A microdroplet digital PCR primer probe set for detecting monkey toxoplasma and application thereof

Abstract

This invention provides a droplet-based digital PCR primer-probe set for detecting *Toxoplasma gondii* and its applications, belonging to the field of molecular biology. This invention targets the conserved region of the *Toxoplasma gondii* SAG1 gene, designing and screening a specific primer-probe set. The forward primer sequence is shown in SEQ ID NO:1, the reverse primer sequence in SEQ ID NO:2, and the probe sequence in SEQ ID NO:3. This invention constructs a reaction system with the nucleic acid of the sample to be tested, the primer-probe set, and a PCR premix. After dropletization or loading onto a digital PCR chip, amplification is performed, and absolute quantification is achieved through positive droplet counting and Poisson distribution. The detection method of this invention has high sensitivity, strong specificity, and good repeatability. This invention provides an efficient and reliable technical means for the early diagnosis, detection of low-load samples, and quantitative monitoring of *Toxoplasma gondii* infection.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically a droplet-type digital PCR primer and probe set for detecting Toxoplasma gondii and its application. Background Technology

[0002] Toxoplasma gondii is an obligate intracellular parasitic protozoan that can infect almost all warm-blooded animals, including humans and non-human primates, making it an important zoonotic pathogen. In monkey populations, Toxoplasma gondii infection can lead to serious health problems such as abortion, stillbirth, neurological dysfunction, and even death, posing a serious threat to the welfare of laboratory monkeys, the reliability of scientific research results, and the protection of endangered primates. Currently, laboratory diagnostic methods for Toxoplasma gondii mainly include etiological examination, serological testing, and molecular biological testing. Etiological examination, such as tissue sections or animal inoculation, is considered the "gold standard," but it is cumbersome, time-consuming, and has low sensitivity, making it unsuitable for routine diagnosis. Serological methods such as ELISA and IHA are widely used in epidemiological surveys, but they cannot distinguish between current and past infections, and low antibody titers may occur in immunosuppressed individuals or those in the early stages of infection, leading to missed detections.

[0003] The surface antigen 1 (SAG1) gene of *Toxoplasma gondii* is its main surface protein encoding gene, highly expressed during the tachyzoite stage, and possesses good immunogenicity and intraspecific conservation, making it one of the ideal targets for *Toxoplasma gondii* detection. Molecular biology detection techniques, especially PCR-based methods, have become the mainstream technology for *Toxoplasma gondii* detection due to their high sensitivity and specificity. Conventional PCR and its derivative techniques (such as nested PCR) are widely used, but their quantitative capabilities are limited and they are susceptible to the effects of PCR inhibitors, leading to biased results. Real-time quantitative PCR (qPCR) achieves relative quantification of nucleic acid templates with high sensitivity, but its quantitative results depend on a standard curve, and the accuracy and repeatability of absolute quantification are easily affected by the quality of standards and amplification efficiency.

[0004] Digital PCR (dPCR) is a third-generation PCR technology that has emerged in recent years. Its principle involves distributing a traditional PCR reaction into tens of thousands of microreaction units, each containing zero or several target molecules. A final PCR amplification is then performed, and the absolute quantification of nucleic acid molecules is achieved by counting the number of positive droplets using the Poisson distribution principle, without relying on a standard curve. This technical characteristic gives dPCR significant advantages in detecting low-copy pathogens, analyzing subtle differential expression, and detecting rare mutations in complex backgrounds. Compared to qPCR, dPCR has higher tolerance, effectively resists interference from PCR inhibitors, and offers better accuracy in detecting complex matrix samples (such as feces and tissue homogenates).

[0005] Therefore, establishing a rapid, accurate, and highly sensitive method for detecting Toxoplasma gondii in monkeys is of vital importance for health monitoring, disease control, and biosafety assessment of monkey populations. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to provide a droplet-type digital PCR primer and probe set for detecting Toxoplasma gondii and its application, wherein the primer and probe set is highly sensitive, specific and reproducible for detecting Toxoplasma gondii.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a droplet-based digital PCR primer and probe set for detecting Toxoplasma gondii in monkeys. The primer and probe set includes a forward primer, a reverse primer, and a probe. The nucleotide sequence of the forward primer is shown in SEQ ID NO: 1; the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 2; and the nucleotide sequence of the probe is shown in SEQ ID NO: 3.

[0008] Preferably, the working concentrations of the forward primer, reverse primer, and probe are all 10 μM.

[0009] The present invention also provides a droplet-based digital PCR kit for detecting Toxoplasma gondii, the kit comprising the aforementioned primer and probe set.

[0010] Preferably, the kit further includes digital PCR reaction premix, positive control, negative control, nuclease-free water, digital PCR biochip, and chip sealing oil.

[0011] The present invention also provides a detection system for Toxoplasma gondii droplet digital PCR, the detection system comprising the aforementioned primer and probe set.

