and use the dsRNA compounds of the present invention, wherein the attached delivery compound is GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 One of GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16. The first column of Table 3 provides the double-chain AD# assigned to the double-chains with meaningful and antisense sequences in that row. For example, double-chain AD# AD01081 is a double-chain with meaningful chain SEQ ID NO: 1989 and antisense chain SEQ ID NO: 2063. Each row in Table 3 provides one meaningful chain and one antisense chain, and discloses the double-chains with the meaningful and antisense chains shown. The “Sensitive Chain SS#” in the second column of Table 3 is the assignment identifier for the meaningful sequence (including modifications) shown in the third column of the same row. In Table 3, the "Ansense Chain AS#" in column 5 is the assignment identifier for the ansense sequence (including modifications) shown in column 6. Some chains with GalNAc contain "GLO-n" or "GLS-n". The compound's identifier is displayed as GLS-5. Or GLS-15 The resulting compounds are included in the examples of the methods and / or compositions of the present invention. Table 3 provides the antisense and sense strand sequences of the chemically modified SCN9A RNAi agents. All sequences are indicated from 5' to 3'. These sequences were used in certain in vivo assays described elsewhere herein. The delivery molecules used in in vivo studies are indicated as "GLO-n" or "GLS-n" at the 3' or 5' end of each sense strand. ".
[0143]
[0144] In some embodiments of the invention, the dsRNA (also referred to herein as a “double strand”) is the dsRNA disclosed in one of Tables 1-3. Each row in Tables 1-3 discloses a double strand comprising the sense and antisense sequences of that row. In addition to the double strands disclosed in Tables 1-3, it should be understood that in some embodiments, the double strands of the invention may comprise the sense and antisense sequences shown in Tables 1-3 that differ from the sequences shown in Tables 1-3 by zero, one, two, or three nucleotides. Therefore, as a non-limiting example, in some embodiments, the antisense strand in the duplex of the present invention may be SEQ ID NO: 1972, 1973, 1974, 1975, 1976, 1977, 1978 or 1979, wherein it has zero, one, two or three different nucleotides from the nucleotides in SEQ ID NO: 1972, 1973, 1974, 1975, 1976, 1977, 1978 or 1979, respectively.
[0145] It should be understood that the sense and antisense sequences in the double strands of the present invention can be selected independently. Therefore, the dsRNA of the present invention may include the sense and antisense strands of the double strands disclosed in one row of Tables 1-3. Alternatively, in the dsRNA of the present invention, one or both of the selected sense and antisense strands may include the sequences shown in Tables 1-3, but one or both of the sense and antisense strands may include 1, 2, 3, or more nucleobase substitutions from the parental sequence. In some embodiments, the selected sequence may be longer or shorter than its parental sequence. Therefore, the dsRNA agents included in the present invention may, but do not necessarily, include the exact sequences of the sense and antisense strand pairs disclosed as double strands in Tables 1-3.
[0146] In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, wherein nucleotide positions 2 to 18 of the antisense strand comprise a region complementary to the SCN9A RNA transcript, wherein the complementary region comprises at least 15 consecutive nucleotides differing from one of the antisense sequences listed in any one of Tables 1-3 by 0, 1, 2, or 3 nucleotides, and optionally comprises a targeting ligand. In some cases, the region complementary to the SCN9A RNA transcript comprises at least 15, 16, 17, 18, or 19 consecutive nucleotides differing from one of the antisense sequences listed in any one of Tables 1-3 by no more than 3 nucleotides. In some embodiments of the dsRNA agent of the present invention, the antisense strand of the dsRNA is at least substantially complementary to any of the target regions of SEQ ID NO: 1, and is provided in any one of Tables 1-3. In some embodiments, the antisense strand of the dsRNA agent of the present invention is completely complementary to any of the target regions of SEQ ID NO: 1, and is provided in any one of Tables 1-3. In some embodiments, the dsRNA agent comprises a sense sequence listed in any of Tables 1-3, and the sense sequence is at least substantially complementary to the antisense sequence in the dsRNA agent. In other embodiments, the dsRNA agent of the present invention comprises a sense sequence listed in any of Tables 1-3, and the sense sequence is completely complementary to the antisense sequence in the dsRNA agent. In some cases, the dsRNA agent of the present invention comprises an antisense sequence shown in any of Tables 1-3. Some embodiments of the dsRNA agent of the present invention comprise sense and antisense sequences disclosed as duplexes in any of Tables 1-3. As described herein, it should be understood that the sense and antisense strands in the duplexes of the present invention can be selected independently.
[0147] MISMATCH
[0148] Those skilled in the art will know that mismatches in dsRNA are tolerable for efficacy, especially mismatches in the terminal regions of dsRNA. Some mismatches are even more tolerable, for example, mismatches of the wobble base pairs G:U and A:C are tolerable for efficacy (Du et al., A systematic analysis of the silencing effects of an active siRNA at all single-nucleotide mismatched target sites. Nucleic Acids Res. 2005 Mar 21;33(5):1671-7. Doi: 10.1093 / nar / gki312. NucleicAcids Res. 2005;33(11):3698). In some embodiments of the methods and compounds of the present invention, the SCN9A dsRNA agent may contain one or more mismatches with the SCN9A target sequence. In some embodiments, the SCN9A dsRNA agent of the present invention does not contain mismatches. In some embodiments, the SCN9A dsRNA agent of the present invention contains no more than one mismatch. In some embodiments, the SCN9A dsRNA agent of the present invention contains no more than two mismatches. In some embodiments, the SCN9A dsRNA agent of the present invention contains no more than three mismatches. In some embodiments of the present invention, the antisense strand of the SCN9A dsRNA agent contains mismatches with the SCN9A target sequence, and these mismatches are not located at the center of the complementary region. In some embodiments, the antisense strand of the SCN9A dsRNA agent contains 1, 2, 3, 4 or more mismatches, and these mismatches are located within the last 5, 4, 3, 2 or 1 nucleotides of one or both of the 5' or 3' ends of the complementary region. The methods described herein and / or methods known in the art can be used to determine whether an SCN9A dsRNA agent containing mismatches with the SCN9A target sequence effectively inhibits the expression of the SCN9A gene.
[0149] COMPLEMENTARITY
[0150] As used herein, unless otherwise stated, the term "complementary" when used to describe a first nucleotide sequence (e.g., the sense strand of an SCN9A adsRNA agent or targeting SCN9A mRNA) relative to a second nucleotide sequence (e.g., the antisense strand of an SCN9A dsRNA agent or a single-stranded antisense polynucleotide) means hybridization of an oligonucleotide or polynucleotide comprising the first nucleotide sequence with an oligonucleotide or polynucleotide comprising the second nucleotide sequence [under mammalian physiological conditions (or IN VITRO SIMILAR CONDITIONS[The ability to form base pair hydrogen bonds] and, under certain conditions, to form double-stranded or double-helical structures. Other conditions, such as physiologically relevant conditions that may be encountered in an organism, may also apply. Technicians will be able to determine the most suitable set of conditions for testing the complementarity of two sequences based on the final application of the hybridized nucleotide. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, including natural or modified nucleotides or nucleotide mimics, at least within the range that satisfies the hybridization requirements described above. Sequence identity or complementarity is independent of modification.
[0151] Complementary sequences, such as those described herein in the SCN9A dsRNA, comprise an oligonucleotide or polynucleotide containing a first nucleotide sequence that pairs with an oligonucleotide or polynucleotide containing a second nucleotide sequence along the entire length of one or both nucleotide sequences. Such sequences may be referred to herein as “perfectly complementary” to each other. It should be understood that, in embodiments, when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs are not considered mismatches for the purposes of this complementarity determination. For example, an SCN9A dsRNA comprising one 19-nucleotide oligonucleotide and another 20-nucleotide oligonucleotide, wherein the longer oligonucleotide comprises a 19-nucleotide sequence that is perfectly complementary to the shorter oligonucleotide, may still be referred to herein as “perfectly complementary.” Therefore, “perfectly complementary” as used herein means that all (100%) bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide. The sequential sequence may include all or part of the first or second nucleotide sequence.
[0152] As used herein, the term "substantially complementary" means that in the hybridized nucleobase sequence pairs, at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% (but not all) of the bases in the first polynucleotide sequence will hybridize with the same number of bases in the second polynucleotide sequence. The term "substantially complementary" can also be used to refer to the first sequence being substantially complementary to the second sequence if the two sequences contain one or more mismatched base pairs, such as at least 1, 2, 3, 4, or 5 mismatched base pairs, when hybridizing to form a duplex of up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs (bp), while maintaining the ability to hybridize under conditions most relevant to their final application, such as repressing SCN9A gene expression via a RISC pathway.
[0153] The term "partial complementarity" may be used herein to refer to hybridized nucleobase sequence pairs in which at least 75% (but not all) of the bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide. In some embodiments, "partial complementarity" means that at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the bases in the sequential sequence of the first polynucleotide will hybridize with the same number of bases in the sequential sequence of the second polynucleotide.
[0154] As used herein, the terms “complementary,” “fully complementary,” “fundamentally complementary,” and “partially complementary” refer to base matching between the positive and antisense strands of the SCN9A dsRNA agent, between the antisense strand of the SCN9A dsRNA agent and the target SCN9A mRNA sequence, or between a single-stranded antisense oligonucleotide and the target SCN9A mRNA sequence. It should be understood that the term “antisense strand of the SCN9A dsRNA agent” can refer to the same sequence as the “SCN9A antisense polynucleotide agent.”
[0155] As used herein, the terms "substantially identical" or "substantially identical" when referring to a nucleic acid sequence mean a nucleic acid sequence containing a sequence having at least about 85% or more sequence identity with a reference sequence, preferably at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%. The percentage of sequence identity is determined by comparing two best-aligned sequences in a comparison window. The percentage is calculated by determining the number of positions in both sequences where the same nucleic acid bases occur to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100. The invention disclosed herein covers nucleotide sequences substantially identical to the nucleotide sequences disclosed herein. For example, in Tables 1-3. In some embodiments, the sequences disclosed herein are identical to, or at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, the sequences disclosed herein (e.g., Tables 1-3).
[0156] As used herein, the term "chain containing a sequence" refers to an oligonucleotide containing a nucleotide chain described by a sequence indicated using standard nucleotide nomenclature. As used herein, the terms "double-stranded RNA" or "dsRNA" refer to an RNAi comprising an RNA molecule or molecular complex having a hybrid double-stranded region comprising two antiparallel and substantially or completely complementary nucleic acid chains having a "forward" and "reverse" orientation relative to the target SCN9A RNA. The double-stranded region can be of any length allowing for specific degradation of the desired target SCN9A RNA via a RISC pathway, but is typically in the range of 9 to 30 base pairs, for example, 15–30 base pairs in length. Considering double strands ranging from 9 to 30 base pairs, the length of the double strand can be within this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, and any subranges therein, including but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, etc. Base pairs, 18-22 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. SCN9A dsRNA agents produced in cells by processing with Dicer and similar enzymes are typically 19–22 base pairs in length. One strand of the double-stranded region of the SCN9A dsDNA agent contains a sequence substantially complementary to the target SCN9A RNA region. The two strands forming the double-stranded structure can originate from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. When the double-stranded region is formed from the two strands of a single molecule, the molecule may have a double-stranded region separated by a single-stranded nucleotide chain (referred to herein as a “hairpin loop”) between the 3’ end of one strand and the 5’ end of the other strand forming the double-stranded structure.In some embodiments of the invention, the hairpin structure comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more unpaired nucleotides. When the two substantially complementary strands of the SCN9AdsRNA agent consist of separate RNA molecules, these molecules do not need to be, but can be, covalently linked. When the two strands are covalently linked in a manner other than a hairpin loop, the linking structure is called a “connector.” The term “siRNA” is also used herein to refer to the dsRNA agent described herein.
[0157] In some embodiments of the present invention, the SCN9A dsRNA agent may include sense and antisense sequences without unpaired nucleotides or nucleotide analogs at one or both ends of the dsRNA agent. An end without unpaired nucleotides is called a "blunt end" and has no nucleotide protrusions. If both ends of the dsRNA agent are blunt ends, the dsRNA is referred to as "blunt-end". In some embodiments of the present invention, the first end of the dsRNA agent is blunt-end; in some embodiments, the second end of the dsRNA agent is blunt-end; and in some embodiments of the present invention, both ends of the SCN9A dsRNA agent are blunt-end.
[0158] In some embodiments of the dsRNA agent of the present invention, the dsRNA does not have one or two blunt ends. In this case, the end of the dsRNA agent strand has at least one unpaired nucleotide. For example, a nucleotide overhang is present when the 3' end of one strand of the dsRNA extends beyond the 5' end of another strand, or vice versa. The dsRNA may contain at least 1, 2, 3, 4, 5, 6 or more nucleotide overhangs. The nucleotide overhangs may comprise or be composed of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. It should be understood that in some embodiments, the nucleotide overhangs are located on the sense strand of the dsRNA agent, on the antisense strand of the dsRNA agent, or at both ends of the dsRNA agent, and the nucleotides of the overhangs may be present at the 5' end, 3' end, or both ends of the antisense strand or sense strand of the dsRNA. In some embodiments of the present invention, one or more nucleotides in the overhangs are replaced by phosphate-thioester nucleosides.
[0159] As used herein, the terms "antisense strand" or "guide strand" refer to the strand of the SCN9A dsRNA agent that includes regions substantially complementary to the SCN9A target sequence. The terms "sense strand" or "passenger strand" refer to the strand of the SCN9A dsRNA agent that includes regions substantially complementary to the antisense strand region of the SCN9A dsRNA agent.
[0160] MODIFICATION
[0161] In some embodiments of the invention, the RNA of the SCN9A RNAi agent is chemically modified to enhance stability and / or one or more other beneficial properties. The nucleic acids in some embodiments of the invention can be synthesized and / or modified using methods well established in the art, for example, as described in “Current protocols in Nucleic Acid Chemistry,” Beaucage, SL et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications that may be present in certain embodiments of the SCN9A dsRNA agent of the present invention include, for example, (a) terminal modifications, such as 5' terminal modifications (phosphorylation, binding, reverse linkage, etc.), 3' terminal modifications (binding, DNA nucleotides, reverse linkage, etc.), (b) base modifications, such as base substitution with a stable base, an unstable base, or a base paired with a base from an extended library of bases, base removal (debasic nucleotides), or binding bases, (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitution, and (d) backbone modifications, including modification or substitution of phosphodiester bonds. Specific examples of RNA compounds useful in certain embodiments of the SCN9A dsRNA agent, SCN9A antisense polynucleotide, and SCN9A sense polynucleotide of the present invention include, but are not limited to, RNA containing a modified backbone or RNA without natural nucleoside internucleotide bonds. As a non-limiting example, RNA with a modified backbone may not have a phosphorus atom in the backbone. RNA without a phosphorus atom in the internucleotide backbone may be called an oligonucleotide. In some embodiments of the present invention, the modified RNA has phosphorus atoms in its internucleotide backbone.
[0162] It should be understood that the terms "RNA molecule" or "RNA" or "ribonucleic acid molecule" not only cover RNA molecules expressed or found in nature, but also include RNA analogs and derivatives containing one or more ribonucleotide / ribonucleoside analogs or derivatives described herein or known in the art. The terms "ribonucleoside" and "ribonucleotide," "nucleoside" and "nucleotide" are used interchangeably herein. RNA molecules may be modified in their nucleobase structure or ribose-phosphate backbone structure, as described below, and molecules containing ribonucleoside analogs or derivatives must retain the ability to form double strands. As a non-limiting example, the RNA molecule may also include at least one modified ribonucleotide, including but not limited to 2'-O-methyl modified ribonucleotides, ribonucleotides containing a 5'-thiophosphate group, terminal ribonucleotides linked to a cholesterol derivative or a dodecanoic acid bis(decanoic acid) group, lock ribonucleotides, debased ribonucleotides, 2'-deoxy-2'-fluoro modified ribonucleotides, 2'-amino modified ribonucleotides, 2'-alkyl modified ribonucleotides, 5'-phosphonate modified ribonucleotides, morpholino ribonucleotides, aminophosphates, or ribonucleotides containing non-natural bases, or any combination thereof. In some embodiments of the invention, the RNA molecule comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more full-length SCN9A dsRNA molecules are modified ribonucleotides. The modifications of each of such multiple modified ribonucleotides in the RNA molecule need not be identical.
[0163] In some embodiments, the dsRNA agents, SCN9A antisense polynucleotides, and / or SCN9A sense polynucleotides of the present invention may comprise one or more independently selected modified nucleotides and / or one or more independently selected nonphosphodiester bonds. As used herein, the terms “nucleotide bond,” “nucleoside bond,” “linking bond,” “backbone linking bond,” and “link” are used interchangeably to refer to the linking group in the backbone of the dsRNA of the present invention, which may specifically refer to the bond between unmodified or modified nucleosides in the oligonucleotide chain, and / or the bond between an unmodified or modified nucleoside and one or more residues, and / or the bond between an unmodified or modified nucleoside and one or more target groups. In some embodiments, the link may be independently selected from phosphodiester (PO) links, phosphate thioester (PS) links, and / or phosphate dithioester (PS2) links of dinucleotides at any position in a single-stranded or double-stranded oligonucleotide. The term “independently selected” as used herein with respect to selected elements (e.g., modified nucleotides, nonphosphodiester links, etc.) means that two or more selected elements may, but do not necessarily, be the same as each other.
[0164] As used herein, “nucleotide base,” “nucleotide,” or “nucleobase” refers to a heterocyclic pyrimidine or purine compound, a standard component of all nucleic acids, including the bases that form the nucleotides adenine, guanine, cytosine, thymine, and uracil. Nucleobases may be further modified to include (but are not limited to): universal bases, hydrophobic bases, hybrid bases, size-enlarged bases, and fluorinated bases. The terms “ribonucleotide” or “nucleotide” may be used herein to refer to an unmodified nucleotide, a modified nucleotide, a nucleotide analog, or a replaceable substituted moiety. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil may be substituted with other moiety without significantly altering the base-pairing properties of oligonucleotides containing nucleotides with such substituted moiety.
[0165] As used herein, “optionally” or “optionally” means that the event or environment described below may occur but is not guaranteed to occur, including the possibility that the event or environment may or may not occur. For example, “C1-6 alkyl group optionally substituted with halogen or cyano” means that halogen or cyano group may be present but is not guaranteed to be present, including the case where the alkyl group is substituted with halogen or cyano group and the case where the alkyl group is not substituted with halogen or cyano group.
[0166] As used herein, in the chemical structure of the compounds disclosed herein, bonds This represents an unspecified configuration; that is, if a chiral isomer exists in the chemical structure, then the bond... It can be " "or" ",or" "and" "Two configurations. Although some of the above structural formulas are depicted as isomers for simplicity, this disclosure can include all isomers, such as tautomers, rotatable isomers, and mixtures thereof. Suitable chiral compounds include geometric isomers, diastereomers, racemates, and enantiomers."
[0167] As used herein, the chemical formulas used in this disclosure are “ "or" "It can be connected to any one or more groups according to the scope of the invention described herein."
[0168] In one embodiment, the modified RNA used in the methods and compositions described herein is considered to be a peptide nucleic acid (PNA) that has the ability to form the desired double-stranded structure and allows or mediates the specific degradation of the target RNA via the RISC pathway. In some embodiments of the invention, the SCN9A RNA interfering agent comprises a single-stranded RNA that interacts with the target SCN9A RNA sequence to mediate the cleavage of the target SCN9A RNA.
[0169] The modified RNA backbone may include, for example, thiophosphates, chiral thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkylphosphonates (including 3'-alkylphosphonates and chiral phosphonates), phosphonites, aminophosphates (including 3'-aminoaminophosphates and aminoalkylaminophosphates), thiophosphates, thioalkylphosphonates, thioalkyl phosphate triesters, and borophosphates having normal 3'-5' bonds, their 2'-5' linked analogs, and those with reverse polarity (where adjacent nucleoside unit pairs are linked in 3'-5' to 5'-3' or 2'-5' to 5'-2' directions). Various salts, mixed salts, and free acid forms are also included. Methods for preparing phosphorus-containing bonds are conventional in the art, and such methods can be used to prepare certain modified SCN9A dsRNA agents, certain modified SCN9A antisense polynucleotides, and / or certain modified SCN9A sense polynucleotides of the present invention.
[0170] The phosphorus-free modified RNA backbone has a backbone formed by short-chain alkyl or cycloalkyl nucleoside bonds, mixed heteroatoms and alkyl or cycloalkyl nucleoside bonds, or one or more short-chain heteroatoms or heterocyclic nucleoside bonds. These include backbones with morpholine bonds (partially formed from the sugar moiety of the nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formyl and thioformyl backbones; methyleneformyl and thioformyl backbones; olefin-containing backbones; aminosulfonate backbones; methyleneimino and methylenehydrazine backbones; sulfonate and sulfonamide backbones; amide backbones; and other backbones with mixed N, O, S, and CH2 components. Methods for preparing phosphorus-free modified RNA backbones are conventional in the art, and such methods can be used to prepare certain modified SCN9A dsRNA agents, certain modified SCN9A antisense polynucleotides, and / or certain modified SCN9A sense polynucleotides of the present invention.
[0171] In some embodiments of the invention, RNA mimics are included in SCN9A dsRNA, SCN9A antisense polynucleotides, and / or SCN9A sense polynucleotides, for example, but not limited to, replacing the sugar and nucleoside bonds of the nucleotide units, i.e., the backbone, with novel groups. In such embodiments, the base units are retained to hybridize with suitable SCN9A nucleic acid target compounds. One such oligomeric compound, an RNA mimic that has shown excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. Nucleobases are retained and bind directly or indirectly to the aza-nitrogen atoms of the amide portion of the backbone. Methods for preparing RNA mimics are conventional practice in the art, and such methods can be used to prepare certain modified SCN9A dsRNA agents of the present invention.
[0172] Some embodiments of the present invention include RNAs of oligonucleotides having a phosphate thioester backbone and a heteroatom backbone, particularly -CH2-NH-CH2-, -CH2-N(CH3)-O-CH2- [referred to as the methylene (methylimino) or MMI backbone], -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, and -N(CH3)-CH2- [wherein the native phosphate diester backbone is represented as -OPO-CH2-]. Methods for preparing RNAs of oligonucleotides having a phosphate thioester backbone and a heteroatom backbone are conventional practices in the art, and such methods can be used to prepare certain modified SCN9A dsRNA agents, certain SCN9A antisense polynucleotides, and / or certain SCN9A sense polynucleotides of the present invention.
