A monascus strain with stronger stress resistance and high esterification enzyme yield and application thereof

By utilizing the highly resistant Monascus purpureus strain ZH01 and esterified Monascus purpureus, the problem of decreased esterase activity in Monascus purpureus under organic acid and ethanol environments was solved, enabling esterification in the fermentation of baijiu and vinegar, thus improving product flavor and brewing quality.

CN122278641APending Publication Date: 2026-06-26HUBEI UNIV OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610435743.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-03
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Monascus purpureus is easily inhibited during fermentation processes involving the accumulation of organic acids and ethanol, leading to a decrease in esterase activity and affecting the formation and accumulation of esters. This is especially true in the fermentation of baijiu and vinegar, where the bacteria exhibit insufficient acid and ethanol tolerance.

Method used

A Monascus ruber strain with strong stress resistance and high esterase production was developed, and esterified red yeast rice was prepared by fermenting a mixed culture medium of grains and bran for use in wine and vinegar brewing.

Benefits of technology

It maintains high activity in pH 3 and 25% ethanol environments, significantly improves esterase activity, enhances ester formation, improves the flavor of fermented products, and has a short production cycle and low cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122278641A_ABST
    Figure CN122278641A_ABST
Patent Text Reader

Abstract

This invention relates to the field of microbial fermentation technology, specifically to a Monascus purpureus strain with strong stress resistance and high esterase production, and its applications. The Monascus purpureus strain is *Monascus purpureus* (…). Monascus ruber ZH01, deposited on October 20, 2025, at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC NO:M 20252263. This *Monascus purpureus* strain exhibits strong resistance to adverse conditions and can grow normally in an environment with pH 3 and 25% ethanol. Its fermentation products, after being dried at 50°C for 24 hours, still maintain a higher survival rate compared to the control. Furthermore, it can produce high levels of esterifying enzymes in mixed culture media, with an esterification power of 165.8 mg / g·100h. During the fermentation of baijiu and vinegar, esterification generates lipids, enhancing the flavor of the beverages. The production of esterified red yeast rice using *Monascus purpureus* ZH01 of this invention has advantages such as short production cycle, low cost, and high esterification power.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation technology, specifically to a Monascus purpureus strain with strong stress resistance and high esterase production and its applications. Background Technology

[0002] Monascus purpureus ( Monascus spp. Monascus purpureus is a fungus used in both food and medicine, and is one of the most important industrial fermentation microorganisms. Its application in my country has a history of thousands of years, commonly used in food fermentation and traditional medicine. Its metabolites, such as Monacolin K and Monascus red pigment, have wide applications. It can also produce various enzyme systems, including saccharifying enzymes, esterifying enzymes, and proteases, which play important roles in fermented foods. Among these, esterifying enzymes catalyze the esterification of organic acids and ethanol produced during the fermentation of alcoholic beverages, forming various aroma esters such as ethyl acetate and ethyl hexanoate, thus harmonizing the aroma and flavor of the beverage.

[0003] However, in actual fermentation, as organic acids and ethanol accumulate, the culture environment gradually deteriorates, inhibiting cell growth and reducing esterase activity, thus affecting the formation and accumulation of esters. Especially in the later stages of baijiu fermentation, the system often exhibits low pH and high ethanol concentrations, limiting the sustained activity of Monascus purpureus. Similarly, in acidic fermentation systems such as vinegar, high acidity is also detrimental to cell survival and esterification. Therefore, improving the acid and ethanol tolerance of the strains is beneficial for maintaining high activity in baijiu and vinegar fermentation systems, enabling continuous esterification reactions, promoting the formation of aroma-enhancing esters, and ultimately improving the flavor and brewing quality of the fermented products.