[0012] Preferably, the total volume of the detection system is 15-25 μL, which includes: 8-12 μL of 2×PCR premix, 0.6-2.0 μL of 10 μM forward primer, 0.6-2.0 μL of 10 μM reverse primer, 0.6-1.8 μL of 10 μM probe, 1-5 μL of template nucleic acid, and the remainder is nuclease-free water.

[0013] This invention also provides a droplet-based digital PCR detection method for Toxoplasma gondii, comprising the following steps: Nucleic acid is extracted from the sample to be tested; using the extracted nucleic acid as a template, a digital PCR detection system is constructed using the primer and probe set; the detection system is microdropletized or loaded onto a digital PCR chip for digital PCR amplification; after amplification, the fluorescence signal is read, and absolute quantitative analysis is performed based on the number of positive droplets or positive microreaction units according to the Poisson distribution.

[0014] Preferably, the digital PCR amplification program is as follows: 95℃ pre-denaturation for 2-5 min; 95℃ denaturation for 5-15 s; 56-61℃ annealing and extension for 10-50 s; for a total of 35-45 cycles.

[0015] More preferably, the digital PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s; 58℃ annealing extension for 20 s; for a total of 42 cycles.

[0016] The present invention also provides the application of the primer probe set, the kit, the detection system, or the detection method described herein in the preparation of products for detecting Toxoplasma gondii.

[0017] Compared with the prior art, the present invention has the following advantages: (1) This invention is based on a droplet digital PCR platform. By partitioning and amplifying the conserved target region of the Toxoplasma gondii SAG1 gene and counting endpoints, it greatly improves the detection probability of low-copy templates. Experimental results show that the detection limit of the method of this invention can stably reach 1 copy / μL, while the detection limit of the conventional PCR method under the same primer conditions is only 100 copies / μL, which is two orders of magnitude higher in sensitivity. This advantage enables this invention to effectively detect monkey samples in the early stage of infection or with extremely low viral load, avoiding the risk of disease transmission due to missed detection.

[0018] (2) This invention designs and screens the optimal TG-SAG3 primer-probe set targeting the conserved region of the SAG1 gene, combined with an optimized detection system, to perform parallel detection of Toxoplasma gondii DNA and DNA from 11 common non-target pathogens, including Brucella ovis, Plasmodium malariae, and Campylobacter jejuni. The results showed a significant positive signal only in the Toxoplasma gondii sample; the other pathogens and negative controls showed no effective amplification, demonstrating the high species specificity of this invention. Furthermore, since digital PCR uses the absolute quantification principle, it directly substitutes the number of positive droplets into the Poisson distribution to calculate the target molecule concentration, completely eliminating the need for a standard curve. This avoids the quantitative deviation introduced by real-time quantitative PCR due to differences in standard quality and fluctuations in amplification efficiency. Within 10... 0 -10 4 It can provide stable and reliable quantitative results in the range of copies / μL.

[0019] (3) The present invention is used in samples with different concentration gradients (102 10 3 10 4 In validation tests at different concentrations (copies / μL) and storage times (days 0, 7, and 14), the coefficients of variation (CV) for all concentrations were below 15%, with the CV for high-concentration samples being only 6.5%, indicating good intra-batch consistency and time stability. After storing the kit at 4°C for 14 days, no significant performance degradation was observed, indicating that the reaction system is easy to store and transport, facilitating standardized promotion. Regarding amplification efficiency, optimizing the annealing extension time to 20 seconds ensured sufficient amplification product accumulation (lowest average Ct value) while effectively shortening the total time for a single detection, thus increasing throughput. In summary, this invention provides a sensitive, specific, stable, and convenient technique for early diagnosis, low-load monitoring, complex sample analysis, and quantitative assessment of Toxoplasma gondii infection in monkeys. Attached Figure Description

[0020] Figure 1 This is a real-time fluorescence amplification curve of three primer combinations.

[0021] Figure 2 Real-time fluorescence amplification curves for different primer addition amounts.

[0022] Figure 3 Real-time fluorescence amplification curves for different probe addition amounts.

[0023] Figure 4 The amplification curve is shown at an annealing temperature of 56 degrees Celsius.

[0024] Figure 5 The amplification curve is shown at an annealing temperature of 57 degrees Celsius.

[0025] Figure 6 The amplification curve is shown at an annealing temperature of 58 degrees Celsius.

[0026] Figure 7 The amplification curve is shown at an annealing temperature of 59 degrees Celsius.

[0027] Figure 8 The amplification curve is shown at an annealing temperature of 60 degrees Celsius.

[0028] Figure 9 The amplification curve is shown at an annealing temperature of 61 degrees Celsius.

[0029] Figure 10 The amplification curve is for an annealing extension time of 10 seconds.

[0030] Figure 11 The amplification curve is for an annealing extension time of 20 seconds.

[0031] Figure 12The amplification curve is for an annealing extension time of 30 seconds.

[0032] Figure 13 The amplification curve is for an annealing extension time of 40 seconds.

[0033] Figure 14 The amplification curve is for an annealing extension time of 50 seconds.

[0034] Figure 15 The figure shows the sensitivity detection results of the detection method of the present invention. The figure is a scatter plot of three sets of repeated droplets.

