A kit and method for detecting a polymorphism of an obesity gene

Abstract

This invention relates to the field of molecular biology, and more particularly to a kit and method for detecting obesity gene polymorphisms. The invention develops a kit and nucleic acid mass spectrometry detection method for simultaneously detecting obesity gene polymorphisms rs1421085, rs9939609, rs1801282, rs1042713, and rs17782313. This allows for the rapid and simultaneous detection of ten genotypes at five polymorphic loci, making genetic testing for obesity-related polymorphisms more convenient and offering high sample throughput. This provides better technical support for obesity gene detection and helps to provide better suggestions for personal weight loss plans, demonstrating broad application prospects.

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology, and in particular to a kit and method for detecting obesity gene polymorphism. Background Technology

[0002] rs1421085 is a key single nucleotide polymorphism (SNP) locus located in the intron region of the FTO (Fat Mass and Obesity Associated) gene on human chromosome 16. It is one of the most strongly known genetic loci associated with common obesity and body mass index. At rs1421085, the C allele is the risk allele for obesity, and this variation disrupts the binding site of a transcriptional repressor (ARID5B). The variation leads to the abnormal activation of two normally repressed adjacent genes, IRX3 and IRX5. Overexpression of IRX3 / IRX5 shuts down thermogenesis-related genetic programs in adipocytes (such as UCP1), inhibits mitochondrial "burning" function, and results in reduced energy expenditure.

[0003] rs9939609 is one of the most well-known and widely studied single nucleotide polymorphisms (SNPs) in the FTO gene. Its risk allele (A allele) ranks among the strongest in its association with obesity among all common gene variants. The risk allele (A allele) primarily mediates appetite upregulation through the central nervous system, affecting the levels or sensitivity of hormones such as leptin and ghrelin, leading to weakened satiety signals and increased hunger (Cecil, JE, et al. (2008). Anobesity-associated FTO gene variant and increased energy intake in children. New England Journal of Medicine, 358(24), 2559-2566). Carriers of this risk allele are advised to eat more protein-rich foods and reduce their intake of sweets and fried foods.

[0004] rs1801282 is a classic genetic variant closely associated with obesity and metabolism, but its mechanism of action is completely different from that of FTO. This site is located on the PPARG (peroxisome proliferator-activated receptor γ) gene, and it is a functionally defined missense mutation that directly alters the amino acid sequence of the protein (Deeb, SS, et al. (1998). APro12Ala substitution in PPARgamma2 associated with decreased receptor activity, lower body mass index and improved insulin sensitivity. Nature Genetics, 20(3), 284-287). People carrying the C gene are more prone to fat accumulation and need to reduce their intake of refined staple foods and replace them with brown rice and oats.

[0005] rs1042713 is a genetic variant closely related to energy metabolism and body composition. Located on the ADRB2 (β-2-adrenergic receptor) gene, it is a functional missense mutation. rs1042713 results in a base change (A→G) in exon 16 of the ADRB2 gene, replacing the encoded arginine (Arg) with glycine (Gly), hence it is commonly referred to as the ADRB2 Arg 16 Gly variant. Gly16 carriers may exhibit stronger lipolysis and thermogenesis. Because their ADRB2 receptors are less susceptible to desensitization, adipocytes can break down fat more persistently and efficiently under catecholamine stimulation (lipolysis), and skeletal muscle and brown adipose tissue may also consume energy more efficiently (thermogenesis) (Liggett, SB (2000). Pharmacogenetics of beta-1- and beta-2-adrenergic receptors. Pharmacology, 61(3), 167-173). Theoretically, this is beneficial for weight loss and maintaining body weight. Arg16 carriers, on the other hand, experience weak weight loss effects from regular exercise and require high-intensity exercise to achieve their weight loss goals.