[0004] In view of the above-mentioned problems, the present invention provides a Monascus strain with strong stress resistance and high esterase production and its application. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a Monascus purpureus strain with strong stress resistance and high esterase production and its application.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: Firstly, a Monascus purpureus strain with strong stress resistance and high esterase production, wherein the Monascus purpureus strain is Monascus purpureus (… Monascus ruber ZH01 was deposited at the China Center for Type Culture Collection on October 20, 2025, with accession number CCTCC NO:M 20252263.

[0007] Based on the above technical solution, the present invention can be further improved as follows.

[0008] Secondly, a microbial agent comprising the aforementioned Monascus purpureus strain with strong stress resistance and high esterase production.

[0009] The inoculant may contain other bacteria, such as Clostridium hexanoate, Rhizopus, and Aspergillus acidophilus.

[0010] Furthermore, the viable count of the Monascus purpureus strain with strong stress resistance and high esterase production in the bacterial agent is 1×10⁻⁶. 4 CFU / g ~ 1×10 6 CFU / g.

[0011] Thirdly, an esterified red yeast rice, wherein the esterified red yeast rice is obtained by fermentation using a red yeast rice strain that is highly resistant to stress and produces a high amount of esterifying enzyme.

[0012] Fourthly, a method for preparing esterified red yeast rice includes the following steps: inoculating a seed liquid of a Monascus purpureus strain with strong stress resistance and high esterification enzyme production onto a mixed culture medium, and fermenting it to produce esterified red yeast rice. The mixed culture medium includes grains and bran.

[0013] Furthermore, the mass ratio of the grain to the bran is 5~15:85~95, preferably 10:90; The grains include at least one of rice, corn, and soybeans.

[0014] Specifically, the mixed culture medium is prepared by mixing grains and bran at a mass ratio of 5~15:85~95, adding 70%~90% water by mass, mixing well, and then sterilizing at high temperature.

[0015] Furthermore, the seed culture comprises 5% to 15% of the mass of the mixed culture medium; preferably 10%.

[0016] Furthermore, the fermentation parameters were: culture temperature 30±3℃, culture time 3~4 days.

[0017] Fifthly, the Red Monascus strain with strong stress resistance and high esterase production, or the inoculant, or the application of the esterified Red Monascus in winemaking.

[0018] Among them, the ethyl acetate content of esterified red yeast rice in the simulated liquid fermentation of rice-aroma wine was significantly higher than that of the blank control; the ethyl acetate content of the added esterified red yeast rice was 5.81 mg / 100 mL, compared with the ethyl acetate content of 4.6 mg / 100 mL in the blank control, which increased the ethyl acetate content by 26.3%.

[0019] Furthermore, the wine includes at least one of yellow wine, rice wine, red yeast rice wine, and white wine.

[0020] Sixthly, the application of the highly resistant Monascus purpureus strain with high esterase production, the inoculant, or the esterified Monascus purpureus in vinegar brewing.

[0021] The application of esterified red yeast rice in vinegar brewing showed that the timing of its addition significantly affects product quality. When esterified red yeast rice ZH01 was added during the acetic acid fermentation stage, the total ester content of vinegar increased to 112.1% of the control group, but the amino acid nitrogen content decreased to 80.2% of the control group. When esterified red yeast rice ZH01 was added after acetic acid fermentation, its esterification effect was more significant, with the total ester content increasing by 29.3% compared to the fermentation control group, while the amino acid nitrogen content increased by 20.0%.

[0022] The vinegar brewing process mainly refers to enhancing the aroma of vinegar and / or accelerating its aging.

