Genetically engineered bacteria and method for enhancing denitrification efficiency of anaerobic ammonia oxidation process at low temperature

Abstract

This invention discloses a genetically engineered bacterium and method for enhancing the denitrification efficiency of anaerobic ammonia oxidation at low temperatures. The genetically engineered bacterium is *Escherichia coli* expressing the cold shock protein gene *cspB*. The preparation method of this genetically engineered bacterium is as follows: (1) the cold shock protein gene *cspB* is ligated into the *pET-28a(+)* plasmid to obtain the *pET-28a(+)*-*cspB* plasmid; (2) the *pET-28a(+)*-*cspB* plasmid is introduced into *E. coli*, and after screening to obtain positive clones, it is cultured to obtain the genetically engineered bacterium. The method for enhancing the denitrification efficiency of anaerobic ammonia oxidation at low temperatures is as follows: the bacterial solution of the above-mentioned genetically engineered bacterium is mixed with the bacterial solution of *Rhizobium* to obtain a mixed bacterial solution; the mixed bacterial solution is placed at 2-8℃ for 4-8 hours for cold shock; the cold-shocked mixed bacterial solution is added to the anaerobic ammonia oxidation reactor. This invention can effectively improve the denitrification efficiency and operational stability of the anaerobic ammonia oxidation process at low temperatures.

Description

Technical Field

[0001] This invention belongs to the field of wastewater treatment technology, and relates to biological denitrification of wastewater, specifically to genetically engineered bacteria and methods for enhancing the denitrification efficiency of anaerobic ammonia oxidation processes at low temperatures. Background Technology

[0002] The increasing discharge of domestic sewage and industrial wastewater has led to severe exceedances of nitrogen pollutants in water bodies, causing eutrophication. The remediation of nitrogen pollution in water bodies has become one of the key tasks urgently needing to be addressed in the environmental field.

[0003] Currently, the nitrification-denitrification process, widely used in biological wastewater denitrification, suffers from problems such as high energy consumption, large sludge production, and the need for external organic carbon sources. In contrast, the anammox process offers significant advantages, including high denitrification efficiency, no need for aeration, low sludge production, and no need for external carbon sources, making it a research hotspot in the field of biological wastewater denitrification.

[0004] Anaerobic ammonia-oxidizing bacteria (AnAOB), as functional microorganisms in the anammox process, directly influence the denitrification efficiency of the entire reaction through their metabolic activity. However, AnAOB is extremely sensitive to temperature changes. Although it has a wide survival temperature range (-2.5℃ to 100℃), its optimum temperature is only 30-37℃. Once the temperature deviates from the optimum range, the anammox reaction is significantly inhibited. Studies show that when the temperature drops from 35℃ to 20℃, the system denitrification rate decreases by about 50%; when the temperature further drops to 15℃, the denitrification rate is only 10% of that at 35℃. Therefore, maintaining the stable operation and efficient denitrification of the anammox process in low-temperature environments has become a key technical bottleneck restricting its widespread application. Summary of the Invention

[0005] In view of the above-mentioned shortcomings of the existing technology, the purpose of this invention is to provide a genetically engineered bacterium and method for enhancing the denitrification efficiency of anaerobic ammonia oxidation process at low temperature. This invention can effectively improve the denitrification efficiency and operational stability of anaerobic ammonia oxidation process at low temperature.

[0006] The technical solution of this invention is implemented as follows:

[0007] A genetically engineered bacterium that enhances the denitrification efficiency of anaerobic ammonia oxidation at low temperatures, wherein the genetically engineered bacterium is Escherichia coli expressing the cold shock protein gene cspB.

[0008] Furthermore, the NCBI serial number of the cold shock protein gene cspB is KSMBR1_1099.

[0009] The method for preparing genetically engineered bacteria for enhancing the denitrification efficiency of anaerobic ammonia oxidation at low temperatures, as described above, is characterized by comprising the following steps:

[0010] (1) The cold shock protein gene cspB was ligated into the pET-28a(+) plasmid to obtain the pET-28a(+)-cspB plasmid;

[0011] (2) The pET-28a(+)-cspB plasmid was introduced into Escherichia coli. After screening to obtain positive clones, the genetically engineered bacteria were cultured to obtain the genetically engineered bacteria.

[0012] Furthermore, the culture medium used in step (2) is LB medium.

[0013] This invention also provides a method for enhancing the nitrogen removal efficiency of anaerobic ammonia oxidation process at low temperatures, specifically including the following steps:

[0014] S1: Mix the bacterial solution of the genetically engineered bacteria that enhances the denitrification efficiency of the anaerobic ammonia oxidation process at low temperature as described in claim 1 or 2 with the bacterial solution of rhizobium to obtain a mixed bacterial solution;

[0015] S2: Add the mixed bacterial solution to the anaerobic ammonia oxidation reactor.