[0006] rs17782313 is another crucial locus in obesity genetics research. It's not located within the coding region of a gene, but rather approximately 188 kb downstream of the MC4R (melanocortin 4 receptor) gene, making it a long-range regulatory element. While rs17782313 itself may not directly alter protein structure, it interacts with the regulatory region of the MC4R gene, affecting its expression level or pattern, thereby interfering with the body's "central controller" of energy balance. The risk allele (C allele) of rs17782313 is associated with higher hunger, stronger food cravings, and weaker satiety. Similar to FTO, carriers of this risk allele show a stronger preference and reward response to high-fat, high-energy, and appealing foods. Therefore, carriers of the risk allele (C allele) receive satiety signals more slowly and are more prone to overeating. It is recommended that they try using smaller bowls for food and drinking a glass of water before each meal to help control their food intake.

[0007] Currently, polymorphism detection technologies mainly include molecular biology techniques such as real-time quantitative PCR (qPCR), gene chips, and next-generation sequencing. Real-time quantitative PCR is flexible, fast, and low-cost, but its throughput is limited; typically, a four-color channel can only detect four mutation types at two polymorphic sites. Gene chips and next-generation sequencing have high throughput, but their detection costs are high, reagent kit development is lengthy, and detection procedures are complex.

[0008] Nucleic acid mass spectrometry is a medium-throughput detection and analysis technique that can analyze 15-30 polymorphic sites at a time. It is low-cost and relatively simple to perform. Therefore, developing detection kits and nucleic acid mass spectrometry methods targeting the aforementioned multiple obesity gene polymorphic sites has become a pressing technical problem in this field. Summary of the Invention

[0009] To address the aforementioned technical problems, this invention first provides a detection kit for obesity gene polymorphism suitable for nucleic acid mass spectrometry, comprising: 5 pairs of primers and 5 corresponding probes; the primers are used to amplify obesity gene polymorphic sites, which include: rs1421085, rs9939609, rs1801282, rs1042713, and rs17782313; the 5 pairs of primers are shown in SEQ ID No. 1-10, and the 5 probes are shown in SEQ ID No. 11-15.

[0010] The forward and reverse primers for detecting rs1421085 are shown in SEQ ID No. 1-2, and the probe is shown in SEQ ID No. 11. The forward and reverse primers for detecting rs9939609 are shown in SEQ ID No. 3-4, and the probe is shown in SEQ ID No. 12; The forward and reverse primers for detecting rs1801282 are shown in SEQ ID No. 5-6, and the probe is shown in SEQ ID No. 13; The forward and reverse primers for detecting rs1042713 are shown in SEQ ID No. 7-8, and the probe is shown in SEQ ID No. 14; The forward and reverse primers for detecting rs17782313 are shown in SEQ ID No. 9-10, and the probe is shown in SEQ ID No. 15.

[0011] In designing primers, this invention discovered that incompatibility issues existed between primers targeting the five loci simultaneously. This incompatibility led to some primers being ineffective in multiplex PCR amplification and extension. Therefore, five pairs of compatible primers were needed to ensure effective amplification of all five loci in multiplex PCR. Through extensive optimization, this invention found that the primers are compatible with each other and achieve high amplification efficiency for all five loci.

[0012] Preferably, the kit is a multiplex PCR kit.

[0013] Preferably, the kit further includes a multiplex PCR mixing solution; the multiplex PCR mixing solution contains DNA polymerase and Mg. 2+ and dNTPs.

[0014] Preferably, the kit further includes a SAP enzyme digestion reaction solution; the SAP enzyme digestion reaction solution contains SAP enzyme and SAP reaction buffer.

[0015] Preferably, the kit further includes a single-base extension reaction solution; the single-base extension reaction solution contains ddNTPs and a single-base extension reaction buffer.

[0016] Furthermore, the present invention provides a method for detecting obesity gene polymorphism, comprising: performing multiplex PCR amplification on the DNA sample to be tested using primers as shown in SEQ ID No. 1-10, performing single base extension reaction using probes as shown in SEQ ID No. 11-15 after SAP enzyme digestion reaction, and detecting the genotypes of the rs1421085, rs9939609, rs1801282, rs1042713 and rs17782313 loci.