[0173] The modified RNA may also contain one or more substituted sugar moieties. The SCN9A dsRNA, SCN9A antisense polynucleotide, and / or SCN9A sense polynucleotide of the present invention may contain one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl, and alkynyl groups may be substituted or unsubstituted C1 to C2 groups. 10 Alkyl or C2 to C 10 Alkenyl and ynyl groups. Exemplary suitable modifications include O[(CH2)] n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2 and O(CH2) n ON[(CH2) n CH3)]2, where n and m are 1 to approximately 10. In other embodiments, the dsRNA at the 2' position includes one of the following: C1 to C 10Lower alkyl groups, substituted lower alkyl groups, alkylaryl groups, aryl alkyl groups, O-alkylaryl or O-aryl alkyl groups, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocyclic alkyl groups, heterocyclic alkylaryl groups, aminoalkylamino groups, polyalkylamino groups, substituted silyl groups, RNA cleaving groups, reporter groups, intercalating agents, groups used to improve the pharmacokinetic properties of SCN9A dsRNA agents, or groups used to improve the pharmacodynamic properties of SCN9AdsRNA agents, SCN9A antisense polynucleotides and / or SCN9A sense polynucleotides, and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., alkoxy-alkoxy. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., the O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in the examples below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2. Methods for preparing the modified RNA are conventional practices in the art, and such methods can be used to prepare certain modified SCN9A dsRNA agents of the present invention.
[0174] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), and 2'-fluorine (2'-F). Similar modifications can also be made at other positions on the RNA of the SCN9A dsRNA agent, SCN9A antisense polynucleotide, and / or SCN9A sense polynucleotide of the present invention, particularly at the 3' position of the sugar in the 3' terminal nucleotide or the 2'-5' linked SCN9AdsRNA, SCN9A antisense polynucleotide, or SCN9A sense polynucleotide, and at the 5' position of the 5' terminal nucleotide. The SCN9A dsRNA agent, SCN9A antisense polynucleotide, and / or SCN9A sense polynucleotide may also have a sugar mimic, for example, replacing the pentofuranose with a cyclobutyl moiety. Methods for preparing modified RNA (such as those described) are conventional practice in the art, and such methods can be used to prepare certain modified SCN9A dsRNA agents, SCN9A antisense polynucleotides, and / or SCN9A sense polynucleotides of the present invention.
[0175] In some embodiments, the SCN9A dsRNA agent, SCN9A antisense polynucleotide, and / or SCN9A sense polynucleotide may include nucleobase (generally referred to in the art simply as "base") modifications or substitutions. "Unmodified" or "natural" nucleobases as used herein include purine bases adenine and guanine, and pyrimidine bases thymine, cytosine, and uracil. Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halogenuridine and cytosine, 5-propyneuridine and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, and 5-halogen (especially 5-bromine). 5-Trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deadenine and 7-deadenine, and 3-deadenine and 3-deadenine. Other nucleosides known in the art that may be included in certain embodiments of the SCN9A dsRNA agent of the present invention can be found, for example: Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. Ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science and Engineering, pp. 858-859; Kroschwitz, J. L, Ed. JohnWiley & Sons, 1990; English et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y S., Chapter 15; dsRNA Research and Applications, pp. 289-302; Crooke, ST. and Lebleu, B., Ed., CRC Publications, 1993.Methods for preparing dsRNAs, SCN9A antisense polynucleotides, and / or SCN9A sense polynucleotides containing nucleobase modifications and / or substitutions (such as those described herein) are conventional practices in the art, and such methods can be used to prepare certain modified SCN9A dsRNA agents, SCN9A sense polynucleotides, and / or SCN9A antisense polynucleotides of the present invention.
[0176] Some embodiments of the SCN9A dsRNA agents, SCN9A antisense polynucleotides, and / or SCN9A sense polynucleotides of the present invention comprise RNA modified to contain one or more locked nucleic acids (LNAs). Locked nucleic acids are nucleotides having a modified ribose moiety containing an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in a 3'-inner conformation. Adding locked nucleic acids to the SCN9A dsRNA agents, SCN9A antisense polynucleotides, and / or SCN9A sense polynucleotides of the present invention can increase serum stability and reduce off-target effects (Elmen, J. et al., (2005) NucleicAcids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Methods for preparing dsRNA agents containing locked nucleic acids, SCN9A antisense polynucleotides, and / or SCN9A sense polynucleotides are conventional practices in the art, and such methods can be used to prepare certain modified SCN9A dsRNA agents of the present invention.
[0177] Some embodiments of the SCN9A dsRNA compounds, sense polynucleotides, and / or antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide includes: 2'-O-methyl nucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2'3'-seco nucleotide mimic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholinonucleotide and 3'-OMe nucleotide, nucleotide containing a 5'-thiophosphate group, nucleotide containing a vinylphosphonate, nucleotide containing adenosine-ethylenediamine Nucleotides of glycosaminoglycans (GNA), nucleotides containing the S-isomer of thymidine-glycosaminoglycans (GNA), nucleotides containing 2-hydroxymethyl-tetrahydrofuran-5-phosphate, nucleotides containing 2'-deoxythymidine-3'-phosphate, nucleotides containing 2'-deoxyguanosine-3'-phosphate, nucleotides containing 2'-deoxyadenosine-3'-phosphate, nucleotides containing 2'-deoxycytidine-3'-phosphate, nucleotides containing 2'-deoxyuridine-3'-phosphate, or terminal nucleotides linked to cholesterol derivatives or dodecanoic acid bis(decanoic acid) groups, 2'-amino-modified nucleotides, aminophosphates, or nucleotides containing non-natural bases. In some embodiments, the SCN9A dsRNA compound is located at the 5' end of the antisense strand. - The terminal includes an E-vinylphosphonate nucleotide, also referred to herein as the guide chain.
[0178] Some embodiments of the SCN9A dsRNA compounds of the present invention, the 3' and 5' ends of sense polynucleotides, and / or the 3' end of antisense polynucleotides, include at least one modified nucleotide, wherein the at least one modified nucleotide includes: abase nucleotide, ribitol, inverted nucleotide, inverted non-base nucleotide, inverted 2'-OMe nucleotide, inverted 2'-deoxy nucleotide. It is known to those skilled in the art that including abase or inverted non-base nucleotides at the oligonucleotide ends can enhance stability (Czauderna et al. Structural variations and strabilizing modifieds of synthesized siRNAs in maturian cells. Nucleic Acids Res. 2003;31(11):2705-2716. doi:10.1093 / nar / gkg393). In some embodiments, the SCN9A dsRNA compounds contain one or more inverted non-base residues at the 3' or 5' end, or both the 3' and 5' ends. Exemplary invab (inverse base-free residues) include, but are not limited to, the following:
[0179] Some embodiments of the SCN9A dsRNA compound, 3' and 5' sense polynucleotides, and / or 3' antisense polynucleotides of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide includes: isomannitol nucleotide or a stereoisomer of said isomannitol nucleotide. Specific examples of isomannitol nucleotide or stereoisomers of said isomannitol nucleotide include, but are not limited to: , , , , , , , , , , and In this context, "Olig" independently represents a polynucleotide moiety. Exemplary isomannitol residues (imann) include, but are not limited to, the following: or .
[0180] In some embodiments, isomannitol nucleotides may be further conjugated to one or more targeting groups or delivery molecules, such as the GalNAc moiety.
[0181] Some embodiments of the antisense polynucleotide SCN9A dsRNA compound of the present invention include at least one modified nucleotide, wherein the at least one modified nucleotide comprises an unlocked nucleic acid nucleotide (UNA) and / or a glycol nucleic acid nucleotide (GNA). It is known to those skilled in the art that UNA and GNA are thermally unstable chemical modifications that can significantly improve the off-target properties of siRNA compounds (Janas, et al., Selection of GalNAc-conjugated siRNAs with limited off-target-driven rat hepatotoxicity. Nat Commun. 2018;9(1):723. doi:10.1038 / s41467-018-02989-4; Laursen et al., Utilization of unlocked nucleic acid (UNA) to enhance siRNA performance in vitro and in vivo. Mol BioSyst. 2010;6:862–70).
[0182] In some embodiments of the SCN9A dsRNA compound of the present invention, the antisense polynucleotide further comprises a phosphate moiety. As used herein, a phosphate moiety refers to a phosphate group, including phosphate esters or phosphate ester mimics, which are attached to the sugar moiety of the nucleotide (e.g., ribose or deoxyribose or similar). Nucleotides containing phosphate ester mimics may also be defined as phosphonate-modified nucleotides.
[0183] In some embodiments, the phosphate ester analog is 5'-vinylphosphonate (VP). In an exemplary embodiment, the vinylphosphonate of this disclosure has the following structure:
[0184] The vinylphosphonate of this disclosure can be linked to the antisense or sense strand of the dsRNA of this disclosure. In some preferred embodiments, the vinylphosphonate of this disclosure is linked to the antisense strand of the dsRNA, optionally to the 5' end of the dsRNA antisense strand.
[0185] In some embodiments, the vinylphosphonate-modified nucleotides of this disclosure have the structure of formula (IV): (IV) Where X is O or S; R is hydrogen, hydroxyl, fluorine, or C. 1-20 Alkyl groups (e.g., methoxy or n-hexadecyloxy); R 5' =C(H)-P(O)(OH)2, and C5' carbon and R 5' The double bonds between them are in the E or Z direction (e.g., the E direction); and B is a nucleobase or a modified nucleobase, optionally wherein B is adenine, guanine, cytosine, thymine, or uracil.
[0186] In some embodiments, R 5' =C(H)-P(O)(OH)2, and C5' carbon and R 5' The double bond between them is in the E direction. In some embodiments, R is a methoxy group, R 5' =C(H)-P(O)(OH)2, and C5' carbon and R 5' The double bond between them is in the E direction. In some embodiments, X is S, R is methoxy, and R... 5' =C(H)-P(O)(OH)2, and C5' carbon and R 5' The double bond between them is in the E direction.
[0187] Vinylphosphonate modification is also applicable to the dsRNA, compositions, and methods disclosed herein. An exemplary vinylphosphonate structure is as follows: .
[0188] In some embodiments, the vinylphosphonate-modified nucleotide is VPU. It has the following structure: .
[0189] In some embodiments, the dsRNA comprises a phosphate ester or a phosphate mimic at the 5' terminal nucleotide of the guide strand, wherein the 5'-terminal nucleotide of the phosphate ester or phosphate mimic fragment may be represented by one of the following specific structures or stereoisomers thereof:
[0190] In many cases, protecting groups are used in the preparation of the compounds of the present invention. The term “protected” as used herein refers to a protected group attached to the indicated portion. In some embodiments of the invention, the compound contains one or more protecting groups. A variety of protecting groups can be used in the methods of the present invention. Generally, protecting groups inert chemical functional groups to specific reaction conditions and can be attached to or removed from such functional groups in a molecule without significantly impairing the rest of the molecule. General protecting groups and hydroxyl protecting groups are well known in the art (Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed., John Wiley & Sons, New York, 1991).
[0191] Examples of protecting groups (e.g., hydroxyl protecting groups) used herein include, but are not limited to, methyl, ethyl, benzyl (Bn), phenyl, isopropyl, tert-butyl, acetyl, chloroacetyl, trichloroacetyl, trifluoroacetyl, neopentanoyl, tert-butoxymethyl, methoxymethyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, allyl, cyclohexyl, 9-fluorenylmethoxycarbonyl (Fmoc), methanesulfonate, toluenesulfonate, trifluoromethanesulfonate, benzoyl, benzoylcarbamate, p-phenylbenzoyl, 4-methoxybenzyl, monomethoxytriphenylmethyl, dimethoxytriphenylmethyl, trimethoxytriphenylmethyl, 4-chlorobenzyl, 4-nitrobenzyl, 2,4-dinitrophenyl, 4-acyloxybenzyl, 2-Methylphenyl, 2,6-dimethylphenyl, 2-chlorophenyl, 2,6-dichlorobenzyl, diphenylmethyl, triphenylmethyl, 4-methylthio-1-butyl, S-acetylthioacetate (SATA), 2-cyanoethyl, 2-cyano,1-dimethylethyl (CDM), 4-cyano-2-butenyl, 2-(trimethylsilyl)ethyl (TSE), 2-(phenylthio)ethyl, 2-(triphenylsilyl)ethyl, 2-(benzylsulfonyl)ethyl, 2,2,2-trichloroethyl, 2,2,2-tribromoethyl, 2,3-dichlorophenyl Bromopropyl, 2,2,2-trifluoroethyl, phenylthio, 2-chloro-4-triphenylmethylphenyl, 2-bromophenyl, 2-[N-isopropyl-N-(4-methoxybenzoyl)amino]ethyl, 4-(N-trifluoroacetamido)butyl, 4-oxopentyl, 4-triphenylmethylaminophenyl, 4-benzylaminophenyl, tetrahydropyranyl, morpholinyl, trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, neopentanoyloxymethyl (POM), and 9-phenylxanthine-9-yl.
[0192] Examples of amino protecting groups used herein include, but are not limited to, urethane protecting groups such as 2-trimethylsilylethoxycarbonyl (Teoc), 1-methyl-1-(4-biphenyl)ethoxycarbonyl (Bpoc), tert-butoxycarbonyl (BOC), allyloxycarbonyl (Alloc), 9-fluorenyl-methoxycarbonyl (Fmoc), and benzyloxycarbonyl (Cbz); amide protecting groups such as formyl, acetyl, neopentyl, trihaloacetyl, benzoyl, and 2-nitrobenzenesulfonyl; and imine and cyclic imide protecting groups such as phthalimide and dithiosuccinyl. Equivalents of these amino protecting groups are also included in the compounds and methods of the present invention.
[0193] Some embodiments of the SCN9A dsRNA drug include at least one lipophilic moiety, which includes, for example, but not limited to, saturated or unsaturated C42-. 16Hydrocarbon chain (e.g., straight-chain C16 alkyl or alkenyl). This application provides for a lipophilic moiety included at any position in the dsRNA agent. In some embodiments, the lipophilic moiety is bound to a nucleobase, sugar moiety, or nucleoside internucleotide bond of the double-stranded iRNA agent. For example, C 16 Some can bind to the 2'-oxygen of ribonucleotides, as shown in the following structure: .
[0194] As used herein, “lipophilic” or “lipophilic moiety” broadly refers to any compound or chemical moiety that has an affinity for lipids. One way to characterize the lipophilicity of a lipophilic moiety is by the octanol-water partition coefficient logKow, where Kow is the ratio of the concentration of the chemical substance in the octanol phase to its concentration in the aqueous phase in a two-phase system at equilibrium. The octanol-water partition coefficient is a laboratory-measured property of a substance. However, it can also be predicted by using coefficients attributed to the structural composition of the chemical substance, calculated using first-principles or empirical methods (e.g., see Tetko et al., J. Chem. Inf. Comput. Sci. 41:1407-21 (2001), the full text of which is incorporated herein by reference). It provides a thermodynamic measurement of a substance’s tendency to favor a non-aqueous or oily environment over water (i.e., its hydrophilic / lipophilic balance). In principle, a chemical substance is lipophilic when its logKow exceeds 0.
[0195] Another modification that may be included in the RNA of certain embodiments of the SCN9A dsRNA agent, SCN9A antisense polynucleotide, and / or SCN9A sense polynucleotide of the present invention includes chemically linking one or more ligands, portions, or conjugates to the RNA, said ligands, portions, or conjugates enhancing one or more properties of the SCN9A dsRNA agent, SCN9A antisense polynucleotide, and / or SCN9A sense polynucleotide, respectively. Non-limiting examples of properties that can be enhanced include: activity of the SCN9A dsRNA agent, SCN9A antisense polynucleotide, and / or SCN9A sense polynucleotide, cellular distribution, delivery of the SCN9A dsRNA agent, pharmacokinetic properties of the SCN9A dsRNA agent, and cellular uptake of the SCN9A dsRNA agent. In some embodiments of the present invention, the SCN9A dsRNA agent comprises one or more targeting groups or linking groups, said targeting groups or linking groups binding to the sense strand in certain embodiments of the SCN9A dsRNA agent of the present invention. Non-limiting examples of targeting groups are compounds containing N-acetylgalactosamine (GalNAc). The terms "targeting group," "targeting agent," "linker," "targeting compound," "delivery molecule," "delivery compound," and "targeting ligand" are used interchangeably herein. In some embodiments of the invention, the SCN9A dsRNA agent comprises a targeting compound that binds to the 5' end of the sense strand. In some embodiments of the invention, the SCN9A dsRNA agent comprises a targeting compound that binds to the 3' end of the sense strand. In some embodiments of the invention, the SCN9A dsRNA agent comprises a targeting group containing GalNAc. In some embodiments of the invention, the SCN9AdsRNA agent comprises a targeting group that includes a lipophilic moiety. In some embodiments of the invention, the SCN9AdsRNA agent does not include a targeting compound conjugated to one or both of the 3' and 5' ends of the sense strand. In some embodiments of the invention, the SCN9A dsRNA agent does not include a GalNAc-containing targeting compound conjugated to one or both of the 5' and 3' ends of the sense strand.
[0196] Other targeting agents and linkers are well known in the art. For example, targeting agents and linkers that can be used in certain embodiments of the present invention include, but are not limited to, lipid moieties, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), bile acids (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers, such as beryl-S-triphenylmethylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 1993, 1994, 1995 ... 20:533-538), aliphatic chains, such as dodecyl glycol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids, such as hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycerol-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamines or polyethylene glycol chains (Manoharan et al.). (Al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or octadecylamine or hexanocarbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).
[0197] Some embodiments of compositions comprising SCN9A dsRNA agents, SCN9A antisense polynucleotides, and / or SCN9A sense polynucleotides may include ligands that alter the distribution, targeting, etc., of the SCN9A dsRNA agent. In some embodiments of compositions comprising the SCN9A dsRNA agent of the present invention, the ligand increases affinity for selected targets (e.g., molecules, cells or cell types, compartments (e.g., cellular or organ compartments), tissues, organs, or body regions) compared to species where such ligands are absent. Ligands that can be used in the compositions and / or methods of the present invention can be naturally occurring substances, such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, such as synthetic polyamino acids or polyamines. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-ethylene glycol) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphonazine. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide polyamines, peptide mimicry polyamines, dendritic polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides.
[0198] The ligands included in the compositions and / or methods of the present invention may contain a targeting group, non-limiting examples of which are cell or tissue targets, such as lectins, glycoproteins, lipids, or proteins, such as antibodies that bind to specific cell types (e.g., CNS cells, kidney cells, or hepatocytes). The targeting group may be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polylactose, polygalactose, N-acetylgalactosamine, N-acetylglucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, vitamin A, biotin, or RGD peptides or RGD peptide mimics.
[0199] Other examples of ligands include dyes, intercalators (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, tecosafrine, safeline), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrene), lysine-tyrosine-lysine tripeptides, aminoglycosides, guanidinoaminoglycosides, artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol (and its thio analogs), cholic acids, cholanonic acids, lithocholic acids). adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono, di, or tri fatty acid esters, such as C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 fatty acids) and their ethers, such as C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 alkyl groups; for example, 1,3-bis-O (hexadecyl) Glycerin, 1,3-bis-O-(octadecyl)glycerin), geranyoxyhexyl, hexadecylglycerin, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, stearic acid (e.g., glyceryl distearate), oleic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytriphenylmethyl or phenoxazine) and peptide conjugates (e.g., anthelmintic peptide, Tat peptide), alkylating agents, phosphate esters, amino groups, mercapto groups, P EG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled, enzyme, hapten (e.g., biotin), transport / absorption promoter (e.g., aspirin, naproxen, vitamin E, folic acid), synthetic ribonuclease (e.g., imidazole, diimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, tetraza macrocyclic Eu3+ complexes), dinitrophenyl, HRP, or AP.
[0200] The ligands included in the compositions and / or methods of the present invention may be proteins, such as glycoproteins or peptides, molecules having a specific affinity for an accessory ligand, or antibodies, such as antibodies that bind to a specific cell type (e.g., cancer cells, endothelial cells, cardiomyocytes, or osteocytes). Useful ligands in embodiments of the compositions and / or methods of the present invention may be hormones or hormone receptors. Useful ligands in embodiments of the compositions and / or methods of the present invention may be lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polymannose, or polyvalent fucose. Useful ligands in embodiments of the compositions and / or methods of the present invention may be substances capable of increasing the entry of SCN9A dsRNA agents into cells, for example, by disrupting the cytoskeleton of the cell, such as by disrupting microtubules, microfilaments, and / or intermediate filaments. Non-limiting examples of this type of drug include: taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, and myoservin.
[0201] In some embodiments, the ligand linked to the SCN9A dsRNA agent of the present invention serves as a pharmacokinetic (PK) modifier. Examples of PK modifiers that can be used in the compositions and methods of the present invention include, but are not limited to: lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, cholesterol, fatty acids, cholic acids, lithocholic acids, dialkyl glycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, aptamers that bind serum proteins, etc. Oligonucleotides containing a large number of thiophosphate bonds are also known to bind serum proteins; therefore, short oligonucleotides containing multiple thiophosphate bonds in the backbone, such as oligonucleotides of about 5, 10, 15, or 20 bases, can also be used as ligands in the compositions and / or methods of the present invention.
[0202] SCN9A dsRNA COMPOSITIONS
[0203] In some embodiments of the invention, an SCN9A dsRNA agent is present in the composition. The compositions of the invention may include one or more SCN9A dsRNA agents, and optionally one or more pharmaceutically acceptable carriers, delivery agents, targeting agents, detectable markers, etc. Non-limiting examples of targeting agents that may be useful in some embodiments of the method according to the invention are agents that direct the SCN9A dsRNA agent of the invention to cells to be treated and / or to cells to be treated. The choice of targeting agent will depend on factors such as the nature of the SCN9A-related disease or condition and the type of cells targeted. In non-limiting examples, in some embodiments of the invention, it may be desirable to target and / or direct the SCN9A dsRNA agent to hepatocytes. In non-limiting examples, in some embodiments of the invention, it may be desirable to target and / or direct the SCN9A dsRNA agent to brain cells. In non-limiting examples, in some embodiments of the invention, it may be desirable to target and / or target spinal cord cells with the SCN9A dsRNA agent. It should be understood that in some embodiments of the method of the present invention, the therapeutic agent comprises an SCN9A dsRNA agent having only a delivery agent, such as a delivery agent containing N-acetylgalactosamine (GalNAc) or a lipophilic moiety, without any additional attaching elements. For example, in some aspects of the present invention, the SCN9A dsRNA agent may be attached to a delivery compound containing GalNAc and contained in a composition comprising a pharmaceutically acceptable carrier, and administered to cells or a subject without attaching any detectable markers or targeting agents, etc., attached to the SCN9A dsRNA agent.