[0016] Furthermore, the mixed bacteria were first subjected to cold shock at 2-8°C for 4-8 hours before being added to the anaerobic ammonia oxidation reactor.

[0017] Furthermore, the specific method for step S1 is as follows:

[0018] S1.1: Inoculate the genetically engineered bacteria into LB medium and culture with shaking until the bacterial culture reaches OD. 600 =0.6-0.8, centrifuge to collect bacterial cells, add PBS buffer to resuspend and wash 2-3 times, and finally add an equal volume of PBS buffer to the original LB medium to resuspend the bacterial cells to obtain the genetically engineered bacterial culture.

[0019] S1.2: Inoculate the rhizobium into yeast mannitol medium and culture with shaking until the bacterial culture reaches OD500. 600 =0.6-0.8, centrifuge to collect bacterial cells, add PBS buffer to resuspend and wash 2-3 times, and finally add an equal volume of PBS buffer to the original yeast mannitol medium to resuspend the bacterial cells to obtain Rhizobium bacterial culture;

[0020] S1.3: Mix the genetically engineered bacterial solution and the rhizobium bacterial solution to obtain a mixed bacterial solution.

[0021] Furthermore, in step S1, the volume ratio of the genetically engineered bacterial solution to the rhizobium bacterial solution is 1:0.5-1:2.

[0022] Furthermore, in step S1, the volume ratio of the genetically engineered bacterial solution to the rhizobium bacterial solution is 1:1.

[0023] Furthermore, in step S2, the amount of mixed bacterial solution added is 0.01%-1% of the sludge mass in the anaerobic ammonia oxidation reactor.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] 1. The cold shock protein gene cspB used in this invention originates from the planctomycetes phylum, belonging to anaerobic ammonia-oxidizing bacteria (AnAOB). It has high homology with AnAOB, and its encoded protein is naturally compatible with the intracellular environment of AnAOB. ​​It can directly alleviate the physiological inhibition of AnAOB by low temperature through multiple mechanisms, including maintaining the correct protein conformation, protecting nucleic acid integrity, and activating key metabolic enzymes. The cspB gene is integrated into the pET-28a(+) vector, which has stable replication and high-efficiency expression capabilities, and introduced into *Escherichia coli* DH5α. The high-efficiency proliferation characteristics of this strain are utilized to prepare genetically engineered bacteria on a large scale. After the resulting genetically engineered bacteria are added to the anammox system, the bacteria directly and efficiently transfer the plasmid carrying the cspB gene into AnAOB cells through fimbriae-mediated conjugation.

[0026] 2. This invention involves mixing genetically engineered *E. coli* (genetically engineered bacteria) with rhizobia and then adding the mixture to the anammox system. Since plasmid conjugation transfer in *E. coli* is regulated by quorum sensing, and *Rhizobium* sp. itself can produce the universal signaling molecule C12-HSL, which significantly promotes the plasmid conjugation transfer frequency in *E. coli*, the signaling molecule produced by rhizobia can effectively promote plasmid conjugation transfer between *E. coli* and AnAOB, thereby enhancing the plasmid transfer frequency. Furthermore, the plasmid carrying the cspB gene, after being transferred into AnAOB, can be stably inherited along with the self-replication of AnAOB, avoiding efficiency decay caused by bacterial population changes. Simultaneously, it continuously expresses cold shock proteins, fundamentally and systematically enhancing the low-temperature adaptability of AnAOB, ultimately achieving a high efficiency improvement and long-term stable operation of the entire anammox system for denitrification at low temperatures.

[0027] 3. The Escherichia coli and Rhizobium used in this invention are common laboratory strains that are easy to culture and preserve. At the same time, Rhizobium is widely present in wastewater treatment plants, making it easy to isolate. It has no negative impact on wastewater treatment systems, good environmental adaptability and safety, and good engineering application value. Attached Figure Description

[0028] Figure 1 - PCR identification results of the cspB gene in the genetically modified Escherichia coli in Example 1.

[0029] Figure 2 -Denitrification performance of each reactor in Example 2.

[0030] Figure 3 - Hydrazine dehydrogenase activity in each reactor in Example 2.

[0031] Figure 4 -Denitrification performance of each reactor in Example 3.

[0032] Figure 5 -Denitrification performance of each reactor in Example 4.

[0033] Figure 6 -Denitrification performance of each reactor in Example 5. Detailed Implementation

[0034] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.