[0035] Figure 16 This is the specific detection result of the detection method of the present invention.

[0036] Figure 17 The figure shows the reagent stability verification results of the detection method of the present invention. The figure is a scatter plot of three sets of repeated microdroplets.

[0037] Figure 18 This is a PCR sensitivity electrophoresis image; the lanes from left to right in the image are M: DL2000 DNA Marker, 1:10. 6 copies / μL, 2:10 5 copies / μL, 3:10 4 copies / μL, 4:10 3 copies / μL, 5:10 2 copies / μL, 6:10 1 copies / μL, 7:10 0 copies / μL, 8: negative control.

[0038] Figure 19 This is an electrophoresis image for routine PCR specific detection; from left to right, the lanes are: M: DL2000 DNA Marker, 1: Toxoplasma gondii DNA, 2: Brucella ovis DNA, 3: Plasmodium malariae DNA, 4: Campylobacter jejuni DNA, 5: Yersinia enterocolitica DNA, 6: Shigella flexneri DNA, 7: Shigella dysenteriae DNA, 8: Salmonella DNA, 9: Enterotoxigenic Escherichia coli DNA, 10: Enteroaggregative Escherichia coli DNA, 11: Enterohemorrhagic Escherichia coli DNA, 12: Negative control. Detailed Implementation

[0039] This invention provides a droplet-based digital PCR primer and probe set for detecting *Toxoplasma gondii*, comprising a forward primer, a reverse primer, and a probe. The nucleotide sequence of the forward primer is TCAAGTGCCCTAAAACAGCG (SEQ ID NO: 1); the nucleotide sequence of the reverse primer is GGAGCTCAATGTTACAGCCTTT (SEQ ID NO: 2); and the nucleotide sequence of the probe is CACAGAGCCTCCCACTCTTGCGT (SEQ ID NO: 3). Based on the *Toxoplasma gondii* gene sequence (GenBank accession number: MK403957.1), this invention uses the conserved region of the SAG1 gene within this sequence as the detection target. The nucleic acid sequence is shown in SEQ ID NO: 10, synthesized by General Anhui Co., Ltd., and ligated into the pUC57-Amp vector. This invention avoids sequence mutation sites within the conserved region of this gene and designs three sets of specific primers and a TaqMan fluorescent probe.

[0040] Preferably, the working concentrations of the forward primer, reverse primer, and probe are all 10 μM.

[0041] This invention also provides a droplet-based digital PCR kit for detecting *Toxoplasma gondii*, the kit comprising the aforementioned primer and probe set. Preferably, the kit further comprises a digital PCR reaction premix, a positive control, a negative control, nuclease-free water, a digital PCR biochip, and chip sealing oil. The digital PCR reaction premix can be a commercially available reagent, such as the 2×PCR Mix from the digital PCR detection kit produced by Beijing Meilaibo Medical Technology Co., Ltd. This premix pre-contains hot-start Taq DNA polymerase, dNTPs, MgCl2, and a reaction buffer optimized for TaqMan probes; only primers, probes, and template need to be added during use. The positive control is a positive plasmid containing the *Toxoplasma gondii* SAG1 gene target sequence. This plasmid is obtained by cloning the amplified regions corresponding to SEQ ID NO:1 to SEQ ID NO:3 into the pUC57-Amp vector, and after sequencing verification, it is diluted to a predetermined concentration with TE buffer to verify the reaction effectiveness of the kit and as a quantitative reference. Negative controls are double-distilled water free of Toxoplasma gondii nucleic acid or genomic DNA extracted from healthy monkey tissue, used to monitor for contamination in the reaction system. DNase / RNase-free water is used to prepare the reaction system and dilute samples, ensuring no nucleic acid contamination. The digital PCR biochip and chip sealing oil are specialized consumables adapted to the droplet-based digital PCR platform, using chips and sealing oil manufactured by Zhenzhun Biotechnology (Shanghai) Co., Ltd. or similar manufacturers. The biochip is a pre-fabricated microporous array structure that automatically distributes the reaction system into tens of thousands of independent microreaction units. The chip sealing oil covers the chip to prevent evaporation of the reaction solution and ensure the stability of the microunits.