[0023] The beneficial effects of this invention are: The Monascus purpureus strain of this invention exhibits strong resistance and can grow normally in an environment with pH 3 and 25% ethanol. After its fermentation products are dried at 50°C for 24 hours, they still maintain a high survival rate compared to the control. Furthermore, it can produce high levels of esterifying enzymes in mixed culture media, with an esterification power of 165.8 mg / g·100h. During the fermentation of baijiu and vinegar, esterification generates lipids, enhancing the flavor of the drinks. Moreover, the production of esterified red yeast rice using Monascus purpureus ZH01 of this invention has the advantages of short production cycle, low cost, and high esterification power. Attached Figure Description

[0024] Figure 1 This is a diagram showing the pH and ethanol tolerance of Monascus purpureus ZH01 in this invention; where (a) is pH and (b) is ethanol. Figure 2 This is the phylogenetic tree of Monascus purpureus ZH01 in this invention; Figure 3 This is a diagram of the fermentation product of esterified red yeast rice ZH01 in this invention. Detailed Implementation

[0025] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they should be performed according to the techniques or conditions described in the literature in this field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0026] Example 1: Isolation and identification of Monascus purpureus.

[0027] (1) Isolation of Monascus purpureus: Sample: High-temperature yeast, using yeast from a certain winery for brewing soy sauce-flavored baijiu to isolate strains, ensuring strain safety.

[0028] Prepare lactic acid-PDA solid medium by adding lactic acid to the PDA solid medium until the pH reaches 4.

[0029] The high-temperature yeast was crushed in a mortar and pestle, and 1 g was weighed and placed in sterilized 0.9% physiological saline. It was then incubated at 30℃ for 4 hours to obtain an initial concentration of 10. -1 The sample solution was diluted with 0.9% physiological saline to 10... -1 The samples were serially diluted to prepare 10... -2 10 -3 10 -4 10 -5 Diluted solutions were prepared, and 0.5 mL of each gradient sample solution was spread onto lactic acid-PDA medium and incubated at 30°C for 3 days. The medium consisted of 20 g potato, 2 g glucose, 2 g agar, and 100 mL water, with the pH adjusted to 4 using lactic acid.

[0030] In the above culture medium, single colonies were selected according to colony morphology, color and size and streaked onto PDA plates for isolation. The process was repeated multiple times to obtain pure bacteria, which were denoted as ZH01.

[0031] (2) Sequencing and identification of Monascus purpureus ITS strains: The activated slant culture was submitted to Sangon Biotech (Shanghai) Co., Ltd. for ITS sequencing. The sequencing results were then subjected to BLAST homology searching at the National Center for Biotechnology Information (NCBI) in the United States. The ITS comparison results are as follows: Figure 2 The image shows Monascus purpureus (M. purpureus) Monascus rubber ).

[0032] The ITS sequence (SEQ ID NO:1) of the strain is as follows: CCCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCCGGGGCCCGCCGGAGACATCTTCTCGAACGCTTCTTTGAAAAGGATTGCTGTCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCG GGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCCCGTCCCCTGCGCCTCCGGGCAAGGGGGACGGGCCCGAAAGGCAGTGGCCGGCGCCGCGTCCGGTC CTCGAGCGTATGGGGCTTTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC.

[0033] The newly isolated strain (ZH01) was deposited on October 20, 2025, at the China Center for Type Culture Collection (Wuhan University Collection Center), located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, with accession number CCTCC NO: M 20252263 and deposit date of October 20, 2025. It was named *Monascus purpureus*. Monascus ruber ZH01.

[0034] Example 2: Activation of Monascus purpureus and preparation of seed culture.

[0035] (1) Activation of Monascus purpureus strains: Monascus purpureus ZH01 was inoculated onto an agar slant and cultured at 30°C for 4 days, activating the culture for three generations. The agar slant consisted of the following components by weight: glucose 6%, peptone 2%, soluble starch 3%, and agar 3%. (2) Preparation of liquid seed solution: The slant from step (1) was inoculated onto the liquid seed culture and cultured at 180 rpm and 30°C for 2-3 days to obtain the liquid seed culture. The liquid seed culture medium contains the following components by weight: glucose 6%, peptone 1.5%, NaNO3 0.2%, KH2PO4 0.1%, and MgSO4·7H2O 0.1%.

[0036] Example 3: Verification of the acid and ethanol resistance of Monascus purpureus through culture.