[0035] All the pharmaceuticals used in the following examples are commercially available pharmaceuticals.

[0036] Example 1

[0037] This embodiment provides a method for modifying Escherichia coli with the cold shock protein cspB gene:

[0038] (1) Using conventional molecular biology techniques, the pET-28a(+)-cspB plasmid containing the target gene cspB was constructed. The specific steps are as follows:

[0039] Based on the cold shock protein gene cspB (NCBI serial number: KSMBR1_1099) from the phylum Planctomycetes, with the base sequence: ATGGCGAACGGAACAGTAAAGTGGTTTAATGATTCAAAAGGTTTCGGCTTTATTTCTCAGGAAAACGGAACTGATGTATTTGTTCATCAGACGTCCATCAAGTCAGAGGGTTTCAGAACTCTTGCTGAAGGAGATAAGGTTGAGTTTGATGTCATTTCAGACCAAAAAGGCCAAAAGGCCACAAATGTTGTAAAAGTA, the whole gene was synthesized using GenScript. The synthesized gene fragment was cloned into a universal sequencing vector and provided in dry powder tubes. Before use, an appropriate amount of sterile ultrapure water was added to dissolve it to a concentration of 100 ng / μL, which served as a template for subsequent experiments.

[0040] The pET-28a(+) expression vector was double-digested with restriction endonucleases NdeI and XhoI to obtain a linearized vector backbone that could be ligated to the target gene. The digestion reaction mixture (50 μL) consisted of: 1 μg pET-28a(+) plasmid; 5 μL 10×FastDigest Buffer; 1 μL NdeI restriction endonuclease; 1 μL XhoI restriction endonuclease; and sterile ultrapure water to a final volume of 50 μL. The mixture was incubated at 37°C for 1 hour.

[0041] After the reaction, 1–1.2% agarose gel electrophoresis was performed. The linearized vector band (approximately 6.6 kb) was excised under UV light and purified using an agarose gel DNA recovery kit. Following purification, the concentration and purity (OD) were determined using a micro-spectrophotometer. 260 / OD 280 The ratio should be between 1.8 and 2.0.

[0042] Using the synthesized cspB gene as a template, its protein-coding region was amplified by polymerase chain reaction (PCR). The PCR primers were designed as follows: upstream primer: 5'-CATATGGCGAACGGAACAGTAAAG-3'; downstream primer: 5'-CTCGAGTTTACAACATTTGTGGCCTTT-3'. The PCR reaction system and conditions were performed according to the high-fidelity DNA polymerase manufacturer's instructions. After verification by agarose gel electrophoresis, the amplified product was excised and the target band was recovered, purified to obtain the cspB gene fragment suitable for ligation.

[0043] The purified linearized pET-28a(+) vector and the cspB gene fragment were mixed at a vector:insertion ratio of 1:5 (molar ratio), and T4 DNA ligase and its buffer were added, with a total volume of 20 μL. The ligation reaction was carried out in a water bath at 16℃ for 16 h to allow the target gene to be directionally inserted into the expression vector, obtaining the recombinant plasmid pET-28a(+)-cspB.

[0044] (2) The pET-28a(+)-cspB plasmid was introduced into Escherichia coli using conventional molecular biology techniques.

[0045] All solutions used in the experiment must be sterilized. The specific formula for E. coli LB medium is: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride.

[0046] Preparation of chemocompetent cells: Activated and cultured DH5α *E. coli* to the logarithmic growth phase were rapidly cooled for 30 min. The cooled bacterial culture was aliquoted into pre-chilled centrifuge tubes and centrifuged at 5000 rpm for 15 min at 4°C to collect the cells. 10 mL of pre-chilled 0.1 M CaCl2 solution was added to each cell pellet, and the pellet was gently resuspended by pipetting. The pellet was incubated on ice for 60 min, and then centrifuged again at 5000 rpm for 15 min at 4°C. The supernatant was discarded. 2–4 mL of 0.1 M CaCl2 solution containing 15% glycerol was added to the pellet, and the pellet was resuspended and stored.

[0047] Chemical transformation: Add 1 µL of plasmid to 50 µL of competent bacteria (thawed on ice), gently mix with a pipette, and incubate on ice for 30 min. Heat shock at 42℃ for 90 s, then immediately incubate on ice for 2 min. Add 500 µL of antibiotic-free sterile LB solution, and incubate at 37℃ for 200 rpm for 40 min; then centrifuge at 4℃ for 5000 rpm for 15 min, and spread the bacterial solution onto LB resistant plates containing kanamycin (50 μg / mL), and incubate overnight at 37℃. The appearance of colonies on the plate indicates successful transfer.