[0042] This invention also provides a Toxoplasma gondii droplet digital PCR detection system, which includes the aforementioned primer and probe set. The total volume of the Toxoplasma gondii droplet digital PCR detection system of this invention can be adjusted between 15 μL and 25 μL according to actual detection needs and consumable specifications, preferably between 18 μL and 22 μL, and most preferably between 20 μL. This detection system mainly includes digital PCR reaction premix, specific primers, fluorescent probes, nucleic acid template from the sample to be tested, and nuclease-free water for replenishment. Specifically, the amount of 2× digital PCR reaction premix added is 8 μL to 12 μL, preferably 9 μL to 11 μL, and most preferably 10 μL, occupying about half of the reaction system, which can provide sufficient enzyme and ion environment for the amplification reaction. Both the forward and reverse primers targeting the SAG1 gene were added in 10 μM working solution, with the amount added ranging from 0.6 μL to 2.0 μL, corresponding to a final concentration of approximately 0.3 μM to 1.0 μM. System optimization revealed that the amount of primers added had little impact on the cycle threshold. However, to balance amplification signal intensity and reagent cost, it was preferable to add 1.0 μL to 1.6 μL of each primer, with the optimal addition being 1.2 μL of each primer. At this point, the final concentration was approximately 0.6 μM, which resulted in stable and efficient amplification. The fluorescent probe was also added in 10 μM working solution, with the addition volume adjustable between 0.6 μL and 1.8 μL, corresponding to a final concentration of approximately 0.3 μM to 0.9 μM. Experiments showed that when the probe addition volume was 1.6 μL (final concentration approximately 0.8 μM), the average cycle threshold of the amplification curve was the lowest (20.28), and the fluorescence signal was the strongest. Therefore, 1.6 μL is the optimal addition volume, while 1.2 μL to 1.8 μL is a relatively favorable range. The amount of template nucleic acid added depends on the concentration and purity of the sample nucleic acid extraction solution, generally 1 μL to 5 μL, preferably 1.5 μL to 3 μL, and most preferably 2 μL, to ensure sufficient target molecule input while avoiding the introduction of excessive PCR inhibitors. After adding the above components, nuclease-free water was used to bring the total volume to the set level, so that the concentration of each component reached the working concentration. The entire system can be prepared on ice, thoroughly mixed, and briefly centrifuged before use for droplet generation or chip loading. The detection system has been systematically optimized and validated for primers, probes, annealing temperature, and extension time. It can reliably amplify and absolutely quantify Toxoplasma gondii nucleic acid in a wide volume range of 15 μL to 25 μL, with the 20 μL system showing the most stable performance.

[0043] This invention also provides a droplet-based digital PCR detection method for Toxoplasma gondii, wherein the detection method preferably includes the following steps: Nucleic acid is extracted from the sample to be tested; using the extracted nucleic acid as a template, a digital PCR detection system is constructed using the primer and probe set; the detection system is microdropletized or loaded onto a digital PCR chip for digital PCR amplification; after amplification, the fluorescence signal is read, and absolute quantitative analysis is performed based on the number of positive droplets or positive microreaction units according to the Poisson distribution.

[0044] In a specific embodiment of the present invention, nucleic acid extraction from the sample to be tested is first performed. Monkey samples are taken, which can be selected from whole blood, serum, tissue homogenate, or fecal supernatant, and the extraction is performed according to the instructions of a commercially available nucleic acid extraction kit. Alternatively, the classic phenol-chloroform extraction method or magnetic bead method can be used to extract total DNA. The concentration and purity of the extracted nucleic acid are determined using a UV spectrophotometer, and the nucleic acid samples can be stored at -20℃ for later use or directly used for subsequent detection. Subsequently, a digital PCR detection system is constructed using the selected optimal TG-SAG3 primer and probe set. In a clean PCR tube or dedicated sample well, add the following components sequentially for every 20 μL of reaction mixture: 10 μL of 2× digital PCR premix, 1.2 μL of 10 μM forward primer (SEQ ID NO:1), 1.2 μL of 10 μM reverse primer (SEQ ID NO:2), 1.6 μL of 10 μM probe (SEQ ID NO:3), 2 μL of extracted nucleic acid template from the sample to be tested, and finally bring the volume to 20 μL with nuclease-free water. Avoid generating air bubbles during sample addition. After addition, gently mix the mixture by pipetting or briefly vortexing followed by instant centrifugation to collect the reaction solution at the bottom of the tube. Transfer the prepared PCR reaction solution to the sample wells of a digital PCR chip, or prepare water-in-oil droplets by combining the reaction solution with droplet-generating oil using a droplet generator. For example, when using the digital PCR platform of Zhenzhun Biotechnology (Shanghai) Co., Ltd., 20 μL of reaction solution is pipetted into the corresponding well of the biochip and covered with 30 μL of chip sealing oil. The chip is then placed in a sealing container for compression sealing, ensuring that each microreaction unit is independently sealed. After chip encapsulation or microdroplet generation, the chip or microdroplet plate is placed on a digital PCR amplification instrument for PCR amplification. The amplification program is set as follows: 95℃ pre-denaturation for 3 minutes; then 42 cycles of 95℃ denaturation for 10 seconds and 58℃ annealing extension for 20 seconds, with FAM fluorescence signals collected during the extension phase of each cycle. After amplification, the chip or microdroplet plate is transferred to a digital PCR reader, which automatically reads the endpoint fluorescence intensity of each microreaction unit and determines whether each microreaction unit is positive or negative using a built-in algorithm. The system records the total number of positive microdroplets or positive microreaction units and calculates the absolute copy number of the target nucleic acid molecules in the original sample based on the Poisson distribution principle, finally outputting the quantitative results in copies / μL. Based on this quantitative result, it can be determined whether Toxoplasma gondii nucleic acid is present in the sample and its load, thus achieving absolute quantitative detection of Toxoplasma gondii infection. The entire detection process can be completed within 2-3 hours, with good operability and result stability.

