Use of nr4a1 as a biomarker for early gamma radiation
By using the NR4A1 protein or its encoding gene as a biomarker, the problems of early diagnosis and time differentiation of gamma-ray radiation have been solved, enabling rapid and accurate radiation assessment and treatment selection, which is suitable for emergency rescue.
Patent Information
- Application Number
- CN202610460716.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-09
- Publication Date
- 2026-06-26
Smart Images

Figure CN122279022A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of cell detection technology, specifically involving the application of NR4A1 as an early biomarker of gamma-ray radiation. Background Technology
[0002] Nuclear explosions or accidents can expose large numbers of people to radiation. The ability to quickly and accurately estimate the dose and degree of radiation damage to those exposed in the initial irradiation period (within 12 hours) is crucial for rapid injury classification and treatment selection in nuclear accidents.
[0003] The main types of ionizing radiation include alpha, beta, gamma, X-rays, and neutrons. Gamma rays have sufficient energy to penetrate deep into the human body and damage tissues, making them the primary threat to human health after a nuclear explosion. Currently, the technologies available for radiation biodosage assessment are very limited. The only universally accepted method is lymphocyte chromosome aberration rate analysis, considered the "gold standard" for radiation biodosage assessment. However, this method is unsuitable for large-scale screening because it is a time- and labor-intensive detection method with very limited testing capacity in emergency situations.
[0004] In recent years, with the rapid development of molecular biology and big data omics technologies, research on the radiation dose and damage of biological macromolecules such as RNA, proteins, or small molecules of metabolites has been continuously deepened and has made great progress. Related studies have shown that the expression of mouse serum miR-375-3p gradually increases within 24h-7d after 7Gy X-ray radiation, but this study did not detect whether the expression of miR-375-3p also gradually increases in the early stage of irradiation and has a dose-effect [Chiba M, et al. Serum miR-375-3p increase in mice exposed to a high dose of ionizing radiation. Sci Rep, 2018, 8(1):1302]. Similarly, existing literature, such as [Srujana Golla, et al. Metabolic Analysis of Mice Exposed to Gamma Radiation Reveals a Systemic Understanding of Total-Body Exposure, Radiat Res. 2017 May; 187(5):612–629. doi:10.1667 / RR14592.1.], reports that adenosine and uracil both decrease after 6 Gy irradiation. However, the above-mentioned existing techniques all study the radiation dose-effect relationship and have not established the radiation time-effect relationship. Currently, there is a lack of biomarkers for the radiation time-effect relationship. Screening for time-related biomarkers of gamma radiation is particularly important for the early diagnosis and prediction of gamma radiation. Summary of the Invention
[0005] The purpose of this invention is to provide NR4A1 as an early diagnostic biomarker for gamma-ray radiation.
[0006] This invention provides the use of NR4A1 protein or its encoding gene as a marker in one or more of the following: (1) Prepare products for early diagnosis of cells using gamma-ray radiation; (2) Prepare a product for screening cells exposed to γ-rays for 2 h; (3) Prepare products that differentiate the duration of γ-ray irradiation in cells; The expression of the NR4A1 protein or its encoding gene was significantly upregulated in cells irradiated with γ rays for 2 h.
[0007] This invention provides the use of a reagent for detecting NR4A1 protein or its encoding gene in one or more of the following: (1) Prepare products for early diagnosis of cells using gamma-ray radiation; (2) Prepare a product for screening cells exposed to γ-rays for 2 h; (3) Prepare products that differentiate the duration of γ-ray irradiation in cells; The expression of the NR4A1 protein or its encoding gene was significantly upregulated in cells irradiated with γ rays for 2 h.
[0008] Preferably, the reagent comprises an NR4A1 antibody or primers; the primers comprise an upstream primer with a nucleotide sequence as shown in SEQ ID NO:1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:2.
[0009] Preferably, the gamma ray radiation dose is 2~8 Gy.