[0048] To further demonstrate the successful transfer of the cspB gene into *E. coli*, PCR verification was performed on the *E. coli* strain containing the prepared cold shock protein cspB gene. The specific method was as follows:

[0049] The *E. coli* strains were inoculated into LB liquid medium containing kanamycin (final concentration 50 µg / mL) and cultured overnight at 37°C with shaking at 200 rpm. An appropriate amount of bacterial culture was taken, and plasmids were extracted and purified using a commercially available plasmid mini-extraction kit, strictly following the manufacturer's instructions. Finally, the concentration and purity of the extracted plasmids (A260 / A280 ratio between 1.8 and 2.0) were determined using a spectrophotometer and stored at -20°C for later use.

[0050] PCR validation was performed. Primer design: Forward primer (5' to 3' sequence): GTTCGGCTTTATTTCTCA; Reverse primer (5' to 3' sequence): TCCTTTCGGGCTTTGTTA. PCR amplification program: Pre-denaturation at 94℃ for 3 min; 30-35 cycles, including: denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 16 s. Final extension at 72℃ for 5 min.

[0051] The amplification products were verified by 1.5% agarose gel electrophoresis. The agarose gel electrophoresis results are as follows: Figure 1As shown, in the lane using the extracted engineered bacterial plasmid as a template, a clear and specific DNA band appeared at approximately 250 bp, perfectly matching the theoretically expected product length of 257 bp. This result conclusively proves that the cspB gene has been successfully integrated into the plasmid, and that the recombinant plasmid pET-28a(+)-cspB is stably present in the *E. coli* DH5α host.

[0052] Example 2

[0053] This embodiment provides an application of the genetically modified Escherichia coli obtained by the preparation method of Example 1, which is mixed with rhizobium and then used for wastewater denitrification treatment in an anammox bioreactor.

[0054] (1) Preparation of a mixed bacterial culture of genetically modified Escherichia coli and Rhizobium, specifically using the following method:

[0055] The activated genetically modified *E. coli* were inoculated into LB medium and cultured with shaking at 37°C. The OD of the bacterial culture was then measured. 600 Once the OD600 of the bacterial culture reaches 0.6-0.8, remove the bacterial culture and centrifuge at 3000 rpm for 5 minutes. After centrifugation, discard the supernatant and resuspend the culture in PBS buffer. Repeat the centrifugation and washing steps 2-3 times to thoroughly remove residual culture medium. Add an equal volume of PBS buffer to the washed bacterial pellet and resuspend the bacteria to prepare bacterial suspension 1. Similarly, inoculate the activated rhizobia into yeast mannitol medium and culture with shaking at 30°C. When the OD600 of the bacterial culture reaches 0.6-0.8, remove the bacterial culture and centrifuge at 3000 rpm for 5 minutes. After centrifugation, discard the supernatant and resuspend the culture in PBS buffer. Repeat the centrifugation and washing steps 2-3 times to thoroughly remove residual culture medium. Add an equal volume of PBS buffer to the washed bacterial pellet and resuspend the bacteria to prepare bacterial suspension 2. Mix bacterial suspension 1 and bacterial suspension 2 at a volume ratio of 1:1 to obtain a mixed bacterial culture.

[0056] The rhizobium used was *Rhizobium sp.*, which was stored in the laboratory for a long time. The specific formula of the yeast mannitol culture medium was: 10 g / L mannitol, 1 g / L yeast extract, 0.5 g / L dipotassium hydrogen phosphate, 0.2 g / L magnesium sulfate heptahydrate, and 0.1 g / L sodium chloride.

[0057] (2) Application of genetically modified Escherichia coli and Rhizobium mixed bacterial solution in anammox bioreactor to enhance wastewater denitrification treatment.

[0058] This embodiment uses a sequencing batch reactor (SBR) to cultivate anaerobic ammonia oxidation granular sludge (AnGS). The total effective volume of the reactor is 50 mL, and the top of the reactor is sealed with a butyl rubber stopper. The AnGS dosage in each reactor is 3 g (wet weight). The AnGS used is inoculated into an expanded granular sludge bed reactor that has been operating continuously for more than 6 years.

[0059] The influent is synthetic wastewater, with NaNO2 and NH4Cl providing the inorganic substrates. The influent NH4... + -N and NO2 - The -N molar ratio is 1:1, and no additional organic matter is added. The composition of the synthetic wastewater is shown in Table 1. After each water change, nitrogen aeration is required to ensure a strictly anaerobic environment, and the aeration time is 10 minutes.