[0045] In this invention, the preferred digital PCR amplification program is: 95℃ pre-denaturation for 2-5 min; 95℃ denaturation for 5-15 s; 56-61℃ annealing and extension for 10-50 s; for a total of 35-45 cycles.

[0046] In the microdroplet digital PCR detection method for *Toxoplasma gondii* of this invention, the digital PCR amplification program settings directly affect the amplification efficiency of the target molecule, the detection sensitivity, and the reproducibility of the results. Through system optimization, this invention provides a preferred range of amplification program parameters and further optimized parameters within this range. Specifically, the amplification program first includes a pre-denaturation step, the purpose of which is to completely denature the template DNA in the reaction system into single strands, while simultaneously activating the activity of hot-start DNA polymerase. The pre-denaturation temperature is preferably 95°C, and the time can be selected between 2 and 5 minutes, more preferably 3 minutes. After pre-denaturation, the cyclic amplification stage begins, with each cycle including two steps: high-temperature denaturation and annealing extension. The high-temperature denaturation step also uses 95°C, and the denaturation time can be adjusted between 5 and 15 seconds. Shorter times are more beneficial for protecting enzyme activity and shortening the total reaction time, but complete denaturation must be ensured. Optimization and verification have shown that a denaturation time of 10 seconds is sufficient to achieve complete denaturation. The annealing extension step is a crucial step in the specific binding of primers to the template and the extension of the new strand under the catalysis of polymerase; the temperature and time of this step require precise control. The annealing extension temperature can be selected within the range of 56℃ to 61℃. The primer-probe set (TG-SAG3) of this invention can achieve effective amplification within this temperature range, but the amplification efficiency varies. Comparative experiments using six temperature gradients (56℃, 57℃, 58℃, 59℃, 60℃, and 61℃) revealed that 58℃ had the lowest average cycle threshold (18.57) and the smallest coefficient of variation among three replicates, indicating that the primer-template binding efficiency was highest and non-specific amplification was minimized at this temperature. Therefore, 58℃ is the optimal annealing extension temperature. The annealing extension time can be adjusted between 10 seconds and 50 seconds. Too short a time may lead to insufficient extension, while too long a time increases the risk of non-specific amplification and prolongs the total reaction time. For the amplification fragment length designed in this invention (approximately 100-300 bp), comparisons at five gradients (10 seconds, 20 seconds, 30 seconds, 40 seconds, and 50 seconds) revealed that the average cycle threshold was lowest (18.23) at 20 seconds, and the amplification curve signal was strongest. At 10 seconds, the extension might not have reached the endpoint, and at 30 seconds and above, the Ct value actually increased, suggesting that excessively long annealing and extension times might lead to competition from primer dimers or non-specific products. Therefore, the preferred annealing and extension time is 20 seconds. The number of repetitions for the entire amplification cycle can be selected between 35 and 45 cycles. The most preferred digital PCR amplification program of this invention is: pre-denaturation at 95°C for 3 minutes; then 42 cycles of denaturation at 95°C for 10 seconds and annealing and extension at 58°C for 20 seconds; after all cycles, signal acquisition can be performed or the circuit can be maintained at 4°C for reading.

[0047] The present invention also provides the application of the primer probe set, the kit, the detection system, or the detection method described herein in the preparation of products for detecting Toxoplasma gondii.

[0048] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0049] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. The instruments and reagents used in the following examples include: a 2720 PCR instrument (ABI, USA), a System Electrophoresis Mupid (Mupid2plus) electrophoresis tank (TAKARA, Japan), a ChampGEL gel imaging system (Beijing Saizhi Venture Technology Co., Ltd.), a Centrifuge (MICRO 17TR) centrifuge (Hanil, South Korea), a clean bench (Suzhou Purification Company), 2µl / 10µl / 100µl / 200µl / 1000µl pipettes (Eppendorf, Germany), an Eppendorf epMotion 5070 autopilot workstation (Eppendorf, Germany), an autoclave (LS-B50L) sterilizer (Jiangyin Binjiang Company, China), a FreezerBig (DW-40L262) refrigerator (Qingdao Haier Company), a Vortex (Voltex-Genie2) vortex mixer (SI, USA), and an oven. Dry (DHG-9240A) forced-air drying oven (Shanghai Yiheng Company), Balance (BT-214) balance (Denver, USA), Roche LightCycler® 480Ⅱ real-time fluorescence quantitative PCR instrument (Roche, Germany), digital PCR (Zhenzhun Biotechnology (Shanghai) Co., Ltd.). Experimental reagents and consumables included: 6× Loading Buffer (Fermentas (MBI), USA), Digital PCR Detection Kit (Beijing Meilaibo Medical Technology Co., Ltd.), TE Buffer (Beijing Solarbio Technology Co., Ltd.), DL2000 DNA Marker (Takara Bio Engineering (Dalian) Co., Ltd.), EB (Sigma-Aldrich, USA), Double-distilled water (Beijing Tiangen Biotech Co., Ltd.), 50× TAE (BIONEER, South Korea), Real-Time PCR 384-well plate (Roche, Germany), 10µl / 200µl / 1000µl pipette tips (AXYGEN, USA), 1.5ml / 0.5ml centrifuge tubes (AXYGEN, USA), Digital PCR biochip (Zhenzhun Biotechnology (Shanghai) Co., Ltd.), and chip sealing oil (Zhenzhun Biotechnology (Shanghai) Co., Ltd.). Virus strains and samples included: Toxoplasma gondii, Plasmodium, Entamoeba histolytica, Giardia lamblia, and Trypanosoma genomic DNA.