[0010] Preferably, the cells are HeLa cells.
[0011] Preferably, the product includes reagents or kits.
[0012] The present invention provides a reagent or kit for the diagnosis and / or differentiation of cellular gamma-ray radiation time, the reagent or kit comprising a reagent for detecting NR4A1 protein or its encoding gene; The expression of the NR4A1 protein or its encoding gene was significantly upregulated in cells irradiated with γ rays for 2 h.
[0013] This invention provides a method for screening cells irradiated with gamma rays for 2 hours. The method involves detecting the expression level of NR4A1 protein or its encoding gene in the cells to be screened. Cells to be screened that show a significant upregulation of NR4A1 protein or its encoding gene expression compared to control cells are those irradiated with gamma rays for 2 hours.
[0014] Preferably, the expression level of NR4A1 protein or its encoding gene is detected by q-PCR, gene chip or transcriptome sequencing RNA quantification technology.
[0015] Preferably, the gamma ray radiation dose is 2-8 Gy; the cells are HeLa cells.
[0016] Beneficial effects: This invention found that NR4A1 protein and mRNA levels significantly increased in the early stage (2 h) after gamma ray irradiation, and showed a radiation dose-dependent effect. NR4A1 can be used as a biomarker for HeLa cells irradiated with gamma rays for 2 h, to screen cells irradiated with gamma rays for 2 h, to distinguish the time of cellular gamma ray irradiation, and to achieve early diagnosis of cellular gamma ray irradiation. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0018] Figure 1 Western blot analysis results of NR4A1 protein in HeLa cells under different doses and times of γ-ray treatment; Figure 2 The expression of NR4A1 mRNA in HeLa cells treated with 2 Gy γ rays at different time points; Figure 3 The expression of NR4A1 mRNA in HeLa cells treated with 4 Gy γ-rays at different time points; Figure 4 The expression of NR4A1 mRNA in HeLa cells after treatment with 8 Gy γ rays at different time points; express P <0.0001. Detailed Implementation
[0019] The present invention provides the use of NR4A1 protein or its encoding gene as a marker in one or more of the following: (1) preparing a product for early diagnosis of cell γ-ray radiation; (2) preparing a product for screening cells irradiated with γ-rays for 2 h; (3) preparing a product for distinguishing the time of cell γ-ray radiation; wherein the expression of NR4A1 protein or its encoding gene is significantly upregulated in cells irradiated with γ-rays for 2 h.
[0020] The present invention provides the use of a reagent for detecting NR4A1 protein or its encoding gene in one or more of the following: (1) preparing a product for early diagnosis of cell γ-ray radiation; (2) preparing a product for screening cells irradiated with γ-rays for 2 h; (3) preparing a product for distinguishing the time of cell γ-ray radiation; wherein the expression of NR4A1 protein or its encoding gene is significantly upregulated in cells irradiated with γ-rays for 2 h.
[0021] In one embodiment, the reagent of the present invention includes an NR4A1 antibody or primer; the primer includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO:1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:2.
[0022] In one embodiment, the gamma-ray radiation dose of the present invention is 2-8 Gy; in another embodiment, the gamma-ray radiation dose of the present invention is 4-6 Gy. In one embodiment, the cells described in the present invention are HeLa cells. In one embodiment, the product of the present invention includes reagents or kits.
[0023] The present invention provides a reagent or kit for the diagnosis and / or differentiation of cell gamma-ray irradiation time, the reagent or kit comprising a reagent for detecting NR4A1 protein or its encoding gene; the expression of NR4A1 protein or its encoding gene is significantly upregulated in cells irradiated with gamma rays for 2 h.
[0024] This invention provides a method for screening cells irradiated with gamma rays for 2 hours. The method involves detecting the expression level of NR4A1 protein or its encoding gene in the cells to be screened. Cells to be screened that show a significant upregulation of NR4A1 protein or its encoding gene expression compared to control cells are those irradiated with gamma rays for 2 hours.