[0037] (1) Verification of acid resistance of Monascus purpureus through culture: Liquid culture media with different pH conditions (pH=2, 3, 4, 5, 6) were prepared. The liquid culture media consisted of the following components in weight: glucose 6%, peptone 1.5%, NaNO3 0.2%, KH2PO4 0.1%, and MgSO4·7H2O 0.1%.

[0038] The above-cultured liquid seed culture was inoculated into liquid culture media with different pH conditions and cultured at 180 rpm and 30℃ for 4 days. The bacterial cells were then obtained by filtration and weighed. The results are as follows: Figure 1 As shown in (a), Monascus purpureus ZH01 can still grow normally under pH 3 conditions.

[0039] (2) Verification of Monascus purpureus's tolerance to ethanol culture: Prepare an ethanol-PDA solid culture medium by adding ethanol to the PDA solid culture medium to volume fractions of 0%, 5%, 10%, 15%, 20%, and 25%.

[0040] The activated bacterial strains were spotted onto ethanol-PDA solid medium and cultured for 7 days. The colony diameter was then measured. Results are as follows: Figure 1 As shown in (b), Monascus purpureus ZH01 can still grow normally under the condition of 25% ethanol by volume.

[0041] (3) Verification of the survival rate of fermentation products after drying: The activity of the esterified red yeast rice was tested according to the "GB 4789.15-2016 National Food Safety Standard for Microbiological Examination of Food: Count of Molds and Yeasts". After treatment at 50℃ for 24 hours, the survival rate still remained at 20%-40%, as detailed in Table 1.

[0042] Table 1. Survival rate determination results Example 4: Preparation and application of esterified red yeast rice ZH01.

[0043] (1) Preparation of esterified red yeast rice ZH01: The above-mentioned liquid seed culture was inoculated into a solid fermentation medium, with a total weight of 50g of solid medium added. The mixture was incubated at 30℃ for 3 days, with the medium being turned over once on the second day. The fermentation product was dried at 50℃ for 24 hours, then pulverized and sieved. The solid medium formula was as follows: rice, corn, soybeans, and wheat bran were mixed at a mass ratio of 10:90, and 80% water was added. After mixing thoroughly, the mixture was sterilized at high temperature to obtain esterified red yeast rice ZH01 (…). Figure 3The viable count was tested according to GB 4789.15-2016 National Food Safety Standard for Microbiological Examination of Food - Counting of Molds and Yeasts, and the viable count should reach 1×10⁻⁶. 4 CFU / g ~ 1×10 6 CFU / g.

[0044] (2) Detection of esterification power of esterified red yeast rice ZH01: The esterification power of the above-mentioned esterified red yeast rice ZH01 was tested in accordance with the People's Republic of China Light Industry Standard QB / T 5188-2017 Brewing Red Yeast Rice. The test results are shown in Table 2 below, with the highest esterification power reaching 165.77 mg / g·100h.

[0045] Table 2 Results of Esterification Power Measurement of Esterified Red Monascus (2) Application of liquid fermentation in rice-aroma wine: Rice aroma type liquid fermentation process: Soak glutinous rice for 30 minutes, steam and then add α-amylase (addition amount is 5 U / g) and enzymatically hydrolyze at 70℃ for 3 hours. Spread the enzymatically hydrolyzed glutinous rice to cool to 30℃, mix in 1% Angel wheat koji and 1% esterified red yeast rice ZH01. The control is to add 2% wheat koji. Sprinkle the koji in two batches, mix well and then cultivate and saccharify at 30℃ in a constant temperature incubator for 24 hours. Add water with a total mass of 1.5 times the raw material and ferment at 30℃ for 5 days.