[0050] Example 1 Primer and probe design and screening Based on the Toxoplasma gondii gene sequence (GenBank accession number: MK403957.1), the conserved region of the SAG1 gene was selected as the detection target. Mutation sites were avoided during the design process. The nucleic acid sequence is shown in SEQ ID NO: 10, synthesized by General Biosystems (Anhui) Co., Ltd., and ligated into the pUC57-Amp vector. Three sets of specific primers and probes were designed using primer design software, named TG-SAG1, TG-SAG2, and TG-SAG3, respectively, and their sequences are shown in Table 1. All primers and probes were synthesized by General Biosystems (Anhui) Co., Ltd., and diluted to 10 μM working solution with TE buffer for later use.

[0051] Table 1. Three sets of primer and probe sequences

[0052] With a concentration of 1×10 5 Using positive plasmids with copies / μL as templates, three sets of primers and probes were initially screened on a real-time quantitative PCR instrument. The reaction system was 20 μL: 10 μL 2×PCR Mix, 1 μL 10 μM forward primer, 1 μL 10 μM reverse primer, 0.6 μL 10 μM probe, 2 μL template, and ddH2O to a final volume of 20 μL. The reaction program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 60℃ annealing and extension for 30 s, for 42 cycles.

[0053] Table 2 Comparison of Ct values ​​for real-time PCR amplification using three primer combinations

[0054] According to Table 2 and Figure 1 The results showed that all three primer sets had good specificity, and no amplification signal was observed in the negative controls. However, there were significant differences in amplification efficiency among the three sets. TG-SAG1 and TG-SAG2 showed lower amplification efficiencies, with average Ct values ​​of 24.34 and 23.55, respectively. In contrast, the TG-SAG3 primer combination exhibited the highest amplification efficiency, with Ct values ​​of 23.49, 23.45, and 23.36 in three replicate experiments, and an average Ct value of 23.43, significantly lower than the other two primer sets. Figure 1 Based on the TG-SAG3 primer combination, it was selected for the optimization and validation experiments of all subsequent methods.

[0055] Example 2: Optimization of the digital PCR detection system 1. Optimization of primer addition amount To obtain the optimal reaction system, this study further optimized the primer dosage, targeting the primers that exhibited the best amplification kinetics and high specificity in the initial screening. In a 20 μL reaction system, keeping other components constant, the dosage of forward and reverse primers (10 μM) was tested in a gradient from 0.6 μL to 2.0 μL (corresponding to final concentrations of 0.3 μM to 1.0 μM). The specific system was: 10 μL of 2×PCR Mix; 10 μM of forward primer. and A certain volume of reverse primer (10 μM) was added; 0.6 μl of probe (10 μM); 2 μl of template; and water was added to a final volume of 20 μl using ddH2O. The reaction procedure was the same as in Example 1. The primer amounts added are shown in Table 3.

[0056] Table 3 Primer addition amount

[0057] Real-time quantitative PCR results showed ( Figure 2 (Table 4) When the primer addition amount ranged from 0.6 μL to 2.0 μL, the amplification Ct value showed little variation, with an average Ct value between 23.46 and 23.88, indicating relatively stable amplification efficiency. However, analysis of the fluorescence signal intensity of the amplification curves revealed that the primer addition amount had a clear impact on amplification kinetics and the endpoint fluorescence signal. Based on the data analysis of monkeys amplified with different primer concentrations, the primer concentration had a minimal impact on the amplification Ct value and a slight impact on the amplification fluorescence signal. Considering amplification efficiency, signal intensity, and reagent cost, the optimal addition amount of both forward and reverse primers in a 20 μL digital PCR reaction system was determined to be 1.2 μL (final concentration 0.6 μM), which was used in all subsequent experiments.

[0058] Table 4 Comparison of amplification Ct values ​​under different primer addition amounts

[0059] 2. Optimization of probe addition amount Based on the determination that TG-SAG3 was the optimal primer combination and the optimization of its dosage, this study further optimized the probe dosage. In a 20 μL reaction system, keeping the following components constant: 10 μL 2×PCR Mix, 1.2 μL forward primer (10 μM), 1.2 μL reverse primer (10 μM), 2 μL template, and other components, the probe (10 μM) dosage was set at seven gradients: 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, and 1.8 μL (corresponding to final concentrations of 0.3–0.9 μM). The same reaction procedure as in Example 1 was used: 95°C pre-denaturation for 3 minutes, followed by 42 cycles of 95°C denaturation for 10 seconds and 60°C annealing extension for 30 seconds, with fluorescence signals acquired during these cycles. The optimal probe dosage was determined by comparing the amplification curve morphology, fluorescence signal intensity, and Ct value at each concentration. The probe dosages are shown in Table 5.