[0017] Preferably, the detection method includes: performing multiplex PCR amplification on the DNA sample to be tested using primers shown in SEQ ID No. 1-10 to obtain PCR amplification reaction products; performing SAP enzyme digestion reaction on the PCR amplification reaction products to obtain SAP enzyme digestion reaction products; performing single base extension reaction on the SAP enzyme digestion reaction products using probes shown in SEQ ID No. 11-15; and detecting the single base extension reaction products to obtain polymorphism results at rs1421085, rs9939609, rs1801282, rs1042713, and rs17782313 sites.

[0018] Preferably, the detection method further includes: adding the resin purification solution to the single base extension reaction product for resin purification and centrifugation, taking the supernatant obtained by centrifugation for mass spectrometry detection, and obtaining the polymorphism results of rs1421085, rs9939609, rs1801282, rs1042713 and rs17782313 sites.

[0019] Preferably, the volume of resin purification solution added in each reaction during mass spectrometry detection is 16 μL; the steps of the mass spectrometry detection are as follows: 0.5 μL of matrix is ​​dropped into the middle of the target plate well, and after waiting for at least 5 min to dry completely, 0.7 μL of supernatant is added, and after waiting for 20 min to dry completely and crystallize, the sample is analyzed.

[0020] Preferably, in the multiplex PCR amplification reaction system, the concentration of the sample to be tested is 1 ng / μL-200 ng / μL, and the working concentration of the primers is 0.1 μM-0.4 μM; the reaction conditions for the multiplex PCR amplification are: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 30 seconds, 58℃-60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for 40 cycles; and 72℃ final extension for 5 minutes. And / or, the conditions for the SAP enzyme digestion reaction are: incubation at 37°C for 30 minutes, followed by enzyme inactivation at 85°C for 5 minutes; And / or, in the reaction system of the single-base extension reaction, the concentration of the probe is 0.5 μM - 1 μM; the reaction conditions of the single-base extension reaction are: pre-denaturation at 95 °C for 30 seconds; denaturation at 95 °C for 5 seconds, cycled 5 times; annealing at 52 °C for 5 seconds and extension at 80 °C for 5 seconds, cycled 5 times; the total reaction of denaturation, annealing and extension is cycled 40 times; final extension at 72 °C for 3 minutes.

[0021] In some implementations, the detection method further includes: predicting the risk of genetically associated obesity based on obesity gene polymorphism; the specific method is as follows: if more than 4 loci in the detection results are obesity genotypes, it indicates that there is a risk of genetically associated obesity.

[0022] Specifically: when the genotype at rs1421085 is CC or CT, it is determined to be an obesity genotype; when the genotype at rs9939609 is AA or AT, it is determined to be an obesity genotype; when the genotype at rs1801282 is CC or CG, it is determined to be an obesity genotype; when the genotype at rs1042713 is AA or AG, it is determined to be an obesity genotype; when the genotype at rs17782313 is CC or CT, it is determined to be an obesity genotype.

[0023] In some implementations, the DNA sample to be tested may be derived from exfoliated cells from the human oral cavity.

[0024] In some implementation schemes, the causes of obesity are determined based on the genotyping results of polymorphic sites, and corresponding measures that can be taken to lose weight are provided.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention develops a detection kit and nucleic acid mass spectrometry detection method for simultaneously detecting obesity gene polymorphism sites rs1421085, rs9939609, rs1801282, rs1042713, and rs17782313. It can rapidly detect ten genotypes at five polymorphic sites simultaneously, making genetic testing for obesity-related polymorphism sites more convenient and with high sample throughput. This provides better technical support for obesity gene testing and helps to provide better suggestions for personal weight loss plans. Attached Figure Description

[0026] Figure 1 This is a simplified diagram of the experimental operation for the test examples of the present invention.

[0027] Figure 2 This is the nucleic acid mass spectrum of sample 01.

[0028] Figure 3 This is the nucleic acid mass spectrum of sample 02.

[0029] Figure 4 This is the nucleic acid mass spectrum of sample 03.