[0204] When the SCN9A dsRNA agent of the present invention is administered and / or attached to one or more delivery agents, targeting agents, labeling agents, etc., those skilled in the art will understand and be able to select and use agents suitable for the methods of the present invention. Labeling agents can be used in certain methods of the present invention to determine the location of the SCN9A dsRNA agent in cells and tissues, and can be used to determine the location of cells, tissues, or organs comprising a therapeutic composition containing an SCN9A dsRNA agent already administered in the methods of the present invention. Procedures for attaching and using labeling agents (e.g., enzyme labeling, dyes, radiolabeling, etc.) are well known in the art. It should be understood that in some embodiments of the compositions and methods of the present invention, the labeling agent is attached to one or both of the sense polynucleotides and antisense polynucleotides contained in the SCN9A dsRNA agent.
[0205] DELIVERY OF SCN9A dsRNA AGENTS AND SCN9A ANTISENSE POLYNUCLEOTIDE AGENTS
[0206] Some embodiments of the method of the present invention include delivering an SCN9A dsRNA agent into cells. As used herein, the term "delivery" refers to facilitating or enabling cellular uptake or absorption. Absorption or uptake of the SCN9A dsRNA agent can occur through unassisted diffusion or active cellular processes, or through the use of delivery agents, targeting agents, etc., that are associated with the SCN9A dsRNA agent of the present invention. Delivery methods suitable for the method of the present invention include, but are not limited to: IN VIVO Delivery, wherein the SCN9A dsRNA agent is injected into a tissue site or administered systemically. In some embodiments of the invention, the SCN9A dsRNA agent is attached to a delivery agent.
[0207] Non-limiting examples of methods that can be used to deliver SCN9A dsRNA agents to cells, tissues, and / or subjects include: SCN9A dsRNA-GalNAc conjugates, SAMiRNA technology, LNP-based delivery methods, and naked RNA delivery. These and other delivery methods have been successfully used in the art to deliver therapeutic RNAi agents for the treatment of a variety of diseases and conditions, such as, but not limited to: neurodegenerative diseases, liver diseases, acute intermittent porphyria (AIP), hemophilia, pulmonary fibrosis, etc. Details of the various delivery methods can be found in the following publications: Nikam, RR & KR Gore (2018) Nucleic Acid Ther, 28 (4), 209-224 Aug 2018; Springer AD & SF Dowdy (2018) Nucleic Acid Ther. Jun 1; 28(3): 109–118; Lee, K. et al., (2018) Arch Pharm Res, 41(9), 867-874; Nair, JK et al., (2014) J. Am. Chem. Soc. 136:16958-16961; Imran Sajid M. et al., (2023) Adv Drug Deliv Rev. 199:114968, and Padmakumar S. et al., (2022) J Control Release. 352:121-145; all of which are incorporated herein by reference.
[0208] Some embodiments of the present invention include the delivery of the SCN9A dsRNA agent of the present invention to cells, tissues, and / or subjects using lipid nanoparticles (LNPs). LNPs are commonly used for... IN VIVODelivery of SCN9A dsRNA agents, including therapeutic SCN9AdsRNA agents. One advantage of using LNPs or other delivery agents is that the stability of the SCN9A RNA agent is increased when delivered to a subject using LNPs or other delivery agents. In some embodiments of the invention, the LNP comprises a cationic LNP carrying one or more SCN9A RNAi molecules of the invention. When an LNP containing SCN9A RNAi molecules is administered to a subject, the LNP and its attached SCN9A RNAi molecules are absorbed by the cell via endocytosis, and their presence leads to the release of RNAi-triggered molecules, thereby mediating RNAi.
[0209] Some embodiments of the present invention include using the functional portion to deliver the SCN9A dsRNA agent of the present invention to cells, tissues and / or subjects.
[0210] The functional portion is a molecule that imparts one or more additional activities to an RNA silencer. In some embodiments, the functional portion enhances cellular uptake by target cells (e.g., neurons). Therefore, this disclosure includes RNA silencers conjugated to or unconjugated to another portion (e.g., a non-nucleic acid portion, such as a peptide), an organic compound (e.g., a dye), etc. (e.g., at its 5' and / or 3' ends). Conjugation can be accomplished by methods known in the art, for example, using Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describing nucleic acids loaded onto polyalkyl cyanoacrylate (PACA) nanoparticles); Fattal et al., J. Control Release 53(1-3): 137-43 (1998) (describing nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (describing nucleic acids conjugated with intercalators, hydrophobic groups, polycations, or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (describing nucleic acids conjugated to nanoparticles).
[0211] In one embodiment, the functional portion is a hydrophobic portion. In one embodiment, the hydrophobic portion is selected from fatty acids, steroids, open-ring steroids, lipids, gangliosides and nucleoside analogs, endocannabinoids, and vitamins. In one embodiment, the steroid is selected from the group consisting of cholesterol and lithocholic acid (LCA). In one embodiment, the fatty acid is selected from the group consisting of eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and docosuccinic acid (DCA). In one embodiment, the vitamin is selected from the group consisting of choline, vitamin A, vitamin E, and their derivatives or metabolites. In one embodiment, the vitamin is selected from the group consisting of retinoic acid and α-tocopherol succinate.
[0212] In one embodiment, the RNA silencing agent of this disclosure is conjugated to a lipophilic moiety. In one embodiment, the lipophilic moiety is a ligand comprising a cationic group. In another embodiment, the lipophilic moiety is attached to one or both strands of the siRNA. In an exemplary embodiment, the lipophilic moiety is attached to one end of the sense strand of the siRNA. In another exemplary embodiment, the lipophilic moiety is attached to the 3' end of the sense strand. In some embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin E, vitamin K, vitamin A, folic acid, and cationic dyes (e.g., Cy3). In an exemplary embodiment, the lipophilic moiety is cholesterol. Other lipophilic moieties include cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O-(hexadecyl)glycerol, geranyloxyhexyl, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytriphenylmethyl, or phenoxazine.
[0213] In some embodiments, the functional portion may include one or more ligands linked to the RNA silencer to improve stability, hybridization thermodynamics with the target nucleic acid, targeting of a specific tissue or cell type, or cell permeability, for example, through endocytosis-dependent or non-endocytosis-dependent mechanisms. The ligand and associated modifications may also increase sequence specificity and thus reduce ectopic targeting. The linking ligand may include one or more modified bases or sugars that can be used as intercalators. These may be located in internal regions, such as protrusions in the RNA silencer / target double strand. The intercalator may be an aromatic compound, such as a polycyclic aromatic compound or a heterocyclic aromatic compound. Polycyclic intercalators may have stacking capabilities and may include systems with 2, 3, or 4 fused rings. The universal bases described herein may be included on the ligand. In one embodiment, the ligand may include a cleavage group that facilitates the suppression of the target gene by cleaving the target nucleic acid. The cleavage group can be, for example, bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2), pyrene, phenanthroline (e.g., O-phenanthroline), polyamine, tripeptide (e.g., lys-tyr-lys tripeptide), or a metal ion chelating group. The metal ion chelating group can include, for example, Lu(III) or EU(III) macrocyclic complexes, Zn(II) 2,9-dimethylphenanthroline derivatives, Cu(II) terpyridine, or acridine, which can promote the selective cleavage of target RNA by free metal ions (e.g., Lu(III)) at the protrusion site. In some embodiments, the peptide ligand can be linked to an RNA silencing agent to promote the cleavage of target RNA, for example, in the protrusion region. For example, 1,8-dimethyl-1,3,6,8,10,13-hexaazacyclotetradecane (cyclam) can bind to a peptide (e.g., via an amino acid derivative) to promote the cleavage of target RNA. The linker ligand can be an aminoglycoside ligand, which can impart improved hybridization properties or improved sequence specificity to the RNA silencing agent. Exemplary aminoglycosides include glycosylated polylysine, galactosylated polylysine, neomycin B, tobramycin, kanamycin A, and acridine conjugates of aminoglycosides, such as neo-N-acrididine, neo-S-acrididine, neo-C-acrididine, tobramycin-N-acrididine, and kanamycin-N-acrididine. Using acridine analogs can increase sequence specificity. For example, neomycin B has a high affinity for RNA compared to DNA, but low sequence specificity. The acridine analog neo-5-acrididine has increased affinity for HIV Rev Reactive Elements (RREs). In some embodiments, a guanidine analog of the aminoglycoside ligand (guanidinoglycoside) binds to the RNA silencing agent. In a guanidinoglycoside, the amino group on the amino acid is exchanged for a guanidino group. The attachment of guanidine analogs can enhance the cellular permeability of RNA silencing agents. The binding ligands can be polyarginine peptides, peptide-like compounds, or peptide mimics, which can enhance the cellular uptake of oligonucleotide agents.
[0214] Exemplary ligands are coupled directly or indirectly to a ligand-binding vector via an intermediate linker. In some embodiments, coupling occurs via a covalent bond. In some embodiments, the ligand is linked to the vector via an intermediate linker. In some embodiments, the ligand alters the distribution, targeting, or lifetime of the RNA silencing agent it binds to. In some embodiments, the ligand provides enhanced affinity to selected targets (e.g., molecules, cells or cell types, compartments (e.g., cellular or organ compartments), tissues, organs, or body regions) compared to species lacking such ligands.
[0215] Exemplary ligands can improve transport, hybridization, and specificity properties, and can also improve the nuclease resistance of resulting natural or modified RNA silencers or polymer molecules containing any combination of monomers and / or natural or modified ribonucleotides described herein. Ligands can typically include therapeutic modifiers, such as those for enhancing absorption; diagnostic compounds or reporter groups, such as those for monitoring distribution; cross-linking agents; portions that confer nuclease resistance; and natural or uncommon nucleobases. Common examples include lipophilic substances, lipids, steroids (e.g., ursolic acid, pine bark saponins, diosgenin), terpenes (e.g., triterpenes, such as sarsaponin, sarsaponin, episarsaponin-derived lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein binders, integrin targeting molecules, polycations, peptides, polyamines, and peptide mimics. Ligands can include naturally occurring substances (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); amino acids; or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, like synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-ethylene glycol) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymers, or polyphosphazene. Examples of polyamines include: polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide polyamines, peptide mimic polyamines, dendritic polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides.
[0216] Ligands may also include targeting groups, such as cell or tissue targets, such as lectins, glycoproteins, lipids, or proteins, such as antibodies, that bind to specific cell types (e.g., kidney cells). Targeting groups may be thyroid-stimulating hormone, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucin carbohydrates, polylactose, polygalactose, N-acetylgalactosamine (GalNAc) or its derivatives, N-acetylglucosamine, polymannose, polyfucose, glycosylated polyamino acids, polygalactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroids, bile acids, folic acid, vitamin B12, biotin, or RGD peptides or RGD peptide mimics. Other examples of ligands include dyes, intercalators (e.g., acridine and substituted acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, tecosafrine, safeline), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrene), lysine-tyrosine-lysine tripeptides, aminoglycosides, guanidinoaminoglycosides, artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., cholesterol (and its thio analogs), bile acids, cholestyrannes). Acids, lithocholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono, di, or tri fatty acid esters, such as C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 fatty acids) and their ethers, such as C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, or C20 alkyl groups; such as 1,3-bis-O-(decanoic acid) Hexaalkylglycerol, 1,3-bis-O-octadecylglycerol), geranyyloxohexyl, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, stearic acid (e.g., glyceryl distearate), oleic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytriphenylmethyl or phenoxazine) and peptide conjugates (e.g., anthelmintic peptide, Tat peptide), alkylating agents, phosphate esters, amino groups, mercapto groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled substances, enzymes, haptens (e.g., biotin), transport / absorption promoters (e.g., aspirin, naproxen, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, diimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, tetraza macrocyclic Eu3+ complexes), dinitrophenyl, HRP, or AP. In some embodiments, the ligand is GalNAc or a derivative thereof.
[0217] Ligands can be proteins, such as glycoproteins, or peptides, such as molecules with a specific affinity for an accessory ligand, or antibodies, such as antibodies that bind to specific cell types (e.g., cancer cells, endothelial cells, or osteocytes). Ligands can also include hormones and hormone receptors. They can also include non-peptide substances, such as lipids, lectins, carbohydrates, vitamins, cofactors, polylactose, polygalactose, N-acetylgalactosamine, N-acetylglucosamine, polymannose, or polyfucose.
[0218] In some embodiments, the functional portion is attached to the 5' end and / or the 3' end of the RNA silencer of this disclosure. In some embodiments, the functional portion is attached to the 5' end and / or the 3' end of the antisense strand of the RNA silencer of this disclosure. In some embodiments, the functional portion is attached to the 5' end and / or the 3' end of the sense strand of the RNA silencer of this disclosure. In some embodiments, the functional portion is attached to the 3' end of the sense strand of the RNA silencer of this disclosure.
[0219] In some embodiments, the functional portion is linked to an RNA silencing agent via a adapter. In some embodiments, the functional portion is linked to an antisense strand and / or a sense strand via a adapter. In some embodiments, the functional portion is linked to the 3' end of the sense strand via a adapter. In some embodiments, the adapter comprises a divalent or trivalent adapter. In some embodiments, the adapter comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphodiester, a thiophosphate, an aminophosphate, an amide, a carbamate, or a combination thereof.
[0220] Another non-limiting example of a delivery agent that can be used in embodiments of the present invention to deliver the SCN9A dsRNA agent of the present invention to cells, tissues, and / or subjects is a pharmaceutical agent comprising GalNAc, which is linked to the SCN9AdsRNA agent of the present invention and delivers the SCN9A dsRNA agent to cells, tissues, and / or subjects. Examples of additional GalNAc-containing delivery agents that can be used in certain embodiments of the methods and compositions of the present invention are disclosed in PCT applications: WO2020191183A1 and WO2023045995 (into this document). A non-limiting example of a GalNAc targeting ligand that can be used in the compositions and methods of the present invention to deliver the SCN9A dsRNA agent to cells is a targeting ligand cluster. Examples of targeting ligand clusters described herein are referred to as: GalNAc ligands having a phosphodiester linkage (GLO) and GalNAc ligands having a thiophosphate linkage (GLS). The term "GLX-n" can be used here to indicate that the GalNAc-containing compound to which it is attached is compound GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 Any one of GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15, and GLO-16, wherein the structure of each compound is shown below, with the linker position of the GalNAc targeting ligand shown below at the far right of each RNAi agent of the present invention (denoted by "GLO-1"). (Display). It should be understood that any RNAi and dsRNA molecules of the present invention can be ligated to GLS-1. GLS-2 GLS-3 GLS-4 GLS-5 GLS-6 GLS-7 GLS-8 GLS-9 GLS-10 GLS-11 GLS-12 GLS-13 GLS-14 GLS-15 GLS-16 , GLO-1, GLO-2, GLO-3, GLO-4, GLO-5, GLO-6, GLO-7, GLO-8, GLO-9, GLO-10, GLO-11, GLO-12, GLO-13, GLO-14, GLO-15 and GLO-16, GLO-1 to GLO-16 and GLS-1 To GLS-16 The structure is shown below.
[0221]
[0222] In some embodiments, the above-described isomannitol nucleotides may be further conjugated to one or more GalNAc targeting ligands. Specific examples of isomannitol nucleotides conjugated to GalNAc targeting ligands include, but are not limited to: , The phrase “olig” independently represents each polynucleotide portion.
[0223] In some embodiments of the invention, in vivo delivery may also be performed using β-glucan delivery systems, such as those described in U.S. Patent Nos. 5,032,401 and 5,607,677 and U.S. Publication No. 2005 / 0281781, which are incorporated herein by reference in their entirety. SCN9A RNAi agents can also be introduced into cells in vitro using methods known in the art, such as electroporation and lipid transfection. In some embodiments of the methods of the invention, SCN9A dsRNA is delivered without a target agent. These RNAs can be delivered as “naked” RNA molecules. As a non-limiting example, the SCN9A dsRNA of the invention may be administered to a subject to treat the subject’s SCN9A-related disease or condition (e.g., AD), wherein the pharmaceutical composition comprises an RNAi agent but does not include a target agent (e.g., a GalNAc targeting compound).
[0224] In addition to certain delivery methods described herein, it should be understood that RNAi delivery methods (such as, but not limited to, those described herein and those used in the art) may be used in conjunction with embodiments of the SCN9A RNAi agents and treatment methods described herein.
[0225] The SCN9A dsRNA agents of the present invention can be administered to subjects in a quantity and manner that effectively reduces the level and activity of SCN9A peptides in cells and / or subjects. In some embodiments of the methods of the present invention, one or more SCN9A dsRNA agents are administered to cells and / or subjects to treat diseases or conditions associated with SCN9A expression and activity. In some embodiments, the methods of the present invention include administering one or more SCN9A dsRNA agents to subjects requiring such treatment to reduce diseases or conditions associated with SCN9A expression in the subjects. The SCN9A dsRNA agents or SCN9A antisense polynucleotide agents of the present invention can be administered to reduce SCN9A expression and / or activity in one or more cells in vitro, ex vivo, and in vivo.
[0226] In some embodiments of the invention, the level of the SCN9A polypeptide in cells is reduced, thereby decreasing its activity, by delivering (e.g., introducing) an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent into cells. Targeting agents and methods can be used to facilitate the delivery of an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent to specific cell types, cell subtypes, organs, spatial regions, and / or intracellular subcellular regions within a subject. In some methods of the invention, the SCN9A dsRNA agent may be administered alone or in combination with one or more additional SCN9A dsRNA agents. In some embodiments, two, three, four, or more independently selected SCN9A dsRNA agents are administered to the subject.
[0227] In some embodiments of the invention, an SCN9A dsRNA agent is administered to a subject in conjunction with one or more additional treatment regimens for treating SCN9A-related diseases or conditions. Non-limiting examples of additional treatment regimens include: administration of one or more of the present invention's SCN9A antisense polynucleotides, administration of a non-SCN9A AdsRNA therapeutic agent, and behavioral modification. The additional treatment regimen may be administered at one or more of the following times: before, simultaneously with, and after administration of the present invention's SCN9A dsRNA agent. It should be understood that "simultaneously" as used herein means within five minutes, ten minutes, thirty minutes, forty-five minutes, and sixty minutes from time zero, where "time zero" refers to the time when the subject is administered the present invention's SCN9A dsRNA agent. Non-limiting examples of non-SCN9A dsRNA therapeutics include: cholinesterase inhibitors (e.g., donepezil, levamisole esters, and galantamine), memantine, BACE1i, immunotherapy, secretase inhibitors (e.g., gamma secretase inhibitors), acetylcholinesterase inhibitors, NMDA receptor antagonists, antibodies against abeta (e.g., aducanumab), agents against tau protein, anti-synuclein antibodies, fumarate compounds, anti-inflammatory agents, anti-fatty degeneration agents, antiviral agents, and / or anti-fibrotic agents, or other agents disclosed herein or known in the art for treating pain in subjects. Non-limiting examples of behavioral modifiers include: dietary therapy, counseling, and exercise therapy. These and other therapeutics and behavioral modifiers are known in the art for treating SCN9A-related diseases or conditions in subjects and can be administered to subjects in combination with one or more SCN9A dsRNA agents of the present invention to treat SCN9A-related diseases or conditions. The SCN9A dsRNA agent of the present invention, administered to cells or subjects to treat SCN9A-related diseases or conditions, can synergize with one or more other therapeutic agents or activities and enhance the effectiveness of one or more therapeutic agents or activities and / or enhance the effectiveness of the SCN9A dsRNA agent in treating SCN9A-related diseases or conditions.
[0228] The treatment methods of the present invention include the administration of an SCN9A dsRNA agent, which may be used before the onset of and / or while the SCN9A-related disease or condition is present, including the early, middle, and late stages of the disease or condition, and all times before and after these stages. The methods of the present invention can also be used to treat subjects who have previously been treated with one or more other therapeutic agents and / or therapeutic activities that have been unsuccessful, had a low success rate, and / or are no longer successful in treating the subject's SCN9A-related disease or condition.
[0229] VECTOR-ENCODED dsRNA
[0230] In some embodiments of the invention, a vector can be used to deliver an SCN9A dsRNA agent into cells. The SCN9A dsRNA agent transcription unit can be contained in a DNA or RNA vector. The preparation and use of vectors encoding transgenes to deliver sequences into cells and / or subjects is well known in the art. Vectors can be used in the methods of the invention to result in transient expression of SCN9A dsRNA, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more hours, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks. The length of transient expression can be determined using conventional methods based on elements such as, but not limited to, the selected specific vector construct and the target cells and / or tissues. Such transgenes can be introduced as linear constructs, circular plasmids, or viral vectors, which can be integrative or non-integrative vectors. Transgenes can also be constructed to allow their inheritance as extrachromosomal plasmids (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).
[0231] The SCN9A dsRNA agent, whether single-stranded or multi-stranded, can be transcribed from a promoter on an expression vector. When expressing two separate strands to produce, for example, dsRNA, two separate expression vectors can be co-introduced into the cell using methods such as transfection or infection. In some embodiments, each separate strand of the SCN9A dsRNA agent of the present invention can be transcribed from a promoter contained on the same expression vector. In some embodiments of the present invention, the SCN9A dsRNA agent is expressed as an inverted repeat polynucleotide linked by a linker polynucleotide sequence, such that the SCN9A dsRNA agent has a stem-loop structure.
[0232] Non-limiting examples of RNA expression vectors are DNA plasmids or viral vectors. The expression vectors useful in the embodiments of the present invention are compatible with eukaryotic cells. Eukaryotic cell expression vectors are routinely used in the art and are available from many commercial sources. Delivery of the SCN9A dsRNA expression vector can be systemic, such as by intravenous or intramuscular administration, by administration to target cells removed from the subject and then reintroduced into the subject, or by any other means that allows for the introduction of the desired target cells.