[0046] The contents of several major flavor compounds in the fermentation products were determined by gas chromatography. The results are shown in Table 3 below. The ethyl acetate content of the prepared esterified red yeast rice in the liquid fermentation of rice-aroma wine was significantly higher than that of the un-esterified red yeast rice ZH01. Specifically, the ethyl acetate content of the product with added esterified red yeast rice ZH01 was 5.81 mg / 100mL, compared with the ethyl acetate content of 4.6 mg / 100mL in the product without added esterified red yeast rice ZH01, representing an increase of 26.3%.

[0047] Table 3 Results of flavor compounds determination in wine samples (2) Application in vinegar brewing: Adding red yeast rice during the acetic acid fermentation stage did not significantly alter the total acid and non-volatile acid content compared to the control group, but the amino acid nitrogen content was lower (80.2% of the control group), while the total ester content was higher (112.1% of the control group). In contrast, adding red yeast rice after the acetic acid fermentation stage reduced both total acid and non-volatile acid content, but significantly increased amino acid nitrogen and total ester content, by 20.0% and 29.3% respectively compared to the fermentation control group, and even greater compared to the frozen control group, reaching 50.7% and 56.1% respectively. The addition of red yeast rice effectively increased the total ester content of vinegar, indicating that red yeast rice esterase played a highly efficient esterification role during fermentation.

[0048] Table 4 Physicochemical properties of vinegar In summary, the Monascus purpureus strain of the present invention exhibits strong resistance and growth capacity, and can grow normally in an environment with pH 3 and 25% ethanol. Furthermore, it can produce high levels of esterifying enzymes in mixed culture media, with an esterification power of 165.8 mg / g·100h. During the fermentation of baijiu and vinegar, it generates lipids through esterification, enhancing flavor. Moreover, the production of esterified red yeast rice using the Monascus purpureus ZH01 of the present invention has advantages such as short production cycle, low cost, and high esterification power.

[0049] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A Monascus purpureus strain with strong stress resistance and high esterase production, characterized in that, The Monascus strain is Monascus purpureus (Monascus purpureus) Monascus ruber ZH01 was deposited at the China Center for Type Culture Collection on October 20, 2025, with accession number CCTCC NO:M 20252263.

2. A microbial agent, characterized in that, The microbial agent includes the Monascus purpureus strain with strong stress resistance and high esterase production as described in claim 1.

3. The bacterial agent according to claim 2, characterized in that, The viable count of the Monascus purpureus strain with strong stress resistance and high esterase production in the microbial agent is 1×10⁻⁶. 4 CFU / g ~ 1×10 6 CFU / g.

4. An esterified red yeast rice, characterized in that, The esterified red yeast rice is obtained by fermentation using the Monascus strain with strong stress resistance and high esterase production as described in claim 1.

5. A method for preparing esterified red yeast rice according to claim 4, characterized in that, The process includes the following steps: seed culture of a Monascus purpureus strain with strong stress resistance and high esterase production is inoculated onto a mixed culture medium and fermented to produce esterified Monascus purpureus; The mixed culture medium includes grains and bran.

6. The method for preparing esterified red yeast rice according to claim 5, characterized in that, The mass ratio of the grain to the bran is 5~15:85~95; The grains include at least one of rice, corn, and soybeans.

7. The method for preparing esterified red yeast rice according to claim 5, characterized in that, The seed solution accounts for 5% to 15% of the mass of the mixed culture medium.

8. The method for preparing esterified red yeast rice according to claim 5, characterized in that, The fermentation parameters are: culture temperature 30±3℃, culture time 3~4 days.

9. The Monascus purpureus strain with strong stress resistance and high esterase production as described in claim 1, or the inoculum agent as described in any one of claims 2 to 3, or the application of the esterified Monascus purpureus as described in any one of claims 4 to 5 in winemaking.

10. The Monascus purpureus strain with strong stress resistance and high esterase production as described in claim 1, or the inoculum agent as described in any one of claims 2 to 3, or the application of the esterified Monascus purpureus as described in any one of claims 4 to 5 in vinegar brewing.