[0030] Figure 5 This is the nucleic acid mass spectrum of sample 04.

[0031] Figure 6 This is the nucleic acid mass spectrum of sample 05.

[0032] Figure 7 The nucleic acid mass spectrum was detected after amplification by mixing rs1421085-0F / rs1421085-0R with four other primer pairs.

[0033] Figure 8The nucleic acid mass spectrum was detected after amplification by mixing rs9939609-0F / rs9939609-0R with four other primer pairs. Detailed Implementation

[0034] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0035] In the embodiments provided in this specification, unless specific techniques or conditions are specified, the techniques or conditions described in the literature in this field, or the product instructions, shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0036] This invention relates to molecular biology experiments. Unless otherwise specified, reference can be made to the book *Molecular Cloning* (J. Sambrook, E.F. Fritsch, and T. Maniatis, Science Press, 1994). This book and its subsequent editions are the most commonly used and guiding reference books for those skilled in the art when performing experiments related to molecular biology. In addition, depending on the experimental purpose, those skilled in the art complete the corresponding experiments under the guidance of the operating manuals accompanying various commercial reagent kits or entrust them to specialized companies, such as primer synthesis and gene sequencing.

[0037] Example 1 This embodiment provides a kit for detecting obesity gene polymorphism, comprising: 5 pairs of primers and 5 corresponding probes; the primers are used to amplify obesity gene polymorphic sites, including: rs1421085, rs9939609, rs1801282, rs1042713, and rs17782313; the 5 pairs of primers are shown in SEQ ID No. 1-10 (Table 1), and the 5 probes are shown in SEQ ID No. 11-15 (Table 2). The kit also includes a multiplex PCR mixing solution; the multiplex PCR mixing solution contains DNA polymerase and Mg 2+ The kit also includes dNTPs. The SAP enzyme digestion reaction solution contains SAP enzyme and SAP reaction buffer (Beijing Xinhui Pury Biotechnology Co., Ltd., XH202502). The kit also includes a single-base extension reaction solution containing ddNTPs and single-base extension reaction buffer (Beijing Xinhui Pury Biotechnology Co., Ltd., XH202502).

[0038] Table 1

[0039] Table 2

[0040] Specifically: rs1421085 is located at position 60 of the sequence shown in SEQ ID No. 16, with a base polymorphism of T / C; rs9939609 is located at position 60 of the sequence shown in SEQ ID No. 17, with a base polymorphism of A / T; rs1801282 is located at position 60 of the sequence shown in SEQ ID No. 18, with a base polymorphism of C / G; rs1042713 is located at position 60 of the sequence shown in SEQ ID No. 19, with a base polymorphism of A / G; and rs17782313 is located at position 60 of the sequence shown in SEQ ID No. 20, with a base polymorphism of T / C. SNP sites in the following sequences are marked in bold.

[0041] SEQ ID No. 16: GCTACTTAAAATAAAGGTAATATTGATTTTATAGTAGCAGTTCAGGTCCTAAGGCATGATATTGATTAAGTGTCTGATGAGAATTTGTAGGGGTAGTCTCCCAGACCTGCAGCTACAGGGCA SEQ ID No. 17: GTTATGCATTTAGAATGTCTGAATTATTATTCTAGGTTCCTTGCGACTGCTGTGAATTTTGTGATGCACTTGGATAGTCTCTGTTACTCTAAAGTTTTAATAGGTAACAGTCAGAAATGGA SEQ ID No. 18: ACAGCAAACCCCTATTCCATGCTGTTATGGGTGAAACTCTGGGAGATTCTCCTATTGACCCAGAAAGCGATTCCTTCACTGATACACTGTCTGCAAACATATCACAAGGTAAAGTTCCTTC SEQ ID No. 19: CCAGACTGCGCGCCATGGGGCAACCCGGGAACGGCAGCGCCTTCTTGCTGGCACCCAATGGAAGCCATGCGCCGGACCACGACGTCACGCAGGAAAGGGACGAGGTGTGGGTGGTGGGCAT SEQ ID No. 20: TGTGAGCATCTTTAATGACTACAACATTATAGAAGTTTAAAGCAGGAGAGATTGTATCCTGATGGAAATGACAAGAAAAGCTTCAGGGGGAAGGTGACATTTAAGTTGGAATATTATTGAG Comparative Example 1 This comparative example provides a kit for detecting obesity gene polymorphism, which differs from Example 1 only in that: Replace the forward primer of the multiplex PCR reaction for rs1421085 with rs1421085-0F, the sequence of which is: ACGTTGGATGCATGGCAGACTTGTAAGGAACACGTTGGATGGCAGGAGATGACACACACC (SEQ IDNo. ​​21), The reverse primer was changed to rs1421085-0R, and its sequence is as follows: ACGTTGGATGAGACTACCCTACAAATTCTCATC (SEQ ID No. 22).