[0233] Viral vector systems that may be included in embodiments of the method include, but are not limited to: (a) adenovirus vectors; (b) retroviral vectors, including but not limited to lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyomavirus vectors; (g) papillomavirus vectors; (h) piconemavirus vectors; (i) poxvirus vectors, such as orthopoxviruses, e.g., vaccinia virus vectors or fowlpox viruses, e.g., canary pox or fowlpox; and (j) helper-dependent or enterovirus-free adenoviruses. Constructs for recombinant expression of SCN9A dsRNA agents may include regulatory elements, such as promoters, enhancers, etc., which may be selected to provide constitutive or regulated / inducible expression. The use of viral vector systems, as well as promoters and enhancers, etc., is conventional in the art and may be used in conjunction with the methods and compositions described herein.
[0234] Some embodiments of the present invention include the delivery of SCN9A dsRNA agents into cells using a viral vector. Various adenovirus-based delivery systems are conventionally used in the art for delivery to, for example, the lungs, liver, central nervous system, endothelial cells, and muscle. Non-limiting examples of viral vectors that can be used in the methods of the present invention are: AAV vectors, poxviruses (e.g., vaccinia virus), modified ankara virus (MVA), NYVAC, and fowlpox (e.g., chickenpox or canarypox).
[0235] Some embodiments of the present invention include a method of delivering an SCN9A dsRNA agent into cells using a vector, and such a vector may be located in a pharmaceutically acceptable carrier that may, but does not necessarily, include a sustained-release matrix into which a gene delivery vector is embedded. In some embodiments, a vector for delivering SCN9A dsRNA can be generated from recombinant cells, and the pharmaceutical compositions of the present invention may include one or more cells that generate an SCN9A dsRNA delivery system.
[0236] PHARMACEUTICAL COMPOSITIONS CONTAINING SCN9A dsRNA OR ssRNA AGENTS
[0237] Some embodiments of the present invention include pharmaceutical compositions using an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent can be used in the methods of the present invention to reduce SCN9A gene expression and SCN9A activity in cells, and can be used to treat SCN9A-related diseases or conditions. Such pharmaceutical compositions can be formulated according to the route of administration. Non-limiting examples of formulations for delivery methods include: formulations for subcutaneous delivery, formulations for intrathecal delivery, formulations for systemic administration via parenteral delivery, formulations for intravenous (IV) delivery, formulations for direct delivery to the brain, etc. The pharmaceutical compositions of the present invention can be administered to deliver SCN9A dsRNA agents or SCN9A antisense polynucleotide agents into cells in one or more ways, such as: topically (e.g., via a transdermal patch), pulmonaryly, for example, by inhalation or blowing in powders or aerosols, including via a nebulizer; intravenously, intratracheally, intranasally, epidermally and transdermally, orally or parenterally. Parenterally administration includes intravenous, intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneously, for example, via an implanted device; or intracranially, for example, via intraparenchymal, intrathecal, or intraventricular administration. SCN9A dsRNA agents or SCN9A antisense polynucleotide agents can also be delivered directly to target tissues, such as directly to the liver, directly to the kidneys, etc. It should be understood that "delivery of SCN9A dsRNA" or "delivery of SCN9A antisense polynucleotide" into cells includes, respectively, the direct delivery of SCN9A dsRNA or SCN9A antisense polynucleotide, and the expression of SCN9A dsRNA in cells from a coding vector delivered to the cells, or the presence of SCN9A dsRNA or SCN9A antisense polynucleotide in cells by any suitable means. Methods for preparing and using formulations and delivering repressive RNA are well known and routinely used in the art.
[0238] As used herein, “pharmaceutical composition” includes a pharmacologically effective amount of the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the present invention and a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier” refers to a carrier used for administering the therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, glucose, water, glycerol, ethanol, and combinations thereof. This term explicitly excludes cell culture media. For orally administered pharmaceuticals, pharmaceutically acceptable carriers include, but are not limited to, pharmaceutically acceptable excipients such as inert diluents, disintegrants, binders, lubricants, sweeteners, flavorings, colorants, and preservatives. Suitable inert diluents include sodium carbonate and calcium carbonate, sodium phosphate and calcium phosphate, and lactose, while corn starch and alginate are suitable disintegrants. Binders may include starch and gelatin, while lubricants (if present) are typically magnesium stearate, stearic acid, or talc. If desired, tablets may be coated with materials such as glyceryl monostearate or glyceryl distearate to delay gastrointestinal absorption. Pharmaceutical agents contained in pharmaceutical formulations will be further described below.
[0239] As used herein, terms such as “pharmacologically effective amount,” “therapeuticly effective amount,” and “effective amount” refer to the amount of the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the present invention that produces the intended pharmacological, therapeutic, or preventative outcome. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or condition is reduced by at least 10%, then the therapeutically effective amount of a drug used to treat that disease or condition is the amount required to reduce that parameter by at least 10%. For example, a therapeutically effective amount of an SCN9A dsRNA agent or SCN9A antisense polynucleotide agent can reduce SCN9A protein levels by at least 10%.
[0240] EFFECTIVE AMOUNT
[0241] The method of the present invention includes, in some aspects, contacting cells with an effective amount of an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent to reduce SCN9A gene expression in the contacted cells. Certain embodiments of the method of the present invention include administering an effective amount of an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent to a subject to reduce SCN9A gene expression in the subject and to treat the subject with an SCN9A-related disease or condition. An “effective amount” used in reducing SCN9A expression and / or treating an SCN9A-related disease or condition is an amount necessary or sufficient to achieve the desired biological effect. For example, an effective amount of an SCN9A dsRNA agent or SCN9A antisense polynucleotide agent used to treat an SCN9A-related disease or condition may be an amount necessary to (i) slow or stop the progression of the disease or condition, or (ii) reverse, alleviate, or eliminate one or more symptoms of the disease or condition. In some aspects of the invention, an effective amount is the amount of SCN9A dsRNA agent or SCN9A antisense polynucleotide agent that, when administered to a subject requiring treatment for an SCN9A-related disease or condition, produces a therapeutic response that prevents and / or treats that disease or condition. According to some aspects of the invention, an effective amount is the amount of SCN9A dsRNA agent or SCN9A antisense polynucleotide agent that, when administered in combination with or in combination with another treatment method for an SCN9A-related disease or condition, produces a therapeutic response that prevents and / or treats that disease or condition. In some embodiments of the invention, the biological effect of treating a subject with the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the invention may be improvement and / or complete elimination of symptoms caused by the SCN9A-related disease or condition. In some embodiments of the invention, the biological effect is the complete elimination of the SCN9A-related disease or condition, for example, demonstrated by diagnostic tests indicating that the subject does not have an SCN9A-related disease or condition. Non-limiting examples of detectable physiological symptoms include a decrease in SCN9A levels in the liver of a subject after administration of the agent of the present invention. The effects of the agent and / or method of the present invention on SCN9A-related diseases or conditions can be determined using other methods known in the art for assessing SCN9A-related diseases or conditions.
[0242] Typically, the effective amount of an SCN9A dsRNA agent or SCN9A antisense polynucleotide agent used to reduce SCN9A peptide activity to a level sufficient to treat SCN9A-related diseases or conditions will be determined in clinical trials, with the effective dose determined in a blinded study compared to a control population. In some embodiments, the effective amount will result in a desired response, such as a reduction in the amount of SCN9A-related disease or condition in cells, tissues, and / or subjects suffering from the disease or condition. Therefore, the effective amount of an SCN9A dsRNA agent or SCN9A antisense polynucleotide agent used to treat SCN9A-related diseases or conditions that can be treated by reducing SCN9A peptide activity can be an amount that, when administered, reduces the amount of SCN9A peptide activity in a subject to less than the amount present in cells, tissues, and / or subjects without the administration of the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent. In some aspects of this invention, the SCN9A polypeptide activity and / or SCN9A gene expression level present in cells, tissues, and / or subjects that have not been exposed to or treated with the SCN9AdsRNA agent or the SCN9A antisense polynucleotide agent of this invention is referred to as the "control" level. In some embodiments of the method of this invention, the control level of the subject is the subject's pre-treatment level; in other words, the level of the subject before the administration of the SCN9A agent can be the subject's control level and compared with the subject's SCN9A polypeptide activity and / or SCN9A gene expression level after administration of siRNA. In the case of treating SCN9A-related diseases or conditions, the desired response may be a reduction or elimination of one or more symptoms of the disease or condition in the cells, tissues, and / or the subject. The reduction or elimination may be temporary or permanent. It should be understood that the status of SCN9A-related diseases or conditions can be monitored using methods such as determining SCN9A polypeptide activity, SCN9A gene expression, symptom assessment, and clinical testing. In some aspects of the invention, the desired response to the treatment of SCN9A-related diseases or conditions is to delay the onset of the disease or condition or even prevent its onset.
[0243] The effective amount of compounds that reduce SCN9A peptide activity can also be determined by assessing the physiological effects of administration of an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent on cells or subjects, such as a reduction in SCN9A-related diseases or symptoms after administration. Measurements and / or symptom monitoring of subjects can be used to determine the efficacy of the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the present invention, which can be administered in the form of the pharmaceutical compounds of the present invention, and to determine whether there is a response to treatment. A non-limiting example is the use of one or more tests known in the art to measure the levels of SCN9A mRNA, SCN9A protein, and / or another parameter related to the function of SCN9A expression levels.
[0244] Some embodiments of the present invention include methods for determining the efficacy of administering the dsRNA agent or SCN9A antisense polynucleotide agent of the present invention to a subject for the treatment of SCN9A-related diseases or conditions, by assessing and / or monitoring one or more “physiological characteristics” of the subject’s SCN9A-related diseases or conditions. Non-limiting examples of physiological characteristics of SCN9A-related diseases or conditions include the levels of SCN9A mRNA, SCN9A protein, or another parameter related to the function of SCN9A expression levels. Standard methods for determining such physiological characteristics are known in the art, including but not limited to blood tests, imaging studies, physical examinations, etc.
[0245] It should be understood that the amount of SCN9A dsRNA or SCN9A antisense polynucleotide administered to a subject can be adjusted, at least in part, based on the determination of the subject's disease and / or condition and / or physiological characteristics. The therapeutic dose can be varied, for example, by increasing or decreasing the amount of SCN9A dsRNA or SCN9A antisense polynucleotide, by changing the composition of the SCN9A dsRNA or SCN9A antisense polynucleotide administered, by changing the route of administration, by changing the time of administration, etc. The effective dose of the SCN9A dsRNA or SCN9A antisense polynucleotide will vary depending on the specific condition being treated, the age and physical condition of the subject being treated, the severity of the condition, the duration of treatment, the nature of any concurrent treatments, the specific route of administration, and other factors within the knowledge and expertise of the healthcare professional. For example, the effective dose may depend on the required SCN9A peptide activity and / or SCN9A gene expression level for effective treatment of SCN9A-related diseases or conditions. Those skilled in the art can determine, based on experience, the effective amount of a specific SCN9A dsRNA agent or SCN9A antisense polynucleotide agent used in the methods of this invention without excessive experimentation. In conjunction with the teachings provided herein, by selecting from the various SCN9A dsRNA agents or SCN9A antisense polynucleotide agents of this invention and weighing factors such as potency, relative bioavailability, patient weight, severity of adverse side effects, and preferred route of administration, an effective prophylactic or therapeutic regimen for a specific subject can be planned. As used in the embodiments of this invention, the effective amount of the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of this invention can be the amount that causes the desired biological effect in the cell upon contact with the cell.
[0246] It should be recognized that SCN9A gene silencing can be determined in any SCN9A-expressing cell, whether constitutively expressed or expressed through genome engineering, and by any appropriate assay. In some embodiments of the invention, by administration of the SCN9A dsRNA agent of the invention, SCN9A gene expression is reduced by at least 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments of the invention, by administration of the SCN9A dsRNA agent of the invention, SCN9A gene expression is reduced by 5% to 10%, 5% to 25%, 10% to 50%, 10% to 75%, 25% to 75%, 25% to 100%, or 50% to 100%.
[0247] DOSE
[0248] The SCN9A dsRNA agent and the SCN9A antisense polynucleotide agent are delivered in the pharmaceutical composition at a dose sufficient to inhibit SCN9A gene expression. In some embodiments of the invention, the dose of the SCN9A dsRNA agent or the SCN9A antisense polynucleotide agent is in the range of 0.01 to 200.0 mg per kilogram of body weight per day for the recipient, typically 1 to 50 mg / kg body weight, 5 to 40 mg / kg body weight, 10 to 30 mg / kg body weight, 1 to 20 mg / kg body weight, 1 to 10 mg / kg body weight, or 4 to 15 mg / kg body weight (inclusive) per day. For example, the SCN9A dsRNA agent or SCN9A... Antisense polynucleotide agents can be administered at the following dosages: approximately 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, and 2.1 mg / kg per dose. g, 2.2mg / kg, 2.3mg / kg, 2.4mg / kg, 2.5mg / kg, 2.6mg / kg, 2.7mg / kg, 2.8mg / kg, 2.9mg / kg, 3.0mg / kg, 3.1mg / kg, 3.2 mg / kg, 3.3mg / kg, 3.4mg / kg, 3.5mg / kg, 3.6mg / kg, 3.7mg / kg, 3.8mg / kg, 3.9mg / kg, 4mg / kg, 4.1mg / kg, 4.2mg / kg, 4 .3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg ,5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5m g / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 11mg / kg, 12mg / kg, 13mg / kg, 14mg / kg, 15mg / kg, 16mg / kg, 17mg / kg, 18mg / kg, 19mg / kg, 20mg / kg, 21mg / kg, 22mg / kg, 23mg / kg, 24mg / kg, 25mg / kg, 26mg / kg, 27mg / kg, 28mg / kg, 29mg / kg, 30mg / kg, 31mg / kg, 32mg / kg, 33mg / kg, 34mg / kg, 35mg / kg, 36mg / kg, 3 7mg / kg, 38mg / kg, 39mg / kg, 40mg / kg, 41mg / kg, 42mg / kg, 43mg / kg, 44mg / kg, 45mg / kg, 46mg / kg, 47mg / kg, 48mg / kg, 49mg / kg, to 50mg / kg body weight. .
[0249] Various factors can be considered when determining the dosage and timing of administration of the SCN9A dsRNA agent of the present invention. The absolute amount of the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent administered will depend on various factors, including concurrent treatment, number of doses, and individual subject parameters, including age, physical condition, body size, and weight. These are factors well known to those skilled in the art and can be resolved with routine experiments. In some embodiments, a maximum dose may be used, i.e., the highest safe dose based on reasonable medical judgment.
[0250] In some embodiments, the method of the present invention may include administering to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more doses of an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent. In some cases, the pharmaceutical compound (e.g., an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent) may be administered to the subject at least daily, every other day, weekly, every other week, monthly, etc. The dose may be administered once daily or multiple times daily, for example, 2, 3, 4, 5 or more times within a 24-hour period. The pharmaceutical composition of the present invention may be administered once daily, or the SCN9A AdsRNA agent or SCN9A antisense polynucleotide agent may be administered as two, three or more sub-dose at appropriate intervals throughout the day, or even delivered using continuous infusion or by controlled-release formulation. In some embodiments of the method of the present invention, the pharmaceutical composition of the present invention may be administered to the subject once or more daily, once or more weekly, once or more monthly, or once or more annually.
[0251] The method of the present invention includes, in some aspects, administration of a pharmaceutical compound alone, in combination with one or more other SCN9 dsRNA agents or SCN9A antisense polynucleotide agents, and / or in combination with other pharmaceutical therapies or therapeutic activities or regimens administered to a subject suffering from an SCN9A-related disease or condition. The pharmaceutical compound may be administered in the form of a pharmaceutical composition. The pharmaceutical composition used in the method of the present invention may be sterile and contain a quantity of an SCN9A dsRNA agent or SCN9A antisense polynucleotide agent that reduces the activity of the SCN9A polypeptide to a level sufficient to produce the desired response, expressed in units of weight or volume suitable for administration to the subject. The dose of the pharmaceutical composition, comprising an SCN9A dsRNA agent or SCN9A antisense polynucleotide agent to reduce the activity of the SCN9A protein, administered to the subject may be selected based on various parameters, particularly the route of administration and the condition of the subject. Other factors include the required duration of treatment. If the subject does not respond adequately to the initial dose, a higher dose may be used within the patient's tolerance (or the dose may be effectively increased via a different, more localized delivery route).
[0252] TREATMENT
[0253] The terms “SCN9A-related diseases,” “SCN9A-related diseases and conditions,” and “diseases and conditions caused and / or regulated by SCN9A” as used in this article are intended to include any disease associated with the SCN9A gene or protein. Such diseases may be caused by, for example, overproduction of the SCN9A protein, mutations in the SCN9A gene, abnormal cleavage of the SCN9A protein, or abnormal interactions between SCN9A and other proteins or other endogenous or exogenous substances. Exemplary SCN9A-related diseases include, but are not limited to: pain, such as acute or chronic pain (e.g., inflammatory pain, neuropathic pain, nociceptive pain, postoperative pain, persistent pain, hyperalgesia, desensitization, analgesia, Gerhardt's disease, Mitchell's disease, or Weir-Mitchell's disease), spontaneous pain (e.g., primary or secondary erythromelalgia), paroxysmal extreme pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with, for example, cancer, arthritis, diabetes, trauma, and viral infections), or other diseases associated with SCN9A expression.
[0254] In some aspects of the invention, the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the invention may be administered to a subject at one or more times before or after a diagnosis of an SCN9A-related disease or condition. In some aspects of the invention, the subject is at risk of having or developing an SCN9A-related disease or condition. A subject at risk of developing an SCN9A-related disease or condition is a subject who has an increased probability of developing an SCN9A-related disease or condition compared to a control risk level. In some embodiments of the invention, the risk level may be statistically significant compared to a control risk level. Subjects at risk may include, for example, subjects who already have or will have pre-existing diseases and / or genetic abnormalities that make them more susceptible to developing an SCN9A-related disease or condition than control subjects without pre-existing diseases or genetic abnormalities; subjects with a family and / or personal history of an SCN9A-related disease or condition; and subjects who have previously received treatment for an SCN9A-related disease or condition. It should be understood that pre-existing diseases and / or genetic abnormalities that make subjects more susceptible to SCN9A-related diseases or conditions may be diseases or genetic abnormalities that have been previously identified as having a higher likelihood of developing SCN9A-related diseases or conditions.
[0255] It should be understood that SCN9A dsRNA agents or SCN9A antisense polynucleotide agents may be administered to subjects based on their individual medical conditions. For example, healthcare provided to a subject may assess SCN9A levels measured in samples obtained from the subject and determine that it is desirable to reduce the subject's SCN9A levels by administering the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the present invention. In this example, SCN9A levels may be considered a physiological characteristic of SCN9A-related diseases even if the subject has not been diagnosed with one (as disclosed herein). Healthcare providers may monitor changes in the subject's SCN9A levels as a measure of the efficacy of the administered SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the present invention. In a non-limiting example, biological samples, such as blood or tissue samples, may be obtained from the subject, and the subject's SCN9A levels may be determined in the samples. Subjects were administered either an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent, and blood samples were obtained from the subjects after administration. SCN9A levels were determined using these samples, and the results were compared to those determined in the subjects' pre-administration (previous) samples. A decrease in SCN9A levels in subsequent samples compared to pre-administration levels indicates that the administered SCN9A dsRNA agent or SCN9A antisense polynucleotide agent was effective in reducing the subjects' SCN9A levels.
[0256] Some embodiments of the method of the present invention include adjusting the treatment, including administering the dsRNA agent or SCN9A antisense polynucleotide agent of the present invention to a subject, based at least in part on an assessment of changes in one or more physiological characteristics of an SCN9A-related disease or condition in the subject due to the treatment. For example, in some embodiments of the present invention, the effect of the administered dsRNA agent or SCN9A antisense polynucleotide agent of the present invention on the subject may be determined and used to help adjust the amount of the dsRNA agent or SCN9A antisense polynucleotide agent of the present invention subsequently administered to the subject. In a non-limiting example, the dsRNA agent or SCN9A antisense polynucleotide agent of the present invention is administered to a subject, the subject's SCN9A level is measured after administration, and based at least in part on the measured level, it is determined that a larger amount of the dsRNA agent or SCN9A antisense polynucleotide agent is needed to increase the physiological effect of the administered agent, such as reducing or further reducing the subject's SCN9A level. In another non-limiting example, the dsRNA agent or SCN9A antisense polynucleotide agent of the present invention is administered to a subject, the subject's SCN9A level is measured after administration, and based at least in part on the measured level, a lower amount of the dsRNA agent or SCN9A antisense polynucleotide agent needs to be administered to the subject.
[0257] Therefore, some embodiments of the present invention include assessing changes in one or more physiological characteristics resulting from prior treatment in a subject to adjust the amount of the dsRNA agent or SCN9A antisense polynucleotide agent of the present invention subsequently administered to the subject. Some embodiments of the method of the present invention include 1, 2, 3, 4, 5, 6 or more physiological characterizations of SCN9A-related diseases or conditions to assess and / or monitor the efficacy of the administered SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the present invention, and optionally using these assays to adjust one or more of the following: the dosage, administration regimen, and / or frequency of the dsRNA agent or SCN9A antisense polynucleotide agent of the present invention to treat the subject's SCN9A-related disease or condition. In some embodiments of the method of the present invention, the desired result of administering an effective amount of the dsRNA agent or SCN9A antisense polynucleotide agent of the present invention to a subject is a reduction in the level of the subject's SCN9AmRNA, SCN9A protein, or another parameter functionally related to the expression level of SCN9A / / or MAPT peptide, etc., compared to a prior or control level determined for that subject.
[0258] As used herein, the terms “treatment,” “treated,” or “under treatment” when used in relation to SCN9A-related disease or condition can refer to preventive treatment that reduces the likelihood of a subject developing an SCN9A-related disease or condition, or to treatment that occurs after a subject has developed an SCN9A-related disease or condition in order to eliminate or reduce the level of the SCN9A-related disease or condition, prevent the SCN9A-related disease or condition from becoming more advanced (e.g., more severe), and / or slow the progression of the SCN9A-related disease or condition in the subject compared to untreated subjects, thereby reducing the activity of the SCN9A peptide in the subject.