[0025] In one implementation method, the present invention detects the expression level of NR4A1 protein or its encoding gene using q-PCR, gene chip, or transcriptome sequencing RNA quantification techniques. The present invention does not impose strict requirements on the methods used for q-PCR, gene chip, or transcriptome sequencing; conventional practices in the art are sufficient.
[0026] In one embodiment, the gamma-ray radiation dose of the present invention is 2-8 Gy; in another embodiment, the gamma-ray radiation dose of the present invention is 4-6 Gy. In one embodiment, the cell of the present invention is HeLa cell.
[0027] To further illustrate the present invention, the application of NR4A1 provided by the present invention as an early biomarker of gamma-ray radiation is described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0028] Example 1 Western blot analysis of NR4A1 protein expression after gamma-ray irradiation 1. HeLa cells were treated with doses of 2, 4, and 8 Gy, respectively. Unirradiated cells and cells 0.5, 2, 4, 8, and 12 h after irradiation were collected, and proteins were extracted by lysis.
[0029] 2. SDS-PAGE protein separation: 80 V constant voltage for 30 min, at which point all bands of the protein marker have begun to separate; 120 V constant voltage for 1 h, constantly monitoring the position of the target band to prevent it from running out of the gel.
[0030] 3. Transfer: After electrophoresis, remove the SDS-PAGE gel and recover the electrophoresis solution. Prepare the transfer clamp and assemble it in the order of the "black gel and white membrane" sandwich model. Remove air bubbles and put it into the transfer tank. Add the pre-treated transfer buffer to the tank and maintain a constant pressure of 100 V for 1 hour.
[0031] 4. Sealing: 5% skim milk powder, shake on a shaker at low speed for 2 hours.
[0032] 5. Primary antibody incubation: Remove the membrane and place it in a pre-diluted TBST NR4A1 antibody solution (dilution ratio 1:1000), incubate at room temperature on a low-speed shaker for 1 h, or place it in a refrigerator at 4°C overnight.
[0033] 6. Primary antibody washing: Shake the 1×TBST solution at high speed 3 times, 10 min each time.
[0034] 7. Secondary antibody incubation: Place the membrane in the secondary antibody prepared in advance with TBST (dilution ratio 1:1000) and incubate at room temperature on a low-speed shaker for 1 h; 8. Secondary antibody washing: Recover the primary antibody, shake the 1×TBST solution at high speed 3 times, 10 min / time.
[0035] 9. Development: Prepare the luminescent solution according to the instructions, using a VA solution and VB solution in a 1:1 volume ratio. Blot the membrane dry with filter paper, then evenly apply an appropriate amount of developing solution to the strip. Develop using a LAS developer. Save the strip image after development. Results are as follows: Figure 1 As shown, NR4A1 protein levels significantly increased 0.5 and 2 h after irradiation with a 2 Gy dose. NR4A1 protein levels also significantly increased 2 h after irradiation with 4 and 8 Gy doses.
[0036] Example 2 qPCR technology for detecting NR4A1 mRNA expression after gamma-ray irradiation 1. Sample processing and nucleic acid extraction: HeLa cells were treated with doses of 2, 4, and 8 Gy, respectively. Unirradiated cells and cells irradiated at 0.5, 2, 4, 8, and 12 h were collected. Total mRNA was extracted by lysis and detected using a spectrophotometer. The A260 / A280 ratio of RNA should be between 1.8 and 2.1, and that of DNA should be between 1.7 and 1.9. The integrity of nucleic acids was detected by agarose gel electrophoresis.
[0037] 2. qPCR Amplification: The extracted nucleic acids are amplified by PCR. The reaction system must be operated on ice to avoid enzyme inactivation. A negative control (no template control, NTC) and a positive control (known positive sample) are set up to eliminate contamination and experimental errors. Each sample should have at least 3 biological replicates and 3 technical replicates. The coefficient of variation (CV) of the Ct value for replicate samples should be <5% to ensure the reliability of the results. The system is briefly centrifuged after preparation to avoid air bubble formation. The PCR amplification primer sequences are as follows: Upstream primer: CAGCTTGCTTGTCGATGTCC (SEQ ID NO:1); Downstream primer: TTGTCAATGATGGGTGGAGG (SEQ ID NO:2).