[0042] Comparative Example 2 This comparative example provides a kit for detecting obesity gene polymorphism, which differs from Example 1 only in that: Replace the forward primer of the multiplex PCR reaction of rs9939609 with rs9939609-0F, the sequence of which is: ACGTTGGATGGCTATGGTTCTACAGTTCCAG (SEQ ID No. 23), The reverse primer was changed to rs9939609-0R, and its sequence is as follows: ACGTTGGATGGCTCTCCCACTCATTTCTGA (SEQ ID No. 24).

[0043] Test case This experiment collected genomic DNA from 20 human oral samples. Using the kits described in the above examples and comparative examples, nucleic acid mass spectrometry was used to detect five obesity-related polymorphic sites. A simplified diagram of the experimental procedure is shown below. Figure 1As shown, the steps are as follows: I. Sample Collection Remove the swab from the sterile packaging, avoiding touching the swab head (cotton swab / flocked part) with your hands. Ask the subject to open their mouth wide. Place the swab head firmly against the mucous membrane of the inside of one cheek. Using moderate pressure, vigorously rotate and scrape from top to bottom (or bottom to top) along the inside of the mouth 20-30 times (approximately 30-60 seconds). The scraping area should be large enough to ensure contact with the entire buccal mucosa area (including top and bottom, front and back). Repeat the same scraping process 20-30 times on the other cheek using the same swab. Multiple scrapings can also be made at different locations on the inside of the mouth (e.g., sides, top and bottom) to ensure sufficient cell count. During the scraping process, the swab should avoid contact with the tongue, teeth, saliva, and lips to reduce bacterial and food residue contamination. Break off the swab head and place it in DNA sample preservation solution (Beijing Xinhui Pury Technology Development Co., Ltd., product number: XH202511).

[0044] II. Nucleic Acid Purification DNA was extracted from the samples using an oral swab genomic DNA extraction kit (Shanghai Sangon Biotech Co., Ltd., product number: XH202511).

[0045] III. Multiplex PCR Amplification Remove the multiplex PCR reaction reagent from the universal nucleic acid mass spectrometry reagent kit (Beijing Xinhui Pury Biotechnology Co., Ltd., XH202502) from -20℃ and thaw it at room temperature. Prepare the PCR reaction system according to Table 3 based on the actual number of samples, and perform thermal cycling as shown in Table 4.

[0046] Table 3

[0047] Table 4

[0048] IV. Shrimp alkaline phosphatase (SAP) digestion reaction Remove the SAP reaction reagent from the general reagent for nucleic acid mass spectrometry from -20℃ and thaw it at room temperature. After the multiplex PCR reaction is completed, prepare the SAP reaction system as shown in Table 5 and the SAP reaction conditions as shown in Table 6.

[0049] Table 5

[0050] Table 6

[0051] V. Single-base extension reaction Remove the single-base extension reaction reagent from the general reagent for nucleic acid mass spectrometry from -20℃ and thaw it at room temperature. After the SAP reaction is completed, the PCR single-base extension reaction system is shown in Table 7 below, and the single-base extension reaction conditions are shown in Table 8 below.