[0259] Certain embodiments of the agents, compositions, and methods of the present invention can be used to inhibit SCN9A gene expression. The terms “inhibit,” “silence,” “reduction,” “downregulation,” and “knockdown” used herein to refer to the expression of the SCN9A gene mean, respectively, a reduction in SCN9A gene expression when cells, cell populations, tissues, organs, or subjects are contacted (e.g., treated) with the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the present invention, as measured by one or more of the following in cells, cell populations, tissues, organs, or subjects in which the SCN9A gene is transcribed: the level of RNA transcribed from the gene, the level of activity of expressed SCN9A, and the level of SCN9A polypeptide, protein, or protein subunit translated from mRNA. In some implementations, the control level is the level in cells, tissues, organs, or subjects that have not been exposed to (e.g., treated with) the SCN9A dsRNA agent or the SCN9A antisense polynucleotide agent.
[0260] METHOD OF ADMINISTRATION
[0261] Various routes of administration for SCN9A dsRNA agents or SCN9A antisense polynucleotide agents can be used in the methods of the present invention. The specific route of administration chosen depends at least in part on the specific condition being treated and the dose required to achieve the therapeutic effect. Generally, the methods of the present invention can be implemented using any medically acceptable route of administration, i.e., any route that produces an effective level of treatment for an SCN9A-related disease or condition without causing clinically unacceptable adverse reactions. The siRNA molecules of this disclosure can be delivered directly to the CNS or neurons of a subject requiring SCN9A silencing via, for example, intrathecal injection, intrastriatal injection, intraparenchymal injection, direct injection into a specific nerve or ganglion (ganglion) (e.g., the trigeminal ganglion or dorsal root ganglion), or intracisional injection (e.g., via catheter insertion, intravenous injection, subcutaneous injection, or intramuscular injection). In some embodiments of the present invention, SCN9A dsRNA agents or SCN9A antisense polynucleotide agents can be administered via oral, enteral, mucosal, subcutaneous, and / or parenteral routes. The term "parenteral" includes subcutaneous, intravenous, intrathecal, intramuscular, intraperitoneal, and intrasternal injection or infusion techniques. Other routes include, but are not limited to, nasal (e.g., via a gastrointestinal tube), skin, vagina, rectum, sublingual, and inhalation. Delivery routes of the present invention may include intrathecal, intraventricular, intraventricular (ICV), striatum, intraparenchymal, intracranial, or intracranial.
[0262] Some embodiments of this method include intrathecal injection or injection via catheter insertion into the cisterna magna. Some embodiments of this method include direct injection into a specific nerve or ganglion (e.g., the trigeminal nerve or dorsal root ganglion).
[0263] Intrathecal injection is a direct injection into the spinal cord or subarachnoid space. By injecting directly into the cerebrospinal fluid of the spinal cord, the siRNA molecules of this disclosure can directly enter cells in the spinal cord (e.g., neurons and glial cells) and enter brain cells by bypassing the blood-brain barrier, or enter the cell bodies of neurons outside the blood-brain barrier.
[0264] Intraventricular injection (ICV) is a method of direct injection into the cerebrospinal fluid within the ventricles. Similar to intrathecal injection, ICV is an injection method that bypasses the blood-brain barrier. ICV allows for convenient access to brain and spinal cord cells without concerns about drug degradation in the bloodstream.
[0265] Intrastriatal injection involves direct injection into or into the striatum. The striatum is a region of the basal ganglia beneath the cerebral cortex. Injection into the striatum bypasses the blood-brain barrier and the pharmacokinetic challenges of bloodstream administration, allowing direct access to brain cells.
[0266] Intraplasmic drug delivery involves direct injection into the parenchyma (e.g., the brain parenchyma). Injection into the brain parenchyma allows direct injection into brain regions affected by disease or condition, while bypassing the blood-brain barrier.
[0267] Injection via catheter insertion into the cerebellomedullary cistern is a direct injection into the cerebellomedullary cistern, a brain region located between the dorsal surface of the cerebellum and medulla oblongata. Injection into the cerebellomedullary cistern allows for more direct delivery of the drug to cells in the cerebellum, brainstem, and spinal cord. In some embodiments of the methods described herein, the therapeutic composition can be delivered to the subject via systemic administration (e.g., intravenous, intramuscular, or subcutaneous).
[0268] Intravenous injection is a method of direct injection into the bloodstream of a subject. Intravenous injection can be administered via bolus dose or continuous infusion, or any other method to which the therapeutic composition is tolerated.
[0269] Intramuscular (IM) injection is administered into a muscle of the subject, such as the deltoid or gluteal muscles. IM allows for rapid absorption of the therapeutic composition.
[0270] In some embodiments of the invention, SCN9A dsRNA agents or SCN9A antisense polynucleotide agents may be placed in a sustained-release matrix and administered by placing the matrix in a subject. In some aspects of the invention, SCN9A dsRNA agents or SCN9A antisense polynucleotide agents may be delivered to subject cells using nanoparticles coated with delivery agents targeting specific cells or organelles. Various delivery means, methods, and agents are known in the art. Non-limiting examples of delivery methods and agents are also provided elsewhere herein. In some aspects of the invention, the term "delivery" in relation to an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent can refer to the administration of one or more "naked" SCN9A dsRNA agents or SCN9A antisense polynucleotide agent sequences to cells or a subject, and in other aspects of the invention, "delivery" refers to administration to cells or a subject via transfection, delivery to a subject of cells containing an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent, delivery to cells and / or a subject of a vector encoding an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent, etc. Delivery of an SCN9A dsRNA agent or an SCN9A antisense polynucleotide agent using transfection may include administration of a vector to cells and / or a subject.
[0271] In some methods of the present invention, one or more SCN9A dsRNA agents or SCN9A antisense polynucleotide agents may be administered in formulation form, which may be administered in a pharmaceutically acceptable solution form, typically containing pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients. In some embodiments of the present invention, the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent may be formulated with another therapeutic agent for simultaneous administration. According to the methods of the present invention, the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent may be administered in the form of a pharmaceutical composition. Typically, the pharmaceutical composition comprises an SCN9A dsRNA agent or SCN9A antisense polynucleotide agent and optionally a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those skilled in the art. As used herein, a pharmaceutically acceptable carrier is a non-toxic material that does not interfere with the effectiveness of the bioactivity of the active ingredient (e.g., the ability of an SCN9AdsRNA agent or an SCN9A antisense polynucleotide agent to inhibit SCN9A gene expression in cells or a subject). Various methods of administration and delivery of dsRNA agents or SCN9A antisense polynucleotide agents for therapeutic purposes are known in the art and can be used in the methods of this invention.
[0272] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art. Exemplary pharmaceutically acceptable carriers are described in U.S. Patent No. 5,211,657, and other carriers are known to those skilled in the art. Such formulations may typically contain salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in pharmaceuticals, salts should be pharmaceutically acceptable, but non-pharmaceuticalally acceptable salts may be conveniently used to prepare their pharmaceutically acceptable salts and are not excluded from the scope of this invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc. Furthermore, pharmaceutically acceptable salts can be prepared as alkali metal or alkaline earth salts, such as sodium, potassium, or calcium salts.
[0273] Some embodiments of the method of the present invention include direct administration of one or more SCN9A dsRNA agents or SCN9A antisense polynucleotide agents to tissues. In some embodiments, the tissue to which the compound is administered is a tissue in which SCN9A-related diseases or conditions exist or may occur, a non-limiting example being the heart. Direct tissue administration can be achieved by direct injection or other means. Many orally delivered compounds naturally reach and pass through the liver and kidneys, and some embodiments of the treatment methods of the present invention include oral administration of one or more SCN9A dsRNA agents to a subject. SCN9A dsRNA agents or SCN9A antisense polynucleotide agents, whether administered alone or in combination with other therapeutic agents, can be administered once or in multiple doses. If administered multiple times, SCN9A dsRNA agents or SCN9A antisense polynucleotide agents can be administered via different routes. For example, although not intended to be limiting, the first (or first few) doses can be administered subcutaneously, and one or more additional doses can be administered orally and / or systemically.
[0274] For embodiments of the present invention requiring systemic administration of SCN9A dsRNA agents or SCN9A antisense polynucleotide agents, the SCN9A dsRNA agents or SCN9A antisense polynucleotide agents can be formulated for parenteral administration by injection, such as by bolus or continuous infusion. The injectable formulation can be in unit dose form, such as ampoules or multi-dose containers, with or without preservatives. The SCN9A dsRNA agent formulation (also referred to as a pharmaceutical composition) can be in the form of a suspension, solution, or emulsion in an oily or aqueous carrier, and can contain formulations such as suspending agents, stabilizers, and / or dispersants.
[0275] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffer media. Parenteral carriers include sodium chloride solutions, Ringer's glucose, glucose and sodium chloride, lactated Ringer's solutions, or non-volatile oils. Intravenous carriers include fluids and nutritional supplements, electrolyte supplements (such as Ringer's glucose-based supplements), etc. Preservatives and other additives may also be present, such as antibacterial agents, antioxidants, chelating agents, and inert gases. Other forms of administration (such as intravenous administration) may reduce the dose. If a subject does not respond adequately to the initial dose, a higher dose may be used within the patient's tolerance (or a higher dose may be used effectively through a different, more localized route of delivery). Multiple doses can be used daily as needed to achieve appropriate systemic or local levels of one or more SCN9A dsRNA agents or SCN9A antisense polynucleotide agents and to achieve an appropriate reduction in SCN9A protein activity.
[0276] In other embodiments, the method of the present invention includes the use of a delivery carrier, such as biocompatible microparticles, nanoparticles, or implants suitable for implantation into a recipient (e.g., a subject). Exemplary biodegradable implants that may be useful according to this method are described in PCT Publication WO 95 / 24929 (incorporated herein by reference), which describes a biocompatible, biodegradable polymer matrix for containing biomacromolecules.
[0277] In the method of this invention, non-biodegradable and biodegradable polymer matrices can be used to deliver one or more SCN9A dsRNA agents or SCN9A antisense polynucleotide agents to a subject. In some embodiments, the matrix may be biodegradable. The matrix polymer may be a natural or synthetic polymer. The polymer can be selected based on the desired release time period, typically from a few hours to a year or longer. Typically, release times ranging from a few hours to three to twelve months can be used. The polymer may optionally be in the form of a hydrogel that can absorb up to about 90% of its weight in water, and may further optionally be crosslinked with multivalent ions or other polymers.
[0278] Generally, in some embodiments of the invention, SCN9A dsRNA agents or SCN9A antisense polynucleotide agents can be delivered using bioerodible implants via diffusion or via degradation of a polymer matrix. Exemplary synthetic polymers for such uses are well known in the art. Biodegradable and bionon-degradable polymers can be used to deliver SCN9A dsRNA agents or SCN9A antisense polynucleotide agents using methods known in the art. Bioadhesive polymers, such as bioerodible hydrogels (see the article in HS Sawhney, CP Pathak and JA Hubellin Macromolecules, 1993, 26, 581-587, whose teachings are incorporated herein by reference), can also be used to deliver SCN9A dsRNA agents or SCN9A antisense polynucleotide agents to treat SCN9A-related diseases or conditions. Other suitable delivery systems may include timed-release, delayed-release, or sustained-release delivery systems. Such systems avoid repeated administration of SCN9A dsRNA agents or SCN9A antisense polynucleotide agents, thus increasing convenience for subjects and healthcare professionals. Many types of release delivery systems are available and are known to those skilled in the art. (See, for example: U.S. Patent Nos. 5,075,109; 4,452,775; 4,675,189; 5,736,152; 3,854,480; 5,133,974; and 5,407,686 (the teachings of each patent are incorporated herein by reference). Additionally, pump-based hardware delivery systems can be used, some of which are suitable for implantation.
[0279] The use of long-release implants may be suitable for prophylactic treatment in subjects, as well as for subjects at risk of recurrent SCN9A-related disease or condition. Long-release as used herein refers to the construction and placement of the implant to deliver therapeutic levels of SCN9A dsRNA or SCN9A antisense polynucleotide agents for a duration of at least 10, 20, 30, 60, 90 days, six months, one year, or longer. Long-release implants are well known to those skilled in the art and include some of the release systems described above.
[0280] SCN9A dsRNA or SCN9A antisense polynucleotide formulations can be prepared for storage by mixing molecules or compounds of desired purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers [Remington's Pharmaceutical Sciences, 21st edition, (2006)] in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are non-toxic to the recipient at the dose and concentration used and include buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyl dimethyl benzyl ammonium chloride; hexamethylamine chloride; benzalkonium chloride, benzyl chloride; phenol, butyl, or benzyl alcohol; alkyl esters of p-hydroxybenzoate, such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol, and m-cresol); low molecular weight (less than about 10). (Residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants, such as TWEEN. ® PLURONICS ® Or polyethylene glycol (PEG).
[0281] CELLS, SUBJECTS, AND CONTROLS
[0282] The methods of this invention can be used with cells, tissues, organs, and / or subjects. In some aspects of this invention, the subject is a human or vertebrate mammal, including but not limited to dogs, cats, horses, cattle, goats, mice, rats, and primates such as monkeys. Therefore, this invention can be used to treat SCN9A-related diseases or conditions in human and non-human subjects. In some aspects of this invention, the subject can be a farm animal, zoo animal, domesticated animal, or non-domesticated animal, and the methods of this invention can be used in veterinary prevention and treatment programs. In some embodiments of this invention, the subject is a human, and the methods of this invention can be used in human prevention and treatment programs.
[0283] Some non-limiting examples applicable to the objects of this invention are subjects diagnosed with, suspected of having, or at risk of having a disease or condition associated with higher than expected SCN9A expression and / or activity (also referred to as "elevated SCN9A expression levels"). Non-limiting examples of diseases and conditions associated with higher than expected SCN9A expression and / or activity are described elsewhere herein. The methods of this invention can be applied to subjects diagnosed at the time of treatment with a disease or condition associated with higher than expected SCN9A expression and / or activity, or subjects considered at risk of having or developing a disease or condition associated with higher than expected SCN9A expression and / or activity. In some aspects of this invention, the disease or condition associated with higher than expected SCN9A expression and / or activity is an acute disease or condition, while in other aspects of this invention, the disease or condition associated with higher than expected SCN9A expression and / or activity is a chronic disease or condition.
[0284] In one non-limiting example, the SCN9A dsRNA agent of the present invention is administered to a subject diagnosed with, suspected of having, or at risk of developing pain symptoms, which is a disease requiring reduction of SCN9A expression. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects considered to be at risk of developing or experiencing the disease or condition.
[0285] In another non-limiting example, the SCN9A dsRNA agent of the present invention is administered to subjects diagnosed with, suspected of having, or at risk of developing pain symptoms, a condition requiring reduction of SCN9A expression. The method of the present invention can be applied to subjects diagnosed with the disease or condition at the time of treatment, or subjects considered to be at risk of developing or experiencing the disease or condition.
[0286] Cells to which the methods of this invention can be applied include in vitro, in vivo, and isolated cells. Cells may be present in the body of a subject, in a culture and / or suspension, or in any other suitable state or condition. Cells to which the methods of this invention can be applied may be hepatocytes, hepatocytes, brain cells, spinal cord cells, heart cells, pancreatic cells, cardiovascular cells, kidney cells, or other types of vertebrate cells, including human and non-human mammalian cells. In some embodiments, the cells are neuronal cells. In some embodiments, the neuronal cells or tissues are peripheral sensory neurons, such as peripheral sensory neurons in the dorsal root ganglion, or nociceptive neurons, such as A-delta fibers or C-type fibers. In some aspects of this invention, the cells to which the methods of this invention can be applied are healthy, normal cells, which are unknown to be diseased cells. In some embodiments of this invention, the cells to which the methods and compositions of this invention are applied are hepatocytes, hepatocytes, brain cells, spinal cord cells, heart cells, pancreatic cells, cardiovascular cells, and / or kidney cells. In some aspects of the invention, control cells are normal cells, but it should be understood that cells with a disease or condition may also be used as control cells in certain circumstances, such as when comparing the results of treated cells with a disease or condition to untreated cells with the same disease or condition.
[0287] According to the method of the present invention, the SCN9A peptide activity level can be determined and compared with the SCN9A peptide activity control level. The control can be a predetermined value, which can take various forms. It can be a single cutoff value, such as the median or mean. It can be established based on comparison groups, such as a group with normal levels of SCN9A peptide and / or SCN9A peptide activity and a group with increased levels of SCN9A peptide and / or SCN9A peptide activity. Another non-limiting example of a comparison group can be a group with one or more symptoms or diagnoses of SCN9A-related diseases or conditions; a group without one or more symptoms or diagnoses of such diseases or conditions; a group of subjects treated with the siRNA of the present invention; or a group of subjects not treated with the siRNA of the present invention. Typically, the control can be based on superficially healthy normal individuals or superficially healthy cells of appropriate age. It should be understood that, in addition to predetermined values, the control according to the present invention can be a material sample tested in parallel with the experimental material. Examples include samples from a control population or control samples generated by manufacturing to be tested in parallel with the experimental sample. In some embodiments of the present invention, the control may include cells or subjects that have not been exposed to or treated with the SCN9AdsRNA agent of the present invention, and in this case, the control level of SCN9A peptide and / or SCN9A peptide activity may be compared with the SCN9A peptide and / or SCN9A peptide activity level in cells or subjects exposed to the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the present invention.
[0288] In some embodiments of the invention, the SCN9A peptide level measured in a subject may be a control level, compared with the SCN9A peptide level measured in the same subject at different times. In a non-limiting example, the SCN9A level is measured in a biological sample obtained from a subject who has never received SCN9A treatment according to the invention. In some embodiments, the biological sample is a tissue sample. The SCN9A peptide level measured in the sample obtained from the subject can be used as a baseline or control for the subject. After administering one or more SCN9A dsRNA agents to a subject in the treatment method of the invention, one or more additional tissue samples may be obtained from the subject, and the SCN9A peptide level in the subsequent samples may be compared with the subject's control / baseline level. This comparison can be used to assess the onset, progression, or remission of SCN9A-related disease or condition in the subject. For example, if the baseline level of SCN9A peptide obtained from a subject is higher than the level obtained from the same subject after administration of the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the present invention, it indicates the regression of SCN9A-related disease or condition and demonstrates the effectiveness of the administered SCN9A dsRNA agent of the present invention in treating SCN9A-related disease or condition.
[0289] In certain aspects of the invention, one or more SCN9A peptide levels and / or SCN9A peptide activity values determined for a subject can be used as controls for later comparison of SCN9A peptide levels and / or SCN9A activity values in the same subject, thereby allowing assessment of changes in SCN9A peptide activity relative to “baseline” in the subject. Therefore, an initial SCN9A peptide level and / or initial SCN9A peptide activity level may exist and / or be determined in the subject, and the methods and compounds of the present invention can be used to reduce the SCN9A peptide level and / or SCN9A peptide activity level in a subject, wherein the initial level is used as a control level for that subject.
[0290] Using the method of the present invention, the SCN9A dsRNA agent and / or SCN9A antisense polynucleotide agent of the present invention can be administered to a subject. The effectiveness of the administration and treatment of the present invention can be assessed when the SCN9A peptide level in a tissue sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more compared to the pre-administration level of the SCN9A peptide in a tissue sample obtained from the subject at a previous time point, or compared to a non-contact control level (e.g., the SCN9A peptide level in a control tissue sample). It should be understood that the levels of SCN9A peptide and the levels of SCN9A peptide activity are correlated with the levels of SCN9A gene expression. Certain embodiments of the method of the present invention involve administering an effective amount of the SCN9A dsRNA agent and / or SCN9A antisense agent of the present invention to a subject to inhibit SCN9A gene expression and thereby reduce the subject's SCN9A peptide level and reduce the level of SCN9A peptide activity.
[0291] Some embodiments of the present invention include determining the presence, absence, and / or amount (also referred to herein as level) of the SCN9A peptide in one or more biological samples obtained from one or more subjects. This determination can be used to evaluate the efficacy of the treatment methods of the present invention. For example, the methods and compositions of the present invention can be used to determine the level of the SCN9A peptide in biological samples obtained from subjects previously treated with the SCN9AdsRNA agent and / or SCN9A antisense agent of the present invention. A level of the SCN9A peptide measured in tissue samples obtained from treated subjects that is at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more lower than the pre-treatment SCN9A peptide level determined for the subject or the level in a non-contact control biological sample indicates the level of efficacy of the treatment administered to the subject.
[0292] In some embodiments of the invention, the physiological characteristics of an SCN9A-related disease or condition determined for a subject may be determined by comparison with physiological characteristics determined in the same subject at different times. In a non-limiting example, physiological characteristics (e.g., levels of SCN9A mRNA, SCN9A protein, or another parameter functionally related to SCN9A expression levels in plasma or tissue samples) are determined in biological samples (e.g., tissue samples) obtained from subjects who have never received SCN9A treatment according to the invention. The SCN9A mRNA levels (and / or other physiological characteristics of the SCN9A disease or condition) determined in samples obtained from the subject can be used as a baseline or control for the subject. In the treatment methods of the invention, after administering one or more SCN9A dsRNA agents to the subject, one or more additional tissue samples may be obtained from the subject, and the levels of SCN9A mRNA, SCN9A protein, or another parameter functionally related to SCN9A expression levels in the subsequent samples are compared to the subject's control / baseline levels and / or ratios, respectively. Such comparisons can be used to assess the onset, progression, or remission of an SCN9A-related disease or condition in the subject. For example, if the SCN9A mRNA level in a baseline sample obtained from a subject is higher than the SCN9A mRNA level determined in a sample obtained from the same subject after administration of the SCN9A dsRNA agent or SCN9A antisense polynucleotide agent of the present invention to the subject, it indicates that the SCN9A-related disease or condition has subsided, and that the administered SCN9A dsRNA agent of the present invention is effective in treating the SCN9A-related disease or condition.
[0293] In certain aspects of the invention, one or more physiological characteristic values for an SCN9A-related disease or condition identified in a subject can be used as control values to allow for later comparison of the physiological characteristics of the same subject, thereby allowing assessment of changes in the subject's physiological characteristics relative to a "baseline". Thus, a subject may have and / or have identified initial physiological characteristics, and the methods and compounds of the invention can be used to reduce the level of SCN9A peptides and / or SCN9A peptide activity in a subject, wherein the initial physiological characteristic measurements serve as a control for that subject.