[0060] Table 1 Components of Synthetic Wastewater

[0061]

[0062] This embodiment was conducted using five 50 mL sequencing batch reactors. The experimental design is as follows:

[0063] The operation of the reactor is divided into three stages. The operating conditions of the five reactors R1-R5 are the same in the first two stages.

[0064] In Phase I (0-14 days), the total nitrogen (TN) concentration in the influent was 400 mg / L, and the shaking temperature was 37℃.

[0065] Phase II (14-28 days): During this phase, all reactors began cooling operation. Since the activity of AnAOB showed a significant decrease at 15°C, the shaking table temperature was set to 15°C. To prevent reactor collapse due to excessive load at low temperatures, the influent TN concentration was adjusted to 80 mg / L.

[0066] Phase III (28-60 days): Reactor R1 served as a blank control and received no treatment. 3 mg of a mixed culture of genetically modified *E. coli* and *Rhizobium* was exogenously added to reactor R2; 3 mg of a mixed culture of non-genetically modified *E. coli* and *Rhizobium* was exogenously added to reactor R3; 3 mg of genetically modified *E. coli* culture (without *Rhizobium*) was exogenously added to reactor R4; and 3 mg of *Rhizobium* culture (without *E. coli*) was exogenously added to reactor R5. Other conditions were the same as in Phase II. All exogenous additions in groups R2-R5 were performed only once on day 28. The hRT (heat recovery time) was 24 h during the entire operation. The operating conditions for each batch of experiments are detailed in Table 2.

[0067] All bacterial cultures involved in the experiment were subjected to a cold shock at 4°C for 6 hours before addition.

[0068] Table 2 Batch Experiment Design

[0069]

[0070] Reactor denitrification performance such as Figure 2 As shown in the figure: Stage I: The denitrification performance of each reactor was stable, with an average total nitrogen removal rate ranging from 83% to 87%. The reactors were successfully started up and operated stably, with good nitrogen removal performance. Stage II: After the temperature was reduced to 15℃, the denitrification performance of each reactor deteriorated, with the total nitrogen removal rate ranging from 24.89% to 28.24%, indicating that low temperature had a significant inhibitory effect on AnAOB activity and reactor denitrification performance. Stage III: The denitrification performance of reactor R1 gradually stabilized, with a slight increase in nitrogen removal rate, but the change was not significant, and the activity of AnAOB was still inhibited; the denitrification performance of reactor R2 was significantly improved after the addition of a mixed bacterial solution of genetically modified Escherichia coli and Rhizobium, with the reactor denitrification performance significantly increasing from 25.21% to 73.11%, and the denitrification effect was stable. This indicates that the addition of a mixed bacterial solution of genetically modified Escherichia coli and Rhizobium can improve the nitrogen removal efficiency of anaerobic ammonia oxidation reactors under low temperature conditions, and the system denitrification performance remains stable under long-term operation. Reactor R3 showed no significant change in denitrification performance compared to R1 after the addition of a mixed culture of unmodified *E. coli* and *Rhizobium*, indicating that the genetic modification of *E. coli* is the core factor in improving denitrification efficiency, rather than the bacteria themselves. Reactor R4 showed improved denitrification performance after the addition of an equal amount of genetically modified *E. coli* culture (excluding *Rhizobium*), with the denitrification efficiency significantly increasing from 27.14% to 59.24%, confirming the individual effect of genetically modified *E. coli*. However, compared to R2, the improvement was smaller, and the time required to reach peak performance was longer. This comparison reveals the key promoting role of *Rhizobium* in plasmid conjugation and transfer efficiency. Reactor R5 showed no significant change in denitrification performance compared to R1 after the addition of an equal amount of *Rhizobium* culture (excluding *E. coli*), indicating that *Rhizobium* itself has no significant impact on the system, further suggesting that its role in experimental group R2 is indirect in promoting conjugation and transfer.

[0071] To further verify the mechanism of action of this invention from the perspective of microbial metabolic activity, the hydrazine dehydrogenase (HDH) enzyme activity in each reactor was measured at different times. HDH enzymes are specific enzymes that catalyze the AnAOB metabolic pathway, converting N2H4 to N2. Therefore, HDH enzyme activity is commonly used to assess the metabolic activity and denitrification capacity of AnAOB.

[0072] HDH enzyme activity was analyzed by measuring the change in the conversion of 1 mg of protein to cytochrome C per minute, i.e., μmol cytochrome C / min / mg protein. 1.73 mL of deoxygenated Tris-HCl, 0.2 mL of oxidized horse heart cytochrome C, and 20 μL of hydrazine solution were added to an anaerobic cuvette containing 20 µL of crude enzyme solution. After mixing, the initial absorbance was measured at 550 nm. Subsequently, the cuvette was placed in a 37°C water bath, and the change in absorbance was recorded every 30 s to calculate the HDH enzyme activity. HDH enzyme activity was measured in each reactor at the end of Phase I, Phase II, and Phase III.