[0052] Table 7

[0053] Table 8

[0054] VI. Mass Spectrometry Detection (1) Resin purification 1. Add resin purification solution: Shake the resin purification solution in the general reagent for nucleic acid mass spectrometry to mix well, add 18 μL for each reaction; the resin settles easily, so shake to mix again every 5 seconds; 2. Purification: Place the sample in a vortex mixer and mix at 20 rpm for 30 min; 3. Centrifugation: After the centrifugation is complete, centrifuge at 2000 rpm for 1 min, and the supernatant is ready for testing.

[0055] (2) Spotting Take out the matrix from the universal reagent for nucleic acid mass spectrometry, add 0.5 μL of matrix to the center of the target plate well, wait at least 20 min for complete drying, add 0.7 μL of supernatant, wait at least 20 min for complete drying and crystallization, and then perform the analysis.

[0056] The test results are shown in Table 9.

[0057] Table 9

[0058] Note: Risk genotypes are marked in italics and bold; overweight individuals are marked in bold.

[0059] BMI (Body Mass Index), formula: weight (kg) / height 2 (m) 2 ) Classification (WHO criteria): <18.5: Underweight; 18.5–24.9: Normal range; 25.0–29.9: Overweight; ≥30: Obese.

[0060] Test Result Analysis: The kit described in Example 1 was used to detect DNA from different samples, and the results were compared with those of the "gold standard" sequencing. The nucleic acid mass spectra of samples 1-5 are shown below. Figures 2-6 The results showed that the sequencing results were consistent with the detection results of the present invention, which proves the reliability and accuracy of the detection results of the present invention.

[0061] In Comparative Example 1, the replaced rs1421085-0F / rs1421085-0R primers were ineffective in multiplex PCR amplification extension. When rs1421085-0F / rs1421085-0R were mixed with the other four primer pairs for amplification, the rs1421085 site probe failed to extend. The nucleic acid mass spectrum detected after mixing rs1421085-0F / rs1421085-0R with the other four primer pairs is as follows. Figure 7 As shown, this primer pair is incompatible with the other four primer pairs.

[0062] In Comparative Example 2, the replaced rs9939609-0F / rs9939609-0R primers were ineffective in multiplex PCR amplification extension. When rs9939609-0F / rs9939609-0R were mixed with the other four primer pairs for amplification, the rs9939609 site probe failed to extend. The nucleic acid mass spectrum detected after mixing rs9939609-0F / rs9939609-0R with the other four primer pairs is as follows. Figure 8 As shown, this primer pair is incompatible with the other four primer pairs.

[0063] In summary, the inheritance of obesity is a typical quantitative trait inheritance, a complex trait resulting from the combined effects of multiple genes (polygenes) and environmental factors (such as diet, exercise, and lifestyle), rather than being determined by a single gene. In modern life, with its abundant diets, obesity-related genes easily lead to overweight or obesity. Conversely, in times of food scarcity, obesity-related genes could help reduce energy expenditure, facilitating energy storage and thus improving survival. The test results from the 20 samples above show that each normal individual carries 2-3 obesity risk loci among the five obesity risk-related loci we tested. We defined carrying 4 or more obesity risk loci as indicating a genetically linked obesity. Of the 20 samples tested, 8 individuals (samples 2, 4, 11, 15, 16, 17, 19, and 20) had a BMI ≥ 25.0, classifying them as overweight. Among these 8 overweight samples, 3 individuals (samples 2, 17, and 19) were found to carry 4 or more obesity risk loci. In this test, 37.5% of the detected obesity cases showed a strong genetic association.

[0064] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A kit for detecting obesity gene polymorphism, characterized in that, include: 5 pairs of primers and 5 corresponding probes; The primers are used to amplify obesity gene polymorphic sites, which include: rs1421085, rs9939609, rs1801282, rs1042713 and rs17782313; the five primer pairs are shown in SEQ ID No. 1-10, and the five probes are shown in SEQ ID No. 11-15.