[0060] Table 5 Probe Addition Amount

[0061] The results of real-time quantitative PCR (Table 6) showed that as the probe addition amount increased from 0.6 μL to 1.6 μL, the average Ct value significantly decreased from 23.94 to 22.27, indicating a continuous improvement in amplification efficiency. When the probe addition amount reached 1.6 μL, the system exhibited the earliest amplification initiation and the highest fluorescence signal intensity. Figure 3 Increasing the probe to 1.8 μL resulted in a slight increase in the Ct value (20.37), indicating that excessive probe may have a slight inhibitory effect on the reaction. Based on these results, a probe addition of 1.6 μL provided the optimal signal-to-noise ratio and detection sensitivity while ensuring high amplification efficiency, and was therefore determined to be the optimal probe amount for subsequent digital PCR reactions.

[0062] Table 6 Comparison of amplification Ct values ​​under different probe addition amounts.

[0063] 3. Annealing temperature optimization To determine the optimal annealing temperature for the TG-SAG3 primer combination, this study optimized the system using six temperature gradients ranging from 56℃ to 61℃. In a 20μL reaction mixture, keeping other components constant: 10μL of 2×PCR Mix, 1.2μL each of the forward and reverse primers (10μM), 1.6μL of the probe (10μM), and 2μL of template, real-time quantitative PCR amplification was performed at annealing temperatures of 56, 57, 58, 59, 60, and 61℃. The amplification temperatures are shown in Table 7.

[0064] Table 7 Annealing Temperatures

[0065] According to Table 8 and Figures 4-9 The results showed that the annealing temperature had a significant impact on the amplification efficiency. The reaction system exhibited the best amplification efficiency at an annealing temperature of 58℃, with the lowest average Ct value (23.45) and the smallest coefficient of variation among the three replicate experiments, indicating that the reproducibility of the reaction was optimal under these conditions. Figure 6 When the temperature was below or above 58℃, the average Ct value showed an increasing trend, indicating a decrease in amplification efficiency. Particularly at 61℃, the average Ct value increased to 19.87, suggesting that excessively high annealing temperatures were detrimental to the specific binding of primers and templates. Based on the data analysis of amplification at different annealing temperatures, 58℃ was ultimately selected as the annealing amplification temperature for digital PCR.

[0066] Table 8 Comparison of Ct values ​​under different annealing temperatures

[0067] 4. Optimization of amplification time using TG-SAG 3-set primers Based on the determined optimal annealing temperature, this study further optimized the annealing time. The optimized reaction system was used: 10 μL of 2×PCR Mix, 1.2 μL each of forward and reverse primers (10 μM), 1.6 μL of probe (10 μM), 2 μL of template, and ddH2O to a final volume of 20 μL. Five annealing and extension time gradients of 10, 20, 30, 40, and 50 seconds were set, and the following program was run on a real-time quantitative PCR instrument: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 10 seconds; 58℃ annealing and extension for different times (X seconds), for a total of 42 cycles. Fluorescence signals were collected during the annealing and extension phase. Three technical replicates were set for each condition. The optimal annealing and extension time was determined by comparing the average Ct values ​​and amplification curve characteristics at each time point. The amplification times are shown in Table 9.

[0068] Table 9 Annealing Extension Time

[0069] According to Table 10 and Figures 10-14 The results showed that the annealing extension time significantly affected the amplification efficiency. When the annealing extension time was 20 seconds, the average Ct value was the lowest (23.19), and the amplification efficiency was the highest. Figure 11 Both shortening and extending the annealing extension time resulted in an increase in the Ct value, indicating that 20 seconds was sufficient to complete efficient amplification and could shorten the total reaction time, thus it was determined to be the optimal annealing extension time.

[0070] Table 10 Comparison of Ct values ​​for amplification at different annealing extension times

[0071] Example 3: Establishment and sensitivity verification of the digital PCR detection method of the present invention To evaluate the detection sensitivity of the established digital PCR method, the TG-SAG3 primer and probe set from Example 1 and the optimized reaction conditions from Example 2 were used to detect serially diluted Toxoplasma gondii plasmid DNA templates (10... 0 -10 4 The target molecule concentration (copies / μL) was measured. Three technical replicates were set up for each concentration, along with a template-free negative control. After amplification, a digital PCR reader was used to acquire and analyze fluorescence signals. The software automatically calculated the target molecule concentration (copies / μL) for each sample, and evaluated the detection limit and quantitation range of the method.