[0294] Using the method of the present invention, the SCN9A dsRNA agent and / or SCN9A antisense polynucleotide agent of the present invention can be administered to a subject in an effective amount to treat an SCN9A disease or condition. The effectiveness of the administration and treatment of the present invention can be assessed by determining changes in one or more physiological characteristics of the SCN9A disease or condition. In a non-limiting example, the SCN9A mRNA level in the tissue sample obtained from the subject is reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to the pre-administration SCN9A mRNA level in a tissue sample obtained from the subject at a previous time point, or compared to a non-contact control level (e.g., the SCN9A mRNA level in a control tissue sample). It should be understood that the levels of SCN9A mRNA, SCN9A protein, or another parameter related to the function of SCN9A / or MAPT peptide expression levels in plasma or tissue samples are each correlated with SCN9A gene expression levels. Some embodiments of the method of the present invention include administering to a subject an amount of the present invention’s SCN9A dsRNA and / or SCN9A antisense agent that effectively inhibits SCN9A gene expression, thereby reducing the level of the subject’s SCN9A mRNA, SCN9A protein, or another parameter related to the function of SCN9A expression level, or otherwise positively influencing the physiological characteristics of the subject’s SCN9A-related diseases or conditions.
[0295] Some embodiments of the present invention include determining the presence, absence, and / or variation of physiological characteristics of SCN9A-related diseases or conditions using methods such as, but not limited to: (1) assessing the physiological characteristics of one or more biological samples obtained from one or more subjects; (2) imaging the subjects (e.g., but not limited to obtaining liver images); and (3) performing a physical examination on the subjects. This determination can be used to evaluate the effectiveness of the treatment methods of the present invention.
[0296] KITS
[0297] The scope of this invention also includes kits containing one or more SCN9A dsRNA agents and / or SCN9A antisense polynucleotide agents and instructions for their use in the methods of this invention. The kits of this invention may include one or more SCN9A dsRNA agents, SCN9A sense polynucleotides, and SCN9A antisense polynucleotide agents, and may be used to treat SCN9A-related diseases or conditions. Kits containing one or more SCN9A dsRNA agents, SCN9A sense polynucleotides, and SCN9A antisense polynucleotide agents can be prepared for use in the treatment methods of this invention. The components of the kits of this invention may be packaged in an aqueous medium or in lyophilized form. The kits of this invention may include a carrier divided into multiple or a series of container devices, such as test tubes, vials, flasks, bottles, syringes, etc., and tightly confining them therein. A first container device or a series of container devices may contain one or more compounds, such as SCN9A dsRNA agents and / or SCN9A sense or antisense polynucleotide agents. A second container device or a series of container devices may contain a targeting agent, a labeling agent, a delivery agent, etc., which may be included as part of an SCN9A dsRNA agent and / or an SCN9A antisense polynucleotide in embodiments of the treatment methods of the present invention.
[0298] The kit of the present invention may also include instructions. The instructions are typically in written form and provide guidance on how to implement the treatment contained in the kit and on making decisions based on that treatment.
[0299] The following examples are provided to illustrate specific instances of the practice of the present invention and are not intended to limit the scope of the invention. Those skilled in the art will understand that the present invention is applicable to a variety of compositions and methods. DETAILED DESCRIPTION
[0301] Example 1. Phosphoramide compound 1
[0302] Under a N2 atmosphere at 0–5 °C, compound D (607 mg, 3.34 mmol, 3.0 eq) and DIEA (432 mg, 3.34 mmol, 582 μL, 3.0 eq) were added to a solution of compound B (500 mg, 1.11 mmol, 1.0 eq) in DCM (5.0 mL). The mixture was stirred at 25 °C for 1.0 h. LC-MS showed that compound B was completely consumed, with several new peaks appearing on the LC-MS, indicating that approximately 70.9% of the desired compound was detected. The resulting reaction mixture was cooled to -20 °C and poured into a cold (0–5 °C) saturated NaHCO3 (5.0 mL) solution, and stirred with DCM (5.0 mL). 2) Extraction: The combined organic layers were washed with cold (0-5°C) saturated NaHCO3 / salt water = 1:1 (5.0 mL / 5.0 mL), dried over Na2SO4, and concentrated under vacuum to obtain a residue (~5 mL). The residue was purified by column chromatography (basic Al2O3, petroleum ether / ethyl acetate = 10 / 1 to 5 / 1, 0.1% Et3N) to give compound 1 (280 mg, 471 μmol, yield 42.3%) as a white solid.
[0303] 1H NMR: EC10615-49-P1N (400 MHz, DMSO-d6) δ ppm 7.44 (br d, J=7.63Hz, 2 H), 7.31 (br t, J=7.94 Hz, 6 H), 7.18 - 7.26 (m, 1 H), 6.89 (brd, J=8.00 Hz, 4 H), 4.08 - 4.13 (m, 1 H), 3.95 - 4.03 (m, 1 H), 3.84 - 3.93 (m, 1H), 3.77 - 3.83 (m, 1 H), 3.74 (s, 6 H), 3.43 - 3.53 (m, 3 H), 3.38 (br d, J=6.75 Hz, 1 H), 2.94 - 3.04 (m, 1 H), 2.70 - 2.85 (m, 1 H), 1.09 - 1.15 (m, 12H), 1.07 (br s, 3 H).
[0304] Example 2. Phosphoramide compound 2
[0305] A solution of DMTrCl (232 g, 684 mmol, 1.0 equivalent) dissolved in pyridine (400 mL) was added to a solution of isomannitol compound A (100 g, 684 mmol, 1.0 equivalent) dissolved in pyridine (600 mL). The mixture was stirred at 25 °C for 12 hours. LC-MS showed that compound A was completely consumed, and a main peak with the desired mass was detected. The resulting reaction mixture was diluted with water (500 mL) and then diluted with DCM (500 mL). 2) Extraction: The combined organic phases were washed with brine (500 mL), dried over Na2SO4, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to give compound B (150 g, 48.9% yield) as a yellow solid.
[0306] 1H NMR: EC4783-404-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.46 (br d, J=7.63Hz, 2 H) 7.28 - 7.37 (m, 6 H) 7.19 - 7.25 (m, 1 H) 6.90 (br d, J=7.88 Hz, 4H) 4.70 (d, J=6.50 Hz, 1 H) 3.99 - 4.09 (m, 6 H) 3.88 - 3.96 (m, 2 H) 3.83 (br dd, J=7.82, 6.94 Hz, 1 H) 3.74 (s, 6 H) 3.41 (br t, J=8.13 Hz, 1H) 3.05 (t, J=8.44 Hz, 1 H) 2.85 (br t, J=7.50 Hz, 1 H).
[0307] Under N2 conditions at 25°C, 2H-tetrazole (0.45 M, 436 mL, 1.1 eq) was added dropwise to a DCM (800 mL) solution of compound B (80.0 g, 178 mmol, 1.0 eq), followed by a DCM (200 mL) solution of compound C (80.6 g, 267 mmol, 85.0 mL, 1.5 eq). The reaction mixture was stirred at 25°C for 1.0 h. LC-MS showed that compound B was completely consumed, and a main peak with the desired mass was detected. The resulting reaction mixture was cooled to -20°C and poured into ice-cold saturated NaHCO3 (500 mL), and then added with DCM (500 mL). 3) Extraction: The combined organic layers were washed with saturated NaHCO3 / salt water at a ratio of 1:1 (300 mL / 300 mL), dried over Na2SO4, and concentrated under vacuum (35°C) to obtain a residue (100 mL). The residue was purified by column chromatography (Al2O3, DCM / MeOH = 100 / 1 to 50 / 1, 0.1% Et3N) to give compound 2 (77 g, 119 mmol, yield 66.5%) as a white solid.
[0308] 1H NMR: EC4783-423-P1B1_C (400 MHz, DMSO-d6) δ ppm 7.22 (br d, J=7.50Hz, 2 H) 7.05 - 7.14 (m, 6 H) 6.96 - 7.02 (m, 1 H) 6.67 (br dd, J=8.82, 1.81Hz, 4 H) 3.95 - 4.07 (m, 2 H) 3.73 - 3.83 (m, 1 H) 3.62 - 3.72 (m, 2 H) 3.48- 3.53 (m, 6 H) 3.27 - 3.37 (m, 3 H) 3.11 (s, 6 H) 2.82 (td, J=8.54, 2.31 Hz, 1 H) 2.47 - 2.63 (m, 3 H) 2.28 (br d, J=1.63 Hz, 3 H) 0.82 - 1.00 (m, 13 H).
[0309] Other phosphoramides can be prepared according to the methods described herein and / or existing technologies (e.g., but not limited to US426,220 and WO02 / 36743).
[0310] Example 3. Preparation of the solid support for the phosphorus amide monomer of the present invention Represents the macroporous resin carrier portion of aminomethyl polyethylene Under nitrogen protection, 19.50 kg of dichloromethane was added to a 50 L glass reactor. Stirring was started, and the temperature was controlled at 20–30 °C. 1.47 kg of DMT Trimann, 1.50 kg of triethylamine, 0.164 kg of 4-dimethylaminopyridine, and 1.34 kg of succinic anhydride were added to the reactor. The mixture was kept at 20–30 °C for 18 h, and a sample was taken to terminate the reaction. 22.50 kg of saturated sodium bicarbonate solution was added to the reaction system, and the mixture was stirred for 10–20 min, resulting in layer separation. The organic phase was separated, and the aqueous phase was extracted twice with dichloromethane. The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum to obtain 1.83 kg of a gray to off-white solid residue.
[0311] Add N,N-dimethylformamide (23.50 kg) to a 100 L glass reactor, stir, and control the temperature at 20-30 °C. Under nitrogen protection, add the previous product O-benzotriazole tetramethylurea hexafluorophosphate (0.33 kg) and N,N-diisopropylethylamine (0.13 kg) to the 100 L glass reactor through a solid feeding funnel, stir for 10-30 minutes, and discharge the material into a 50 L zinc drum for later use. Macroporous amine methyl resin (3.25 kg) (purchased from Tianjin Nankai Synthetic Technology Co., Ltd., batch number HA2X1209, loading 0.48 mmol / g) was added to the 100 L solid-phase synthesis reactor through a solid feed funnel. The temperature was controlled at 20–30 °C. N,N-dimethylformamide (21.00 kg + 21.00 kg) and the reaction solution from the zinc tank in the previous step were added to the solid-phase synthesis reactor. The reaction was maintained at this temperature, and the solid loading was monitored until it reached ≥250 μmol / g. The loading was detected by UV light. The mixture was filtered under nitrogen pressure, and the filter cake was washed three times with N,N-dimethylformamide (26.00 kg + 26.10 kg + 26.00 kg). The filter cake was then left in the reactor. Add CAP.A (50% acetonitrile and 50% acetic anhydride, 4.40 kg + 4.42 kg + 4.30 kg) and CAP.B (20% pyridine, 30% N-methylimidazole, and 50% acetonitrile, 4.40 kg + 4.40 kg + 4.47 kg) to an 80 L glass reactor and stir for 3-8 min before use. Repeat this operation three times. Cover the reactor and add acetonitrile (18.00 kg + 18.00 kg + 18.00 kg + 17.50 kg + 17.50 kg) to a solid-phase synthesis reactor. Purge with nitrogen for 10-30 min and then filter. Repeat this operation four times. Purge the filter cake in the solid-phase synthesis reactor with nitrogen for 2-4 h and then transfer it to a 50 L filter press. Maintain the temperature at 15-30 °C and continue drying. After drying, a yellow to white solid product is obtained, weighing 3.516 kg.
[0312] Isomannitol residues are added to the 5' or 3' end of the oligonucleotide chain by methods well known to those skilled in the art, such as the invab method, and further added to the target group.
[0313] Example 4. Preparation of 5'-phosphate ester mimic phosphoramide
[0314] Enantiomers of phosphoramidite-15-1 and phosphoramidite-15-2
[0315] Benzoyl chloride (126 g, 893 mmol, 104 mL) was added at 0 °C to a solution containing pyridine (735 g, 9.29 mol, 750 mL) and acetonitrile (1.50 L) with uracil (50.0 g, 446 mmol). The reaction solution was stirred at 20–25 °C for 12.0 h, and TLC showed complete consumption of the uracil compound. The reaction mixture was concentrated under vacuum to obtain a residue. The residue was diluted with cold water (1.0 L) and then with ethyl acetate (1.0 L). 3) Extraction. The combined organic layers were washed with brine (500 mL) and dried with anhydrous sodium sulfate. The residue was purified by column chromatography (SiO2, ethyl acetate / petroleum ether = 1 / 10 to 1 / 1) to give a white solid Phos-15-1A (63 g, yield 65.3%).
[0316] 1 H NMR: EC4783-420-P1N (400 MHz, DMSO- d 6) DELTA ppm 7.96 (dd, J =8.4,1.2 Hz, 2 H), 7.76-7.81 (m, 1 H), 7.67 (dd, J =7.6, 5.6 Hz, 1 H), 7.58-7.64(m, 2 H), 5.75 (dd, J =7.6, 1.2 Hz, 1 H).
[0317] Phos-15-SM2 (4.0 g, 47.6 mmol) and compound Phos-15-1A (7.91 g, 36.6 mmol) were dissolved in tetrahydrofuran (80 mL), and triphenylphosphine (11.5 g, 43.9 mmol) and diethyl azodicarboxylate (7.64 g, 43.9 mmol, 7.98 mL) were added. The mixture was stirred at 20–25°C for 16 hours. LC-MS showed that compound Phos-15-1A was completely consumed. The reaction mixture was concentrated under reduced pressure to remove tetrahydrofuran. The residue was diluted with water (80 mL) and then with ethyl acetate (80 mL). 3) Extraction. The combined organic phases were washed with brine (80 mL), dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue was purified by column chromatography (SiO2, MeOH / DCM = 0 / 10 to 1 / 10) to give compound Phos-15-1B (14 g, crude product) as a white solid.
[0318] Under nitrogen protection, a mixture of compound Phos-15-1B (7.0 g, 9.30 mmol) and m-chloroperoxybenzoic acid (2.27 g, 11.1 mmol, 85% purity) in dichloromethane (70 mL) was heated at 0–5°C. After 16 hours of reaction, TLC showed complete consumption of compound Phos-15-1B and a new spot of low polarity was detected. The pH of the reaction mixture was slowly adjusted to 7–8 with a saturated solution of NaHSO3 and NaHCO3 (1:1), and then thawed with ethyl acetate (70 mL). 3) Extraction: Wash the combined organic phases with brine (700 mL). Dry over anhydrous sodium sulfate and concentrate under reduced pressure. Purify the residue by silica gel column chromatography (100-200 mesh silica gel), eluting with ethyl acetate:petroleum ether (1:30~1:1) to give a white solid compound Phos-15-1C (1.2 g, crude product).
[0319] Compound Phos-15-SM3 (4.0 g, 14.4 mmol) was dissolved in tetrahydrofuran (24.0 mL), and KSAc (1.81 g, 15.8 mmol) and tetrabutylammonium iodide (TBAI, 531.4 mg, 1.44 mmol) were added. The mixture was stirred at 70 °C for 4.0 h. LC-MS showed that the starting material Phos-15-SM3 was completely consumed, and the main peak of the desired target molecular weight was detected. The reaction mixture was cooled and concentrated under reduced pressure. The solid residue was removed by filtration through a short silica gel pad and washed with ethyl acetate. The filtrate was concentrated under vacuum to give a brown oily compound Phos-15-1D (3.50 g, 98.5% yield). Compound Phos-15-1D can be used in the next step without further purification.
[0320] 1 H NMR: EC11950-13-P1B (400 MHz, DMSO- d 6) DELTA ppm 3.96-4.07 (m, 4H) 3.27 (d, J =14.0 Hz, 2H) 2.40 (s, 3H) 1.22 (t, J =7.2 Hz, 6H).
[0321] Potassium carbonate (1.11 g, 8.05 mmol) and compound Phos-15-1D (1.91 g, 8.45 mmol) were added to a 15.0 mL ethanol solution of compound Phos-15-1C (1.20 g, 4.02 mmol). The mixture was stirred at 20–25 °C for 3.0 h. TLC showed that compound Phos-15-1C was completely consumed and a major new spot with high polarity was detected. The resulting reaction mixture was filtered, diluted with water (20 mL), and then thawed with dichloromethane (20 mL). 3) Extraction: The combined organic layers were washed with brine, dried over anhydrous sodium sulfate, and concentrated under vacuum to obtain the residue. The residue was purified by column chromatography (SiO2, MeOH / DCM = 1 / 100 to 10 / 100) to give the brown oily compound Phos-15-1E (1.00 g, 65.7% yield, a 1:1 mixture of enantiomers -1E-1 and -1E-2).
[0322] 1 H NMR: EC10615-82-P1N1 (400 MHz, DMSO- d 6) DELTA ppm 11.23 (br s, 1H), 7.69 (d, J =8.0 Hz, 1 H), 5.58 (dd, J =8.0, 1.6 Hz, 1 H), 4.93 (q, J =8.8Hz, 1 H), 3.96-4.17 (m, 5 H), 3.08-3.17 (m, 1 H), 3.03 (dd, J = 14.0, 2.0 Hz, 2 H), 2.38-2.47 (m, 1 H), 2.04-2.07 (m, 1 H), 1.82-1.90 (m, 1 H), 1.56-1.59(m, 1 H), 1.25 (t,J =6.8 Hz, 6 H).
[0323] Compound Phos-15-1E can be chirally resolved to yield enantiomers Phos-15-1E-1 and Phos-15-1E-2. Resolution conditions: DAICELCHIRALPAK AD 40 mm column, 140 mL / min, ethanol:carbon dioxide = 35:75. It is understood that when enantiomers phosphoramidite-15-1 or phosphoramidite-15-2 are desired, they can be obtained simply by reacting the corresponding enantiomers Phos-15-1E-1 or Phos-15-1E-2 with a phosphorus reagent.
[0324] Under a nitrogen atmosphere at room temperature, a solution of bis(diisopropylamino)(2-cyanoethoxy)phosphine (P reagent, 956 mg, 3.17 mmol, 1.01 mL) in dichloromethane (0.5 mL) was added to a solution of compound Phos-15-1E (400 mg, 1.06 mmol) and di-isopropylamine-tetrazole salt (199 mg, 1.16 mmol) in dichloromethane (4.0 mL). The mixture was then stirred at 40 °C for 1.0 h. LC-MS showed that compound Phos-15-1E was completely consumed, with several new peaks appearing and approximately 80% of the desired compound detected. The resulting reaction mixture was cooled to -20 °C and poured into a cold (0–5 °C) saturated sodium bicarbonate aqueous solution (10 mL), and stirred with dichloromethane (10 mL). 2) Extraction: The combined organic layers were washed with cold (0-5 °C) saturated sodium bicarbonate / salt water (5 mL / 5 mL), dried over anhydrous sodium sulfate, and concentrated under vacuum to obtain a residue (~2.0 mL). The residue was purified by column chromatography (alkaline Al₂O₃, MeOH / DCM = 1 / 80 to 1 / 40, 0.1% Et₃N) to give phosphoramidite-15 as a colorless oil (350 mg, 0.6 mmol, 57.2% yield, a 1:1 mixture of enantiophosphoramidite-15-1 and enantiophosphoramidite-15-2).
[0325] Enantiomers of phosphoramidite-15-1 or enantiomers of phosphoramidite-15-2 can be obtained from the same Phos-15-1E-1 or Phos-15-1E-2 obtained by SFC separation and purification, following the same process described above.
[0326] 1 H NMR: EC10615-82-P1N1 (400 MHz, DMSO- d 6) DELTAppm 11.23 (br s, 1H), 7.70 (d, J =8.0 Hz, 1 H), 5.55-5.60 (m, 1 H), 4.89 (q, J =8.4 Hz, 1H),4.29-4.42 (m, 1H), 3.99-4.09 (m, 4H), 3.65-3.84 (m, 2H), 3.53-3.62 (m, 2H),3.35-3.41 (m, 1H), 3.02 (dd, J =14.0 , 8.0 Hz, 2H), 2.76-2.79 (m, 2H), 2.40-2.49 (m, 1H), 2.15-2.25 (m, 1H), 1.95-2.07 (m, 1H), 1.65-1.75 (m, 1H), 1.23-1.26 (m, 6H) 1.12-1.21 (m, 12H).
[0327] The specific preparation methods for Phos-15-1E-1 or Phos-15-1E-2 chiral compounds are as follows: System: Waters SFC 150 Column Name: DAICELCHIRALCEL® AD Column type: 250 50 mm 10 mm Mobile phase A: Supercritical CO2 Mobile phase B: EtOH Wavelength: 214 nm Flow rate: 140 mL / min Column temperature: RT Injection volume: 7.0 mL; Cycle time: 10.0 min Solvents: Supercritical CO2: Food grade EtOH: Redistilled grade.
[0328] Preparation of phosphoramide-43
[0329] (3aR, 6aR)-2,2-dimethyltetrahydro-3aH-cyclopentadieno[d][1,3]dioxacyclopenten-4(6aH)-one (phos-43-SM1, 16.2 g, 105 mmol, 1.0 eq), diethyl mercaptomethylphosphonate (19.3 g, 105 mmol, 1.0 eq), and dichloromethane (200 mL) were added to a 500 mL flask. The flask was stirred under nitrogen protection and cooled to 0–5 °C, then triethylamine (1.06 g, 10.5 mmol, 0.1 eq) was added dropwise. After the addition was complete, the temperature was restored to 25 °C and stirred overnight under nitrogen protection. The reaction was confirmed to be complete by LCMS, and the reaction solution was concentrated under vacuum to obtain the crude product. The crude product was purified by rapid column chromatography using EA:DCM = 0%-15% as the eluent. The product was then concentrated under vacuum to obtain 25g of Phos-43-1A as a pale yellow oil, with a yield of 70.3%.