2. The obesity gene polymorphism detection kit according to claim 1, characterized in that, The forward and reverse primers for detecting rs1421085 are shown in SEQ ID No. 1-2, and the probe is shown in SEQ ID No. 11; The forward and reverse primers for detecting rs9939609 are shown in SEQ ID No. 3-4, and the probe is shown in SEQ ID No. 12; The forward and reverse primers for detecting rs1801282 are shown in SEQ ID No. 5-6, and the probe is shown in SEQ ID No. 13; The forward and reverse primers for detecting rs1042713 are shown in SEQ ID No. 7-8, and the probe is shown in SEQ ID No. 14; The forward and reverse primers for detecting rs17782313 are shown in SEQ ID No. 9-10, and the probe is shown in SEQ ID No.

15.

3. The obesity gene polymorphism detection kit according to claim 1 or 2, characterized in that, The kit is a multiplex PCR kit.

4. The obesity gene polymorphism detection kit according to claim 3, characterized in that, The kit further comprises a multiplex PCR mixed reaction solution; the multiplex PCR mixed reaction solution contains DNA polymerase, Mg 2+ and dNTPs.

5. The obesity gene polymorphism detection kit according to claim 4, characterized in that, The kit also includes an SAP enzyme digestion reaction solution; the SAP enzyme digestion reaction solution contains SAP enzyme and SAP reaction buffer.

6. The obesity gene polymorphism detection kit according to any one of claims 3 to 5, characterized in that, The kit also includes a single-base extension reaction solution; the single-base extension reaction solution contains ddNTPs and a single-base extension reaction buffer.

7. A method for detecting obesity gene polymorphism, characterized in that, include: The DNA samples to be tested were amplified by multiplex PCR using primers shown in SEQ ID No. 1-10. After SAP enzyme digestion, single base extension was performed using probes shown in SEQ ID No. 11-15 to detect the genotypes at the rs1421085, rs9939609, rs1801282, rs1042713 and rs17782313 loci.

8. The detection method according to claim 7, characterized in that, include: The DNA sample to be tested was subjected to multiplex PCR amplification using primers shown in SEQ ID No. 1-10 to obtain the PCR amplification reaction product; The PCR amplification product was digested with SAP enzyme to obtain the SAP enzyme digestion product; the SAP enzyme digestion product was then subjected to single-base extension reaction using the probes shown in SEQ ID No. 11-15, and the single-base extension product was detected to obtain polymorphism results at rs1421085, rs9939609, rs1801282, rs1042713 and rs17782313 sites. Preferably, the detection method further includes: adding the resin purification solution to the single base extension reaction product for resin purification and centrifugation, taking the supernatant obtained by centrifugation for mass spectrometry detection, and obtaining the polymorphism results of rs1421085, rs9939609, rs1801282, rs1042713 and rs17782313 sites.

9. The detection method according to claim 8, characterized in that, In the reaction system of the multiplex PCR amplification, the concentration of the sample to be tested is 1 ng / μL-200 ng / μL, and the working concentration of the primers is 0.1 μM-0.4 μM; the reaction conditions of the multiplex PCR amplification are: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 30 seconds, 58℃-60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for 40 cycles; 72℃ final extension for 5 minutes. And / or, the conditions for the SAP enzyme digestion reaction are: incubation at 37°C for 30 minutes, followed by enzyme inactivation at 85°C for 5 minutes; And / or, in the reaction system of the single-base extension reaction, the concentration of the probe is 0.5 μM - 1 μM; the reaction conditions of the single-base extension reaction are: pre-denaturation at 95 °C for 30 seconds; denaturation at 95 °C for 5 seconds, cycled 5 times; annealing at 52 °C for 5 seconds and extension at 80 °C for 5 seconds, cycled 5 times; the total reaction of denaturation, annealing and extension is cycled 40 times; final extension at 72 °C for 3 minutes.

10. The detection method according to any one of claims 7 to 9, characterized in that, Also includes: Predicting genetically associated obesity risk based on obesity gene polymorphism; the specific method is as follows: if more than 4 loci in the test results are obesity genotypes, it indicates that there is a genetically associated obesity risk.

Images