[0073] Enzyme activity in each reactor as follows Figure 3 As shown. By Figure 3 It can be seen that: at the end of stage I (14 days), AnAOB metabolism was vigorous under suitable temperature, and the HDH enzyme activities of R1-R5 were all at high levels with no significant differences; at the end of stage II (28 days), after cooling to 15℃, the HDH enzyme activities of all reactors dropped sharply compared to 14 days, and the levels were similar, indicating that low temperature significantly inhibited AnAOB activity; at the end of stage III (60 days)... d) Different additives resulted in significant differentiation in enzyme activity: R1 enzyme activity remained at a low level, with no significant difference from stage II, indicating that AnAOB activity was difficult to recover without exogenous intervention; R2 enzyme activity increased significantly, indicating that the cspB gene was efficiently transferred to AnAOB under the promotion of rhizobia, enhancing its cold resistance and leading to a substantial recovery of HDH enzyme activity; R3 enzyme activity was close to R1; R4 enzyme activity was significantly higher than R1 and R3 but lower than R2, due to the reduced plasmid conjugation efficiency caused by the lack of rhizobia signaling molecules, resulting in limited recovery of AnAOB activity; R5 enzyme activity was not different from R1, indicating that rhizobia only assisted in promoting plasmid conjugation and could not directly enhance AnAOB metabolism. Overall, the HDH enzyme activity validated the effectiveness of the technology at the molecular metabolic level and also confirmed that genetically modified E. coli can achieve conjugation transfer of cspB-containing plasmids to AnAOB through fimbriae contact.

[0074] Example 3

[0075] This embodiment provides an application of a mixed bacterial culture of genetically modified Escherichia coli and Rhizobium in wastewater denitrification treatment in an Anammox bioreactor after different cold shock temperatures.

[0076] This embodiment uses the same reactor configuration, operating conditions, and Phase I and Phase II operations (37°C start-up phase and 15°C low-temperature inhibition phase) as Example 2, which will not be repeated here. The difference lies in the treatment of the additives in Phase III: reactor R1 is not treated; reactor R2 is added with 3 mg of a mixed bacterial solution of genetically modified Escherichia coli and Rhizobium (volume ratio 1:1) without prior cold shock treatment; 3 mg of a mixed bacterial solution of genetically modified Escherichia coli and Rhizobium (volume ratio 1:1) is added to all four reactors R3-R6, but they are subjected to cold shock at 2°C, 4°C, 6°C, and 8°C for 6 hours respectively before addition.

[0077] The denitrification performance of each reactor is as follows: Figure 4 As shown in the figure:

[0078] Phase I: The denitrification performance of each reactor was stable, with an average total nitrogen removal rate ranging from 82% to 85%, indicating that the reactors had been successfully started up and were operating stably with good nitrogen removal performance. Phase II: After the temperature was lowered to 15℃, the denitrification performance of each reactor deteriorated, with total nitrogen removal rates ranging from 23.97% to 27.14%, indicating that low temperature had a significant inhibitory effect on AnAOB activity and reactor denitrification performance. Phase III: The denitrification performance of reactor R1 gradually stabilized, with a slight increase in nitrogen removal rate, but the change was not significant, and AnAOB activity remained inhibited; the denitrification performance of reactor R2 (with uncooled mixed bacterial solution) was significantly improved compared to R1, increasing from 25.11% to 63.54%, indicating that the addition of a mixed bacterial solution of genetically modified Escherichia coli and Rhizobium can improve the nitrogen removal efficiency of the anaerobic ammonia oxidation reactor under low-temperature conditions, and the system's denitrification performance remained stable under long-term operation. Reactors R3 through R6 showed significantly enhanced denitrification activity after the addition of mixed bacterial solutions treated at different cold quench temperatures, with a significantly higher increase than that in R2. This indicates that within the cold quench temperature range of 2°C to 8°C, the mixed bacterial solutions can effectively activate the intracellular low-temperature gene memory system, enhance the transfer efficiency of the cspB gene, and thus improve the low-temperature denitrification efficiency of the anammox system. Among them, reactor R4, treated with a 4°C cold quench, showed the most significant improvement in denitrification performance, with the total nitrogen removal rate increasing from 25.31% at the end of stage II to 74.52% at the end of stage III. This comparison demonstrates that cold quench treatment is a key step in fully realizing the effectiveness of this invention; bacterial solutions without cold quenching cannot achieve optimal efficiency; within the cold quench temperature range of 2°C to 8°C, the mixed bacterial solutions can function efficiently, with 4°C being the optimal temperature.