[0330] LCMS: M+H=339.5
[0331] Phos-43-1A (25 g, 73.9 mmol, 1.0 eq) and ethanol (250 mL) were added to a 500 mL flask. The flask was stirred and cooled to 0–5 °C under nitrogen protection, and then sodium borohydride (3.1 g, 81.3 mmol, 1.1 eq) was added in portions. After the addition was complete, the mixture was stirred at 0–5 °C for 0.5 h. The reaction was confirmed to be complete by LCMS. Ice water (200 mL) was added dropwise to the reaction mixture and stirred for 10 min. The mixture was then extracted twice with dichloromethane (500 mL). The combined organic phases were dried over anhydrous sodium sulfate and concentrated under vacuum to obtain the crude product. The crude product was purified by rapid column chromatography using (MeOH:DCM = 0%–5%) as the eluent. The product was then concentrated under vacuum to obtain 24.5 g of Phos-43-1B as a pale yellow oil, with a yield of 97.4%.
[0332] LCMS: M+H=341.5
[0333] 1 H NMR: (400 MHz, CD3CN), δ ppm 4.67-4.65 (d, J =8.0, 1 H), 4.47-4.42(m, 2 H), 4.08-4.01 (m, 5 H), 3.27-3.25 (m, 1 H), 2.97-2.93 (d, J =16.0, 2 H), 2.03-1.99 (m, 1 H), 1.73-1.71 (m, 1 H), 1.38 (s, 3 H), 1.26-1.22 (m, 9 H).
[0334] Phos-43-1B (10 g, 29.4 mmol, 1.0 eq), pyridine (7 g, 88.1 mmol, 3.0 eq), and dichloromethane (100 mL) were added to a 250 mL flask. The flask was stirred under nitrogen protection and cooled to -78 °C. Then, trifluoromethanesulfonic anhydride (12.4 g, 44.1 mmol, 1.5 eq) was added dropwise. After the addition was complete, the mixture was kept at -78 °C and stirred under nitrogen protection for 3 h. The reaction was confirmed to be complete by LCMS. The reaction solution was poured into 50 mL of ice water and then extracted twice with dichloromethane (100 mL). The combined organic phases were dried over anhydrous sodium sulfate and concentrated under vacuum to obtain the crude product Phos-43-1C, which was used directly in the next step.
[0335] LCMS: M+H=473.4
[0336] Phos-43-1C (16 g, 33.8 mmol, 1.0 eq), 3-benzoyluracil (8.8 g, 40.6 mmol, 1.2 eq), cesium carbonate (22 g, 67.7 mmol), and acetonitrile (200 mL) were added to a 500 mL flask. The flask was stirred overnight at 25 °C under nitrogen protection. The reaction was confirmed to be complete by LC-MS. The reaction solution was filtered, and the filtrate was concentrated under vacuum to obtain the crude product. The crude product was purified by rapid column chromatography using (MeOH:DCM = 0%-5%) as the eluent. The product was then concentrated under vacuum to obtain 18 g of Phos-43-1D as a brown oily substance, with a yield of 98.7%.
[0337] LCMS:M+H=539.4
[0338] Phos-43-1D (18 g, 33.4 mmol, 1.0 eq) and methanol (180 mL) were added to a 500 mL flask. Ammonia-methanol (180 mL) was added dropwise under nit...
Claims
1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of sodium voltage-gated channel α subunit 9 (SCN9A), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO:1 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides differing from the nucleotide sequence of SEQ ID NO:2 by no more than 3 nucleotides, wherein the sense strand and the antisense strand may be partially, substantially, or completely complementary, and optionally contain a targeting ligand.
2. The dsRNA agent according to claim 1, wherein the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO:2 by no more than 3 nucleotides, and the sense strand is complementary to at least 15 consecutive nucleotides in the antisense strand.
3. The dsRNA agent according to any one of claims 1-2, wherein the antisense strand comprises a region complementary to the mRNA encoding SCN9A, the complementary region comprising a region complementary to SEQ ID NO:1 Nucleotides 281-301, 287-307, 289-309, 320-340, 339-359, 356-376, 368-388, 371-391, 387-407, 389-409, 390-410, 452-472, 476-496, 499-519, 553-573, 556-576, 558-578, 559-579, 564-584, 568-588, 569-589, 579-599, 580-600, 581-601, 583-603, 584-604, 603-623, 604-624, 60 6-626, 608-628, 609-629, 614-634, 618-638, 622-642, 625-645, 626-646, 627-647, 628-648, 629-649, 630-650, 632-652, 633-653, 635-655, 636-656, 637-657, 638-658, 639-659, 640-660, 642-662, 643-663, 652-672, 653-673, 658-678, 660-680, 663-683, 676-696, 679-699 685-705, 688-708, 689-709, 692-712, 694-714, 695-715, 697-717, 705-725, 709-729, 711-731, 712-732, 713-733, 715-735, 749-769, 751-771, 761-781, 764-784, 786-806, 796-816, 799-819, 802-822, 829-849, 859-879, 863-883, 865-885, 868-888, 869-889, 870-890, 871-89 1. 874-894, 1036-1056, 1039-1059, 1066-1086, 1068-1088, 1069-1089, 1071-1091, 1072-1092, 1073-1093, 1099-1119, 1149-1169, 1156-1176, 1158-1178, 1160-1180, 1179-1199, 1220-1240, 1223-1243, 1225-1245, 1230-1250, 1286-1306, 1298-1318, 1302-1322, 1304-1324,1318-1338、1347-1367、1351-1371、1352-1372、1357-1377、1366-1386、1371-1391、1374-1394、1379-1399、1384-1404、1385-1405、1427-1447、1428-1448、1429-1449、1431-1451、1432-1452、1433-1453、1455-1475、1459-1479、1460-1480、1461-1481、1525-1545、1528-1548、1529-1549、1531-1551、1532-1552、1561-1581、1582-1602、1598-1618、1628-1648、1636-1656、1647-1667、1670-1690、1671-1691、1673-1693、1674-1694、1676-1696、1682-1702、1683-1703、1684-1704、1690-1710、1695-1715、1702-1722、1703-1723、1706-1726、1823-1843、1828-1848、1870-1890、1911-1931、1914-1934、1917-1937、1919-1939、1920-1940、1946-1966、1949-1969、1950-1970、1951-1971、1952-1972、1955-1975、1956-1976、1976-1996、1978-1998、1979-1999、1981-2001、1983-2003、1991-2011、1995-2015、1997-2017、2012-2032、2017-2037、2020-2040、2024-2044、2140-2160、2147-2167、2152-2172、2278-2298、2290-2310、2292-2312、2293-2313、2301-2321、2321-2341、2323-2343、2326-2346、2355-2375、2360-2380、2365-2385、2370-2390、2371-2391、2373-2393、2377-2397、2378-2398、2395-2415、2403-2423、2405-2425、2412-2432、2417-2437、2436-2456、2439-2459、2448-2468、2449-2469、2450-2470、2454-2474、2455-2475、2457-2477、2472-2492、2474-2494、2475-2495、2485-2505、2493-2513、2504-2524、2507-2527、2514-2534、2515-2535、2516-2536、2522-2542、2524-2544、2525-2545、2526-2546、2530-2550、2531-2551、2535-2555、2540-2560、2542-2562、2543-2563、2544-2564、2551-2571、2552-2572、2553-2573、2565-2585、2566-2586、2567-2587、2569-2589、2573-2593、2602-2622、2611-2631、2615-2635、2618-2638、2624-2644、2627-2647、2629-2649、2636-2656、2638-2658、2639-2659、2641-2661、2648-2668、2652-2672、2659-2679、2662-2682、2664-2684、2669-2689、2671-2691、2675-2695、2684-2704、2688-2708、2691-2711、2693-2713、2694-2714、2696-2716、2697-2717、2698-2718、2709-2729、2732-2752、2734-2754、2738-2758、2739-2759、2740-2760、2745-2765、2759-2779、2761-2781、2788-2808、2820-2840、2821-2841、2841-2861、2842-2862、2847-2867、2848-2868、2850-2870、2851-2871、2854-2874、2855-2875、2858-2878、2859-2879、2860-2880、2861-2881、2862-2882、2863-2883、3122-3142、3124-3144、3127-3147、3128-3148、3129-3149、3133-3153、3134-3154、3136-3156、3139-3159、3141-3161、3142-3162、3170-3190、3171-3191、3172-3192、3173-3193、3176-3196、3177-3197、3178-3198、3179-3199、3180-3200、3182-3202、3183-3203、3184-3204、3185-3205、3203-3223、3204-3224、3206-3226、3209-3229、3210-3230、3214-3234、3215-3235、3218-3238、3220-3240、3221-3241、3223-3243、282-300、288-306、290-308、321-339、340-358、357-375、369-387、372-390、388-406、390-408、391-409、453-471、477-495、500-518、554-572、557-575、559-577、560-578、565-583、569-587、570-588、580-598、581-599、582-600、584-602、585-603、604-622、605-623、607-625、609-627、610-628、615-633、619-637、623-641、626-644、627-645、628-646、629-647、630-648、631-649、633-651、634-652、636-654、637-655、638-656、639-657、640-658、641-659、643-661、644-662、653-671、654-672、659-677、661-679、664-682、677-695、680-698、686-704、689-707、690-708、693-711、695-713、696-714、698-716、706-724、710-728、712-730、713-731、714-732、716-734、750-768、752-770、762-780、765-783、787-805、797-815、800-818、803-821、830-848、860-878、864-882、866-884、869-887、870-888、871-889、872-890、875-893、1037-1055、1040-1058、1067-1085、1069-1087、1070-1088、1072-1090、1073-1091、1074-1092、1100-1118、1150-1168、1157-1175、1159-1177、1161-1179、1180-1198、1221-1239、1224-1242、1226-1244、1231-1249、1287-1305、1299-1317、1303-1321、1305-1323、1319-1337、1348-1366、1352-1370、1353-1371、1358-1376、1367-1385、1372-1390、1375-1393、1380-1398、1385-1403、1386-1404、1428-1446、1429-1447、1430-1448、1432-1450、1433-1451、1434-1452、1456-1474、1460-1478、1461-1479、1462-1480、1526-1544、1529-1547、1530-1548、1532-1550、1533-1551、1562-1580、1583-1601、1599-1617、1629-1647、1637-1655、1648-1666、1671-1689、1672-1690、1674-1692、1675-1693、1677-1695、1683-1701、1684-1702、1685-1703、1691-1709、1696-1714、1703-1721、1704-1722、1707-1725、1824-1842、1829-1847、1871-1889、1912-1930、1915-1933、1918-1936、1920-1938、1921-1939、1947-1965、1950-1968、1951-1969、1952-1970、1953-1971、1956-1974、1957-1975、1977-1995、1979-1997、1980-1998、1982-2000、1984-2002、1992-2010、1996-2014、1998-2016、2013-2031、2018-2036、2021-2039、2025-2043、2141-2159、2148-2166、2153-2171、2279-2297、2291-2309、2293-2311、2294-2312、2302-2320、2322-2340、2324-2342、2327-2345、2356-2374、2361-2379、2366-2384、2371-2389、2372-2390、2374-2392、2378-2396、2379-2397、2396-2414、2404-2422、2406-2424、2413-2431、2418-2436、2437-2455、2440-2458、2449-2467、2450-2468、2451-2469、2455-2473、2456-2474、2458-2476、2473-2491、2475-2493、2476-2494、2486-2504、2494-2512、2505-2523、2508-2526、2515-2533、2516-2534、2517-2535、2523-2541、2525-2543、2526-2544、2527-2545、2531-2549、2532-2550、2536-2554、2541-2559、2543-2561、2544-2562、2545-2563、2552-2570、2553-2571、2554-2572、2566-2584、2567-2585、2568-2586、2570-2588、2574-2592、2603-2621、2612-2630、2616-2634、2619-2637、2625-2643、2628-2646、2630-2648、2637-2655、2639-2657、2640-2658、2642-2660、2649-2667、2653-2671、2660-2678、2663-2681、2665-2683、2670-2688、2672-2690、2676-2694、2685-2703、2689-2707、2692-2710、2694-2712、2695-2713、2697-2715、2698-2716、2699-2717、2710-2728、2733-2751、2735-2753、2739-2757、2740-2758、2741-2759、2746-2764、2760-2778、2762-2780、2789-2807、2821-2839、2822-2840、2842-2860、2843-2861、2848-2866、2849-2867、2851-2869、2852-2870、2855-2873、2856-2874、2859-2877、2860-2878、2861-2879、2862-2880、2863-2881、2864-2882、3123-3141、3125-3143、3128-3146、3129-3147、3130-3148、3134-3152、3135-3153、3137-3155、3140-3158、3142-3160、3143-3161、3171-3189、3172-3190、3173-3191、3174-3192、3177-3195、3178-3196、3179-3197、3180-3198、3181-3199、3183-3201、3184-3202、3185-3203、3186-3204、3204-3222、3205-3223、3207-3225、3210-3228、3211-3229、3215-3233、3216-3234、3219-3237、3221-3239、3222-3240、3224-3242、279-303、285-309、287-311、318-342、337-361、354-378、366-390、369-393、385-409、387-411、388-412、450-474、474-498、497-521、551-575、554-578、556-580、557-581、562-586、566-590、567-591、577-601、578-602、579-603、581-605、582-606、601-625、602-626、604-628、606-630、607-631、612-636、616-640、620-644、623-647、624-648、625-649、626-650、627-651、628-652、630-654、631-655、633-657、634-658、635-659、636-660、637-661、638-662、640-664、641-665、650-674、651-675、656-680、658-682、661-685、674-698、677-701、683-707、686-710、687-711、690-714、692-716、693-717、695-719、703-727、707-731、709-733、710-734、711-735、713-737、747-771、749-773、759-783、762-786、784-808、794-818、797-821、800-824、827-851、857-881、861-885、863-887、866-890、867-891、868-892、869-893、872-896、1034-1058、1037-1061、1064-1088、1066-1090、1067-1091、1069-1093、1070-1094、1071-1095、1097-1121、1147-1171、1154-1178、1156-1180、1158-1182、1177-1201、1218-1242、1221-1245、1223-1247、1228-1252、1284-1308、1296-1320、1300-1324、1302-1326、1316-1340、1345-1369、1349-1373、1350-1374、1355-1379、1364-1388、1369-1393、1372-1396、1377-1401、1382-1406、1383-1407、1425-1449、1426-1450、1427-1451、1429-1453、1430-1454、1431-1455、1453-1477、1457-1481、1458-1482、1459-1483、1523-1547、1526-1550、1527-1551、1529-1553、1530-1554、1559-1583、1580-1604、1596-1620、1626-1650、1634-1658、1645-1669、1668-1692、1669-1693、1671-1695、1672-1696、1674-1698、1680-1704、1681-1705、1682-1706、1688-1712、1693-1717、1700-1724、1701-1725、1704-1728、1821-1845、1826-1850、1868-1892、1909-1933、1912-1936、1915-1939、1917-1941、1918-1942、1944-1968、1947-1971、1948-1972、1949-1973、1950-1974、1953-1977、1954-1978、1974-1998、1976-2000、1977-2001、1979-2003、1981-2005、1989-2013、1993-2017、1995-2019、2010-2034、2015-2039、2018-2042、2022-2046、2138-2162、2145-2169、2150-2174、2276-2300、2288-2312、2290-2314、2291-2315、2299-2323、2319-2343、2321-2345、2324-2348、2353-2377、2358-2382、2363-2387、2368-2392、2369-2393、2371-2395、2375-2399、2376-2400、2393-2417、2401-2425、2403-2427、2410-2434、2415-2439、2434-2458、2437-2461、2446-2470、2447-2471、2448-2472、2452-2476、2453-2477、2455-2479、2470-2494、2472-2496、2473-2497、2483-2507、2491-2515、2502-2526、2505-2529、2512-2536、2513-2537、2514-2538、2520-2544、2522-2546、2523-2547、2524-2548、2528-2552、2529-2553、2533-2557、2538-2562、2540-2564、2541-2565、2542-2566、2549-2573、2550-2574、2551-2575、2563-2587、2564-2588、2565-2589、2567-2591、2571-2595、2600-2624、2609-2633、2613-2637、2616-2640、2622-2646、2625-2649、2627-2651、2634-2658、2636-2660、2637-2661、2639-2663、2646-2670、2650-2674、2657-2681、2660-2684、2662-2686、2667-2691、2669-2693、2673-2697、2682-2706、2686-2710、2689-2713、2691-2715、2692-2716、2694-2718、2695-2719、2696-2720、2707-2731、2730-2754、2732-2756、2736-2760、2737-2761、2738-2762、2743-2767、2757-2781、2759-2783、2786-2810、2818-2842、2819-2843、2839-2863、2840-2864、2845-2869、2846-2870、2848-2872、2849-2873、2852-2876、2853-2877、2856-2880、2857-2881、2858-2882、2859-2883、2860-2884、2861-2885、3120-3144、3122-3146、3125-3149、3126-3150、3127-3151、3131-3155、3132-3156、3134-3158、3137-3161、3139-3163、3140-3164、3168-3192、3169-3193、3170-3194、3171-3195、3174-3198、3175-3199、3176-3200、3177-3201、3178-3202、3180-3204、3181-3205、3182-3206、3183-3207、3201-3225、3202-3226、3204-3228、3207-3231、3208-3232、3212-3236、3213-3237、3216-3240、3218-3242、3219-3243、3221-3245、276-306、282-312、284-314、315-345、334-364、351-381、363-393、366-396、382-412、384-414、385-415、447-477、471-501、494-524、548-578、551-581、553-583、554-584、559-589、563-593、564-594、574-604、575-605、576-606、578-608、579-609、598-628、599-629、601-631、603-633、604-634、609-639、613-643、617-647、620-650、621-651、622-652、623-653、624-654、625-655、627-657、628-658、630-660、631-661、632-662、633-663、634-664、635-665、637-667、638-668、647-677、648-678、653-683、655-685、658-688、671-701、674-704、680-710、683-713、684-714、687-717、689-719、690-720、692-722、700-730、704-734、706-736、707-737、708-738、710-740、744-774、746-776、756-786、759-789、781-811、791-821、794-824、797-827、824-854、854-884、858-888、860-890、863-893、864-894、865-895、866-896、869-899、1031-1061、1034-1064、1061-1091、1063-1093、1064-1094、1066-1096、1067-1097、1068-1098、1094-1124、1144-1174、1151-1181、1153-1183、1155-1185、1174-1204、1215-1245、1218-1248、1220-1250、1225-1255、1281-1311、1293-1323、1297-1327、1299-1329、1313-1343、1342-1372、1346-1376、1347-1377、1352-1382、1361-1391、1366-1396、1369-1399、1374-1404、1379-1409、1380-1410、1422-1452、1423-1453、1424-1454、1426-1456、1427-1457、1428-1458、1450-1480、1454-1484、1455-1485、1456-1486、1520-1550、1523-1553、1524-1554、1526-1556、1527-1557、1556-1586、1577-1607、1593-1623、1623-1653、1631-1661、1642-1672、1665-1695、1666-1696、1668-1698、1669-1699、1671-1701、1677-1707、1678-1708、1679-1709、1685-1715、1690-1720、1697-1727、1698-1728、1701-1731、1818-1848、1823-1853、1865-1895、1906-1936、1909-1939、1912-1942、1914-1944、1915-1945、1941-1971、1944-1974、1945-1975、1946-1976、1947-1977、1950-1980、1951-1981、1971-2001、1973-2003、1974-2004、1976-2006、1978-2008、1986-2016、1990-2020、1992-2022、2007-2037、2012-2042、2015-2045、2019-2049、2135-2165、2142-2172、2147-2177、2273-2303、2285-2315、2287-2317、2288-2318、2296-2326、2316-2346、2318-2348、2321-2351、2350-2380、2355-2385、2360-2390、2365-2395、2366-2396、2368-2398、2372-2402、2373-2403、2390-2420、2398-2428、2400-2430、2407-2437、2412-2442、2431-2461、2434-2464、2443-2473、2444-2474、2445-2475、2449-2479、2450-2480、2452-2482、2467-2497、2469-2499、2470-2500、2480-2510、2488-2518、2499-2529、2502-2532、2509-2539、2510-2540、2511-2541、2517-2547、2519-2549、2520-2550、2521-2551、2525-2555、2526-2556、2530-2560、2535-2565、2537-2567、2538-2568、2539-2569、2546-2576、2547-2577、2548-2578、2560-2590、2561-2591、2562-2592、2564-2594、2568-2598、2597-2627、2606-2636、2610-2640、2613-2643、2619-2649、2622-2652、2624-2654、2631-2661、2633-2663、2634-2664、2636-2666、2643-2673、2647-2677、2654-2684、2657-2687、2659-2689、2664-2694、2666-2696、2670-2700、2679-2709、2683-2713、2686-2716、2688-2718、2689-2719、2691-2721、2692-2722、2693-2723、2704-2734、2727-2757、2729-2759、2733-2763、2734-2764、2735-2765、2740-2770、2754-2784、2756-2786、2783-2813、2815-2845、2816-2846、2836-2866、2837-2867、2842-2872、2843-2873、2845-2875、2846-2876、2849-2879、2850-2880、2853-2883、2854-2884、2855-2885、2856-2886、2857-2887、2858-2888、3117-3147、3119-3149、3122-3152、3123-3153、3124-3154、3128-3158、3129-3159、3131-3161、3134-3164、3136-3166、3137-3167、3165-3195、3166-3196、3167-3197、3168-3198、3171-3201、3172-3202、3173-3203、3174-3204、3175-3205、3177-3207、3178-3208、3179-3209、3180-3210、3198-3228、3199-3229、3201-3231、3204-3234、3205-3235、3209-3239、3210-3240、3213-3243、3215-3245、3216-3246、3218-3248、283-301、289-307、291-309、322-340、341-359、358-376、370-388、373-391、389-407、391-409、392-410、454-472、478-496、501-519、555-573、558-576、560-578、561-579、566-584、570-588、571-589、581-599、582-600、583-601、585-603、586-604、605-623、606-624、608-626、610-628、611-629、616-634、620-638、624-642、627-645、628-646、629-647、630-648、631-649、632-650、634-652、635-653、637-655、638-656、639-657、640-658、641-659、642-660、644-662、645-663、654-672、655-673、660-678、662-680、665-683、678-696、681-699、687-705、690-708、691-709、694-712、696-714、697-715、699-717、707-725、711-729、713-731、714-732、715-733、717-735、751-769、753-771、763-781、766-784、788-806、798-816、801-819、804-822、831-849、861-879、865-883、867-885、870-888、871-889、872-890、873-891、876-894、1038-1056、1041-1059、1068-1086、1070-1088、1071-1089、1073-1091、1074-1092、1075-1093、1101-1119、1151-1169、1158-1176、1160-1178、1162-1180、1181-1199、1222-1240、1225-1243、1227-1245、1232-1250、1288-1306、1300-1318、1304-1322、1306-1324、1320-1338、1349-1367、1353-1371、1354-1372、1359-1377、1368-1386、1373-1391、1376-1394、1381-1399、1386-1404、1387-1405、1429-1447、1430-1448、1431-1449、1433-1451、1434-1452、1435-1453、1457-1475、1461-1479、1462-1480、1463-1481、1527-1545、1530-1548、1531-1549、1533-1551、1534-1552、1563-1581、1584-1602、1600-1618、1630-1648、1638-1656、1649-1667、1672-1690、1673-1691、1675-1693、1676-1694、1678-1696、1684-1702、1685-1703、1686-1704、1692-1710、1697-1715、1704-1722、1705-1723、1708-1726、1825-1843、1830-1848、1872-1890、1913-1931、1916-1934、1919-1937、1921-1939、1922-1940、1948-1966、1951-1969、1952-1970、1953-1971、1954-1972、1957-1975、1958-1976、1978-1996、1980-1998、1981-1999、1983-2001、1985-2003、1993-2011、1997-2015、1999-2017、2014-2032、2019-2037、2022-2040、2026-2044、2142-2160、2149-2167、2154-2172、2280-2298、2292-2310、2294-2312、2295-2313、2303-2321、2323-2341、2325-2343、2328-2346、2357-2375、2362-2380、2367-2385、2372-2390、2373-2391、2375-2393、2379-2397、2380-2398、2397-2415、2405-2423、2407-2425、2414-2432、2419-2437、2438-2456、2441-2459、2450-2468、2451-2469、2452-2470、2456-2474、2457-2475、2459-2477、2474-2492、2476-2494、2477-2495、2487-2505、2495-2513、2506-2524、2509-2527、2516-2534、2517-2535、2518-2536、2524-2542、2526-2544、2527-2545、2528-2546、2532-2550、2533-2551、2537-2555、2542-2560、2544-2562、2545-2563、2546-2564、2553-2571、2554-2572、2555-2573、2567-2585、2568-2586、2569-2587、2571-2589、2575-2593、2604-2622、2613-2631、2617-2635、2620-2638、2626-2644、2629-2647、2631-2649、2638-2656、2640-2658、2641-2659、2643-2661、2650-2668、2654-2672、2661-2679、2664-2682、2666-2684, 2671-2689, 2673-2691, 2677-2695, 2686-2704, 2690-2708, 2693-2711, 2695-2713, 2696-2714, 2698-2716, 2699-2717, 2700-2718, 2711-2729, 2734-2752, 2736-2754, 2740-2758, 2741-2759, 2742-2760, 2747-276 5. 2761-2779, 2763-2781, 2790-2808, 2822-2840, 2823-2841, 2843-2861, 2844-2862, 2849-2867, 2850-2868, 2852-2870, 2853-2871, 2856-2874, 2857-2875, 2860-2878, 2861-2879, 2862-2880, 2863-2881, 2864-2882, 2865-2 883, 3124-3142, 3126-3144, 3129-3147, 3130-3148, 3131-3149, 3135-3153, 3136-3154, 3138-3156, 3141-3159, 3143-3161, 3144-3162, 3172-3190, 3173-3191, 3174-3192, 3175-3193, 3178-3196, 3179-3197, 3180-3198, 3181 The complementary sequences of any one of the nucleotide sequences -3199, 3182-3200, 3184-3202, 3185-3203, 3186-3204, 3187-3205, 3205-3223, 3206-3224, 3208-3226, 3211-3229, 3212-3230, 3216-3234, 3217-3235, 3220-3238, 3222-3240, 3223-3241, or 3225-3243 must be at least 15, 16, 17, 18, 19, or 20 consecutive nucleotides differing by no more than 0, 1, 2, or 3 nucleotides.