[0038] PCR amplification program: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5~10 s, 60℃ annealing for 30~60 s, 40 cycles; 60℃→95℃, slow temperature increase of 0.5℃ / s, real-time acquisition of fluorescence signals, and plotting of melting curves.
[0039] 3. Data Analysis Baseline and Threshold Settings: Select the first 3-15 cycles of amplification (the phase without fluorescence signal growth). The instrument will automatically calculate the baseline fluorescence intensity. Set the threshold to the exponential growth phase of the amplification curve, above the baseline, to ensure that the amplification curves of all samples cross the threshold. The number of cycles corresponding to the threshold is the Ct value (cycle threshold). Using 2... -ΔΔCt The NR4A1 mRNA level was calculated using the following formula: ΔCt = Ct (target gene) - Ct (internal reference gene); ΔCt = ΔCt (experimental group) - ΔCt (control group); fold change = 2. -ΔΔCt The result is as follows Figures 2-4 As shown, NR4A1 mRNA levels were significantly increased 2 hours after irradiation with different Gy doses.
[0040] As can be seen from the above, the expression of NR4A1 protein or its encoding gene is significantly upregulated in cells irradiated with γ-rays for 2 h, and it can be used as a biomarker for HeLa cells irradiated with γ-rays for 2 h.
[0041] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of NR4A1 protein or its encoding gene as a biomarker in one or more of the following: (1) Prepare products for early diagnosis of cells using gamma-ray radiation; (2) Prepare a product for screening cells exposed to γ-rays for 2 h; (3) Prepare products that differentiate the duration of γ-ray irradiation in cells; The expression of the NR4A1 protein or its encoding gene was significantly upregulated in cells irradiated with γ rays for 2 h.
2. The application of reagents for detecting NR4A1 protein or its encoding gene in one or more of the following: (1) Prepare products for early diagnosis of cells using gamma-ray radiation; (2) Prepare a product for screening cells exposed to γ-rays for 2 h; (3) Prepare products that differentiate the duration of γ-ray irradiation in cells; The expression of the NR4A1 protein or its encoding gene was significantly upregulated in cells irradiated with γ rays for 2 h.
3. The application according to claim 2, characterized in that, The reagents include NR4A1 antibodies or primers; the primers include an upstream primer with a nucleotide sequence as shown in SEQ ID NO:1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:
2.
4. The application according to any one of claims 1 to 3, wherein the gamma ray radiation dose is 2 to 8 Gy.
5. The application according to any one of claims 1 to 3, wherein the cell is a HeLa cell.
6. The application according to any one of claims 1 to 3, characterized in that, The products include reagents or kits.
7. A reagent or kit for the diagnosis and / or differentiation of cell gamma-ray radiation time, characterized in that, The reagents or kits include reagents for detecting NR4A1 protein or its encoding gene; The expression of the NR4A1 protein or its encoding gene was significantly upregulated in cells irradiated with γ rays for 2 h.
8. A method for screening cells exposed to gamma rays for 2 hours, characterized in that, The expression levels of NR4A1 protein or its encoding gene in the cells to be screened were detected. The cells to be screened that showed significantly upregulated expression of NR4A1 protein or its encoding gene compared to control cells were cells irradiated with γ-rays for 2 h.
9. The method according to claim 8, characterized in that, The expression levels of NR4A1 protein or its encoding gene were detected using q-PCR, gene chip, or transcriptome sequencing RNA quantification techniques.
10. The method according to claim 8, characterized in that, The gamma ray radiation dose is 2-8 Gy; the cells are HeLa cells.