[0079] Example 4

[0080] This embodiment provides an application of wastewater denitrification treatment using a mixed bacterial solution obtained by mixing genetically modified Escherichia coli and Rhizobium in different proportions, followed by cold shock at 4°C for 6 hours.

[0081] This embodiment uses the same reactor configuration, operating conditions, and stages I and II (37°C start-up stage and 15°C low-temperature inhibition stage) as Example 2, which will not be repeated here. The difference lies in the dosage ratio in stage III: reactor R1 is not treated; 3 mg of a mixed bacterial solution of genetically modified Escherichia coli and Rhizobium is added to all three reactors R2-R4, and each reactor is cold-shocked at 4°C for 6 hours before addition, but the mixing ratio is different. Specifically, the volume ratio of genetically modified Escherichia coli to Rhizobium in the mixed bacterial solution of R2-R4 is 1:0.5, 1:1, and 1:2, respectively.

[0082] The denitrification performance of each reactor is as follows: Figure 5 As shown in the figure: Stage I: The denitrification performance of each reactor was stable, with an average total nitrogen removal rate ranging from 82% to 86%, indicating that the reactors had been successfully started up and were operating stably with good nitrogen removal performance. Stage II: After the temperature was lowered to 15℃, the denitrification performance of each reactor deteriorated, with the total nitrogen removal rate ranging from 22.66% to 26.47%, indicating that low temperature had a significant inhibitory effect on AnAOB activity and reactor denitrification performance. Stage III: The denitrification performance of reactor R1 gradually stabilized, with a slight increase in nitrogen removal rate, but the change was not significant, and AnAOB activity was still inhibited; after adding mixed bacterial solutions of different volume ratios, the denitrification activity of reactors R2 to R4 all showed a significant improvement. Among them, reactor R3 (volume ratio 1:1) showed the most significant improvement in denitrification activity, with the total nitrogen removal rate increasing from 25.78% at the end of Stage II to 72.87% at the end of Stage III. This comparison shows that the volume ratio of genetically modified Escherichia coli to Rhizobium is a key indicator for promoting the improvement of denitrification performance of the anammox system. If the proportion of rhizobia is too low, the concentration of quorum sensing signal molecules secreted by them will be insufficient, making it difficult to effectively promote the conjugation process. If the proportion of genetically modified E. coli is too low, it will lead to a shortage of plasmid sources available for transfer. An imbalance in the ratio of both will restrict the final transfer effect of the cspB gene to AnAOB. ​​When the ratio of genetically modified E. coli to rhizobia is controlled between 1:0.5 and 1:2, they can produce a good synergistic effect, with 1:1 being the optimal ratio.

[0083] Example 5

[0084] This embodiment provides the application of mixed bacterial solutions with different dosages in wastewater denitrification treatment in an anammox bioreactor after being chilled at 4°C for 6 hours.

[0085] This embodiment uses the same reactor configuration, operating conditions, and stages I and II (37°C start-up stage and 15°C low-temperature inhibition stage) as Example 2, which will not be repeated here. The difference lies in the dosage of the additives in stage III: reactor R1 is not treated; a mixed bacterial solution of genetically modified Escherichia coli and Rhizobium (volume ratio 1:1) is added to all three reactors R2-R4, and each reactor is cold-shocked at 4°C for 6 hours before addition, with different dosages. Specifically, the dosages of the mixed bacterial solution added to R2-R4 are 0.3 mg, 3 mg, and 30 mg, respectively.

[0086] The denitrification performance of each reactor is as follows: Figure 6 As shown in the figure:

[0087] Phase I: The denitrification performance of each reactor was stable, with an average total nitrogen removal rate ranging from 83% to 86%, indicating that the reactors had been successfully started up and were operating stably with good nitrogen removal performance. Phase II: After lowering the temperature to 15°C, the denitrification performance of each reactor deteriorated, with total nitrogen removal rates ranging from 22.94% to 26.11%, indicating that low temperature had a significant inhibitory effect on AnAOB activity and reactor denitrification performance. Phase III: The denitrification performance of reactor R1 gradually stabilized, with a slight increase in nitrogen removal rate, but the change was not significant, and AnAOB activity remained inhibited. Reactors R2 through R4 showed significant improvements in denitrification activity after the addition of different masses of mixed bacterial solution. Among them, reactor R3 (addition amount 3 mg) showed the most significant improvement in denitrification activity, with the total nitrogen removal rate increasing from 25.29% at the end of Phase II to 73.31% at the end of Phase III. This comparison shows that the dosage of mixed bacterial solution is one of the key parameters affecting the effectiveness of this invention. Insufficient dosage leads to inadequate enhancement, while excessive dosage disrupts the original ecological balance of the anammox system due to the introduction of exogenous mixed bacterial solution. Furthermore, the addition of excessive heterotrophic bacteria creates additional metabolic demands, competing with the anammox sludge for survival space and weakening the enhancement effect. The optimal enhancement effect is achieved when the amount of mixed bacterial solution added is 0.01%-1% of the sludge mass in the anammox reactor.