4. The dsRNA agent according to any one of claims 1-3, wherein the antisense strand comprises a region of at least 15, 16, 17, 18, or 19 consecutive nucleotides complementary to the mRNA encoding SCN9A and differing from any antisense sequence listed in any one of Tables 1-3 by no more than 1, 2, or 3 nucleotides.
5. The dsRNA agent according to any one of claims 1-3, wherein the antisense strand comprises a region of at least 15, 16, 17, 18 or 19 consecutive nucleotides complementary to the mRNA encoding SCN9A and comprising any one of the antisense sequences listed in any one of Tables 1-3.
6. The dsRNA agent according to any one of claims 1-5, wherein the antisense strand of the dsRNA is substantially or completely complementary to any target region of SEQ ID NO: 1, and preferably the dsRNA agent comprises any one of the antisense strand sequences described in Tables 1-3.
7. The dsRNA agent according to any one of claims 1-6, wherein the sense strand sequence is at least substantially complementary or completely complementary to the antisense strand sequence in the dsRNA agent, preferably, wherein the dsRNA agent comprises any one of the sense strand sequences in Tables 1-3.
8. The dsRNA agent according to any one of claims 1-7, wherein the dsRNA agent comprises a sequence listed in double-stranded sequences in any one of Tables 1-3.
9. The dsRNA agent according to any one of claims 1-8, wherein the dsRNA agent comprises at least one modified nucleotide.
10. The dsRNA agent according to any one of claims 1-9, wherein all or substantially all nucleotides of the sense strand and / or antisense strand are modified nucleotides.
11. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of sodium voltage-gated channel α subunit 9 (SCN9A), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region partially complementary to mRNA encoding SCN9A, wherein each strand is about 15 to about 30 nucleotides in length, wherein the sequence of the sense strand is represented by formula (I): 5′-(N′ L ) n′ N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ L N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ (I) in: Each N′ F Nucleotides representing 2'-fluorine modifications; each N' N1 、N′ N2 、N′ N3 、N′ N4 、N′ N5 and N′ N6 Independently representing modified or unmodified nucleotides; each N′ L Each nucleotide can be used independently to represent a modified or unmodified nucleotide, but not a nucleotide with 2'-fluorine modification; m′ and n′ are each an independent integer from 0 to 7.
12. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of sodium voltage-gated channel α subunit 9 (SCN9A), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region partially complementary to mRNA encoding SCN9A, wherein each strand is about 18 to about 30 nucleotides in length, wherein the antisense strand sequence is represented by formula (II): 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′ (II) in: Each N F Represents a 2'-fluorinated nucleotide; each N M1 N M2 N M3 N M4 N M5 N M6 N M7 and N M8 Independently represents a modified or unmodified nucleotide; N L and N Z Each can independently represent a modified or unmodified nucleotide, but not a 2'-fluorinated nucleotide. Optionally, N Z This indicates a 5' terminal nucleotide containing a phosphate ester mimic, preferably N. Z It is a vinylphosphonate-modified nucleotide, more preferably, N Z It is a Vpu It has the following structure: , or, optionally, N Z It is any one selected from the following groups: , , , , , , , and , or its stereoisomers or racemates; n is an integer from 0 to 7.
13. A double-stranded RNA (dsRNA) agent for inhibiting the expression of sodium voltage-gated channel α subunit 9 (SCN9A), wherein the dsRNA agent comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a dsRNA duplex, wherein the sense strand is complementary to the antisense strand, wherein the antisense strand contains a region complementary to mRNA encoding SCN9A, wherein the complementary region contains at least 15 consecutive nucleotides, wherein the dsRNA duplex is represented by formula (III): Sense strand: 5′-(N′ L ) n′ N′ L N′ L N′ N1 N′ N2 N′ N3 N′ N4 N′ L N′ F N′ L N′ N5 N′ N6 N′ L N′ L N′ L (N′ L ) m′ -3′ Antisense strand: 3′-(N L ) n N M1 N L N M2 N L N F N L N M3 N L N M4 N L N M5 N M6 N L N M7 N M8 N L N F N Z -5′ (III) in: Each chain is independently approximately 17 to approximately 30 nucleotides in length; each N F and N′ F Independently represents a nucleotide with 2′-fluorine modification; N M1 N M2 N M3 N M4 N M5 N M6 N M7 N M8 、N′ N1 、N′ N2 、N′ N3 、N′ N4 、N′ N5 and N′ N6 Each N represents a modified or unmodified nucleotide independently; z N L and N′ L Independently represents a modified or unmodified nucleotide, but not a nucleotide with 2'-fluorine modification; optionally, N Z This indicates a 5' terminal nucleotide containing a phosphate ester mimic, preferably N. Z It is a vinylphosphonate-modified nucleotide, more preferably, N Z It is a Vpu It has the following structure: Alternatively, N Z It is any one selected from the following groups: , , , , , , , and , or its stereoisomers or racemates; m′, n′ and n are each independent integers from 0 to 7.
14. The dsRNA agent according to any one of claims 1-13, wherein the one or more modified nucleotides are independently selected from the group consisting of: 2'-O-methyl nucleotides, 2'-fluoronucleotides, 2'-deoxynucleotides, 2'3'-seco nucleotide mimics, locked nucleotides, open-ring nucleic acid nucleotides (UNA), glycol nucleic acid nucleotides (GNA), 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abase-free nucleotides, ribitol, reverse nucleotides, reverse abase-free nucleotides, isomannitol nucleotides, reverse 2'-OMe nucleotides, reverse 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholinonucleotides, 3'-OMe nucleotides, modified nucleotides modified with 5'-phosphonates or 5'-phosphate mimics, nucleotides containing a 5'-thiophosphate group, terminal nucleotides linked to a cholesterol derivative or a dodecanoic acid bis(decyl)amide group, 2'-amino-modified nucleotides, phosphamide esters, or nucleotides containing non-natural bases.
15. The dsRNA agent according to any one of claims 1-14, wherein at the 5th strand of the guide strand... - The terminal contains an E-vinylphosphonate nucleotide, or at the 5' end of the antisense strand. - The terminal contains a 5'-phosphate mimic nucleotide represented by formula (VIII) or a stereoisomer or racemate thereof: Formula (VIII) in: Q8 is O, S, SO, SO2, PR 16 R 17 or NR 11 ;R 16 and R 17 Independently, it can be (=O), (=S), OH, SH, C1-C6 alkyl, or NR. 18 R 19 Ra and Rc are each independently selected from hydroxyl or protected hydroxyl, mercapto or protected mercapto, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, protected or optionally substituted amino, native or modified nucleosides; and R b For O, S, or NR 12 R 12 It is hydrogen, C1-C6 alkyl, or amino protecting group; Q1 and Q2 are each independently H, halogen, -CN, or optionally substituted C1-C6 alkyl; The substituents in the substituted amino group are selected from: optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, sulfinyl, sulfonyl, acetyl; R 11 R 18 and R 19 Independently, it is H, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 alkoxy, methanesulfonyl, and sulfonic acid groups; Z is a nucleoside containing a sugar or a sugar-substituted portion; T3 is an internucleotide linker that connects the 5'-terminal nucleotide of formula (VIII) or its stereoisomer to the guide strand 5'. Connect the remaining parts at one end; Each substituent group contains one or more substituents optionally and independently selected from the following: halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkyl mercapto, CN.
16. The dsRNA agent according to any one of claims 1-15, wherein the dsRNA agent comprises at least one phosphate thionucleotide internucleotide bond.
17. The dsRNA agent according to any one of claims 1-15, wherein the sense strand comprises at least one phosphate thionucleotide internucleotide bond.
18. The dsRNA agent according to any one of claims 1-15, wherein the antisense strand comprises at least one phosphate thionucleotide internucleotide bond.
19. The dsRNA agent according to any one of claims 1-15, wherein the sense strand comprises 1, 2, 3, 4, 5 or 6 phosphate thioester nucleoside bonds.
20. The dsRNA agent according to any one of claims 1-15, wherein the antisense strand comprises 1, 2, 3, 4, 5 or 6 phosphate thioester nucleoside bonds.
21. The dsRNA agent according to any one of claims 1-20, wherein the modified sense strand is a modified sense strand sequence shown in any one of Tables 2-3.
22. The dsRNA agent according to any one of claims 1-20, wherein the modified antisense strand is a modified antisense strand sequence shown in one of Tables 2-3.
23. The dsRNA agent according to any one of claims 1-22, wherein the sense strand is complementary or substantially complementary to the antisense strand, and the length of the complementary region is between 16 and 23 nucleotides.
24. The dsRNA agent according to any one of claims 1-23, wherein the length of the complementary region is 19-21 nucleotides.
25. The dsRNA agent according to any one of claims 1-24, wherein the length of each strand does not exceed 30 nucleotides.
26. The dsRNA agent according to any one of claims 1-24, wherein the length of each strand does not exceed 25 nucleotides.
27. The dsRNA agent according to any one of claims 1-24, wherein the length of each strand does not exceed 23 nucleotides.
28. The dsRNA agent according to any one of claims 1-27, wherein the dsRNA agent comprises at least one modified nucleotide and further comprises one or more targeting groups or linking groups.
29. The dsRNA agent of claim 28, wherein one or more targeting groups or linking groups are conjugated to a sense strand.
30. The dsRNA agent according to claim 28 or 29, wherein the targeting group or linking group comprises N-acetylgalactosamine (GalNAc).
31. The dsRNA agent according to claim 28 or 29, wherein the targeting group has the following structure: 。 32. The dsRNA agent according to any one of claims 1-31, wherein the dsRNA agent comprises a targeting group conjugated to the 5'-end of the sense strand.
33. The dsRNA agent according to any one of claims 1-31, wherein the dsRNA agent comprises a targeting group conjugated to the 3'-end of the sense strand.
34. The dsRNA agent according to any one of claims 1-31, wherein the antisense strand comprises a reverse abase-free residue at its 3' end.
35. The dsRNA agent according to any one of claims 1-31, wherein the sense strand comprises one or two reverse abase-free residues or imann residues at the 3' and / or 5' ends.
36. The dsRNA agent according to any one of claims 1-35, wherein the dsRNA agent has two blunt ends.
37. The dsRNA agent according to any one of claims 1-35, wherein at least one strand comprises a 3' overhang of at least one nucleotide.
38. The dsRNA agent according to any one of claims 1-35, wherein at least one strand comprises a 3' overhang of at least two nucleotides.
39. A composition comprising the dsRNA agent of any one of claims 1-38.
40. The composition of claim 39, further comprising a pharmaceutically acceptable carrier.
41. The composition of claim 40, further comprising one or more additional therapeutic agents.
42. The composition of claim 41, wherein the composition is packaged in a kit, container, package, dispenser, pre-filled syringe, or vial.
43. The composition according to any one of claims 39-42, wherein the composition is formulated for subcutaneous administration, for intrathecal administration, or for intravenous (IV) administration.
44. A cell comprising the dsRNA agent of any one of claims 1-38, wherein the cell is optionally a mammalian cell, optionally a human cell, optionally a neuron.
45. A method for inhibiting SCN9A gene expression in cells, the method comprising: (i) Preparing cells containing an effective amount of the double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-38 or the composition of any one of claims 39-43.
46. The method of claim 45, further comprising: (ii) Maintain the cells prepared in claim 45(i) for a sufficient time to allow for the degradation of the mRNA transcript of the SCN9A gene, thereby inhibiting the expression of the SCN9A gene in the cells.
47. The method according to any one of claims 45-46, wherein the cells are located in the subject and the dsRNA agent is administered subcutaneously to the subject.
48. The method according to any one of claims 45-46, wherein the cells are located in the subject's body, and the dsRNA agent is administered to the subject via intrathecal, intracranial, intraventricular, or intracerebral administration.
49. The method according to any one of claims 45-46, wherein the cells are located in the subject and the dsRNA agent is administered to the subject via intravenous administration.
50. The method according to any one of claims 47-49, further comprising evaluating inhibition of the SCN9A gene after administration of the dsRNA agent to a subject, wherein the evaluation method comprises: (i) Identify one or more physiological characteristics of the subject’s SCN9A-related disease or condition, and (ii) Compare the identified physiological characteristics with baseline physiological characteristics of SCN9A-related diseases or conditions before treatment and / or control physiological characteristics of SCN9A-related diseases or conditions; The comparisons described therein indicate one or more instances of the presence or absence of SCN9A gene expression inhibition in the subjects.
51. The method of claim 50, wherein the determined physiological characteristic is one or more of the following: the level of SCN9Am RNA, SCN9A protein, and another parameter functionally associated with the subject's SCN9A expression level.
52. The method of claim 51, wherein a decrease in one or more of the levels of the subject's SCN9A mRNA, SCN9A protein, and another parameter functionally related to the SCN9A expression level indicates a decrease in the subject's SCN9A gene expression.
53. A method for inhibiting SCN9A gene expression in a subject, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-38 or a composition of any one of claims 39-43.
54. The method of claim 53, wherein the dsRNA agent is administered subcutaneously to the subject.
55. The method of claim 53, wherein the dsRNA agent is administered to the subject via intrathecal, intracranial, intraventricular, or intracerebral administration.
56. The method of claim 53, wherein the dsRNA agent is administered to the subject via IV.
57. The method according to any one of claims 54-56, further comprising evaluating the inhibition of the SCN9A gene after administration of the dsRNA agent, wherein the evaluation method comprises: (i) Identify one or more physiological characteristics of the subject’s SCN9A-related disease or condition, and (ii) Compare the identified physiological characteristics with baseline physiological characteristics of SCN9A-related diseases or conditions before treatment and / or control physiological characteristics of SCN9A-related diseases or conditions; The comparisons indicated the presence or absence of one or more inhibitions of SCN9A gene expression in the subjects.
58. The method of claim 57, wherein the determined physiological characteristic is one or more of the following: the level of SCN9A RNA, SCN9A protein, or another parameter functionally associated with the expression level of SCN9A.
59. The method of claim 58, wherein a decrease in one or more of the levels of the subject's SCN9A mRNA, SCN9A protein, or another parameter functionally related to the SCN9A expression level indicates a decrease in the subject's SCN9A gene expression.
60. A method for treating a disease or condition associated with the presence of SCN9A protein, the method comprising administering to a subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent of any one of claims 1-38 or a composition of any one of claims 39-43 to inhibit SCN9A gene expression.
61. The method of claim 60, wherein the disease or condition is pain or pain disorder.
62. The method according to claim 61, wherein the pain is acute pain or chronic pain, preferably, the pain is inflammatory pain, neuropathic pain, nociceptive pain, postoperative pain, spontaneous pain, or persistent pain.
63. The method of claim 61, wherein the pain disorder is Gerhardt's disease, Mitchell's disease, Weir-Mitchell's disease, erythromelalgia, paroxysmal extreme pain disorder (PEPD), small fiber neuropathy (SFN), trigeminal neuralgia (TN), and pain associated with cancer, arthritis, diabetes, trauma, or viral infection.
64. The method according to any one of claims 60-63, further comprising administering an additional treatment regimen to the subject.
65. The method of claim 64, wherein the additional treatment option comprises: The subject is given one or more SCN9A antisense polynucleotides of the present invention, given a non-SCN9A dsRNA therapeutic agent, and subjected to behavioral modifications.
66. The method of claim 65, wherein the additional treatment is one or more of the following: a nonsteroidal anti-inflammatory drug (NSAID), acetaminophen, an opioid or corticosteroid, acupuncture, therapeutic massage, dorsal root ganglion stimulation, spinal cord stimulation or a local analgesic, or any combination thereof.
67. The method according to any one of claims 60-66, wherein the dsRNA agent is administered to the subject subcutaneously.
68. The method according to any one of claims 60-66, wherein the dsRNA agent is administered to the subject intrathecally, intracranially, intraventricularly, or intracerebrally.
69. The method according to any one of claims 60-66, wherein the dsRNA agent is administered to the subject via intravenous administration.
70. The method according to any one of claims 60-66, further comprising determining the efficacy of the administered double-stranded ribonucleic acid (dsRNA) agent in a subject.
71. The method of claim 70, wherein the method for determining the efficacy of the treatment on the subject comprises: (i) Identify one or more physiological characteristics of the subject’s SCN9A-related disease or condition, and (ii) Compare the identified physiological characteristics with the baseline physiological characteristics of SCN9A-related diseases or conditions before treatment; The comparisons described therein indicate the presence, absence, and level of efficacy of administering double-stranded RNA (dsRNA) agents to the subjects.
72. The method of claim 71, wherein the determined physiological characteristics are: the levels of SCN9A mRNA, SCN9A protein, and another parameter functionally associated with the expression level of SCN9A.
73. The method of claim 71, wherein a decrease in the levels of one or more of the SCN9A mRNA, SCN9A protein, and another parameter functionally related to the expression level of SCN9A indicates efficacy of administration of the double-stranded ribonucleic acid (dsRNA) agent to the subject.
74. A method for reducing the level of SCN9A protein in a subject, the method comprising, compared with a pre-treatment baseline level of SCN9A protein in the subject, administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-38 or a composition according to any one of claims 39-43, to reduce the level of SCN9A gene expression.
75. The method of claim 74, wherein the dsRNA agent is administered to the subject subcutaneously, intracranially, intrathecally, intraventricularly, or intracerebrally, or intravenously.
76. A method for altering the physiological characteristics of a subject with an SCN9A-related disease or condition, compared with the subject's baseline physiological characteristics of the subject before treatment for the SCN9A-related disease or condition, the method comprising administering to the subject an effective amount of a double-stranded ribonucleic acid (dsRNA) agent according to any one of claims 1-38 or a composition according to any one of claims 39-43 to alter the physiological characteristics of the subject with the SCN9A-related disease or condition.
77. The method of claim 76, wherein the dsRNA agent is administered to the subject subcutaneously, intrathecally, intraventricularly, intracerebrally, or intravenously.
78. The method according to any one of claims 76-77, wherein the physiological characteristic is one or more of the following: the level of SCN9A mRNA, the level of SCN9A protein, and the level of another parameter functionally associated with the expression level of SCN9A.
Citation Information
Patent Citations
Modified nucleosides and oligomeric compounds prepared therefrom
CN103154014A
4'-phosphate analogs and oligonucleotides comprising the same
CN110072530A
Drug delivery product and methods
US20050281781A1
Drug-delivery system
US3854480A
Seal-lock
US426220A