[0088] Finally, it should be noted that the above embodiments of the present invention are merely illustrative examples and not intended to limit the implementation of the invention. Those skilled in the art can make other variations and modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the scope of protection of this invention.

Claims

1. A genetically engineered bacterium that enhances the denitrification efficiency of anaerobic ammonia oxidation at low temperatures, characterized in that, The genetically engineered bacteria is *Escherichia coli* expressing the cold shock protein gene cspB.

2. The genetically engineered bacteria for enhancing the denitrification efficiency of anaerobic ammonia oxidation process at low temperature according to claim 1, characterized in that, The NCBI serial number of the cold shock protein gene cspB is KSMBR1_1099.

3. A method for preparing genetically engineered bacteria for enhancing the denitrification efficiency of anaerobic ammonia oxidation at low temperatures, as described in claim 1 or 2, characterized in that... Includes the following steps: (1) The cold shock protein gene cspB was ligated into the pET-28a(+) plasmid to obtain the pET-28a(+)-cspB plasmid; (2) The pET-28a(+)-cspB plasmid was introduced into Escherichia coli. After screening to obtain positive clones, the genetically engineered bacteria were cultured to obtain the genetically engineered bacteria.

4. The method for preparing genetically engineered bacteria for enhancing the denitrification efficiency of anaerobic ammonia oxidation process at low temperature according to claim 3, characterized in that, The culture medium used in step (2) is LB medium.

5. A method for enhancing the nitrogen removal efficiency of an anaerobic ammonia oxidation process at low temperatures, characterized in that, Specifically, the following steps are included: S1: Mix the bacterial solution of the genetically engineered bacteria that enhances the denitrification efficiency of the anaerobic ammonia oxidation process at low temperature as described in claim 1 or 2 with the bacterial solution of rhizobium to obtain a mixed bacterial solution; S2: Add the mixed bacterial solution to the anaerobic ammonia oxidation reactor.

6. The method for enhancing the nitrogen removal efficiency of anaerobic ammonia oxidation process at low temperature according to claim 5, characterized in that, Before adding the mixed bacteria to the anaerobic ammonia oxidation reactor, they are first subjected to cold shock at 2-8℃ for 4-8 hours.

7. A method for enhancing the nitrogen removal efficiency of an anaerobic ammonia oxidation process at low temperature according to claim 5 or 6, characterized in that, The specific method for step S1 is as follows: S1.1: Inoculate the genetically engineered bacteria into LB medium and culture with shaking until the bacterial culture reaches OD. 600 =0.6-0.8, centrifuge to collect bacterial cells, add PBS buffer to resuspend and wash 2-3 times, and finally add an equal volume of PBS buffer to the original LB medium to resuspend the bacterial cells to obtain the genetically engineered bacterial culture. S1.2: Inoculate the rhizobium into yeast mannitol medium and culture with shaking until the bacterial culture reaches OD500. 600 =0.6-0.8, centrifuge to collect bacterial cells, add PBS buffer to resuspend and wash 2-3 times, and finally add an equal volume of PBS buffer to the original yeast mannitol medium to resuspend the bacterial cells to obtain Rhizobium bacterial culture; S1.3: Mix the genetically engineered bacterial solution and the rhizobium bacterial solution to obtain a mixed bacterial solution.

8. The method for enhancing the nitrogen removal efficiency of anaerobic ammonia oxidation process at low temperature according to claim 7, characterized in that, In step S1, the volume ratio of the genetically engineered bacterial solution to the rhizobium bacterial solution is 1:0.5-1:

2.

9. A method for enhancing the nitrogen removal efficiency of an anaerobic ammonia oxidation process at low temperature according to claim 8, characterized in that, In step S1, the volume ratio of the genetically engineered bacterial solution to the rhizobium bacterial solution is 1:

1.

10. The method for enhancing the nitrogen removal efficiency of an anaerobic ammonia oxidation process at low temperature according to claim 5, characterized in that, In step S2, the amount of mixed bacterial solution added is 0.01%-1% of the sludge mass in the anaerobic ammonia oxidation reactor.

Images