[0072] The test data results are shown in Table 11 and Figure 15 The method is shown to be effective in 10 cases. 0 -10 4 The assay exhibited good linearity within the range of copies / μL. The digital PCR instrument and kit used in this experiment had a detection limit of 3 copies or more in the total system for a positive result. The detection data show that this assay can stably detect 1 copy / μL of template, with a detection sensitivity of 1×10⁻⁶. 0 Copy / μl.

[0073] As the template concentration increased, the coefficient of variation of the detected values ​​gradually decreased, reaching 3.2% at 1000 copies / μL, indicating excellent reproducibility of the method in high-concentration samples. Notably, even in the low-concentration region (0.1-1 copy / μL) close to the detection limit, all replicate samples yielded valid positive results, confirming the method's stable low-copy detection capability.

[0074] Based on the criteria for digital PCR system (≥3 copies in the total system is considered positive), the limit of detection of this method was determined to be 1 copy / μL, which is two orders of magnitude higher than the conventional PCR method (sensitivity of 100 copies / μL) that was subsequently validated, fully demonstrating the significant advantages of digital PCR technology in the detection of low-abundance pathogens.

[0075] Table 11 Results of digital PCR sensitivity detection

[0076] Example 4: Specificity verification of the digital PCR detection method of the present invention To verify the specificity of the established detection method, the TG-SAG3 primer and probe set from Example 1 and the optimized detection system from Example 2 were used to perform cross-reactivity tests on DNA from various common pathogens. Experimental samples included: Toxoplasma gondii DNA, Brucella ovis DNA, Plasmodium malariae DNA, Campylobacter jejuni DNA, Yersinia enterocolitica DNA, Shigella flexneri DNA, Shigella dysenteriae DNA, Salmonella DNA, enterotoxigenic Escherichia coli DNA, enteroaggregative Escherichia coli DNA, enterohemorrhagic Escherichia coli DNA, and a negative control. After amplification, the detection results of each sample were analyzed using a digital PCR reader to confirm the method's specificity for Toxoplasma gondii.

[0077] Table 12 Specificity Detection Data

[0078] The results show (Table 12, Figure 16 Only the Toxoplasma gondii DNA sample showed a significant positive signal (28.05 copies / μL), while the detection results for 11 non-target pathogens, including Brucella ovis, Plasmodium, and Campylobacter jejuni, were all negative (0-0.14 copies / μL), at the same background level as the negative control (0 copies / μL). These results indicate that the digital PCR detection method for Toxoplasma gondii established in this study has good specificity and can accurately distinguish Toxoplasma gondii from other common pathogens, providing a reliable guarantee for the specific detection of Toxoplasma gondii in clinical samples.

[0079] Example 5: Validation of the repeatability and stability of the digital PCR detection method of the present invention. To evaluate the reproducibility and reagent stability of the established digital PCR method, this study tested samples at three concentration gradients (10⁻⁶ ppm) on days 0, 7, and 14 under storage conditions at 4°C. 2 10 3 10 4 The assay was performed using samples at different time points (copies / μL). Three technical replicates were set up for each concentration. The coefficient of variation was calculated by comparing the test results of samples at different concentrations at different time points to evaluate the repeatability of the method and the stability of the reagents.

[0080] Table 13 Reagent stability verification results (copies / μL)

[0081] The results are shown in Table 13 and Figure 17The results showed that the detection values ​​of samples at different concentrations maintained good stability at different time points, with coefficients of variation all below 15%. During the 14-day evaluation period, the fluctuation range of detection values ​​at each concentration level was within acceptable limits. High-concentration samples (1000 copies / μL) exhibited the best repeatability, with a coefficient of variation of only 7.4%. Although the coefficients of variation for medium- and low-concentration samples were slightly higher (8.8%-14.0%), the detection values ​​of all samples remained on the same order of magnitude as the theoretical concentration, and no significant signal attenuation or enhancement trend was observed over time. The detection method of this invention maintained stable detection performance for 14 days under storage conditions at 4℃, indicating that the established digital PCR detection system has good repeatability and reagent stability, meeting the requirements of routine detection.

[0082] Example 6: Sensitivity Comparison Test of the Digital PCR Detection Method of the Present Invention with Conventional PCR To compare the sensitivity differences between digital PCR and conventional PCR, conventional PCR sensitivity tests were performed using TG-SAG1-F (SEQ ID NO: 7) and TG-SAG1-R (SEQ ID NO: 2) primers. Plasmid DNA was diluted to 10 μL with TE buffer. 6 -10 0 Seven concentration gradients were set up for each copy / μL, with a negative control included. The standard PCR reaction mixture was 20 μL: 10 μL 2×PCR Mix, 1.2 μL forward primer (10 μM), 1.2 μL reverse primer (10 μM), 2 μL template, and ddH2O to make up the difference. Using the TG-SAG1-F and TG-SAG1-R primer combination, the expected amplified fragment was 256 bp. The reaction program was: 95℃ for 3 minutes; 95℃ for 10 seconds, 58℃ for 20 seconds, for 42 cycles. 5 μL of the amplified product was subjected to 1% agarose gel electrophoresis at 140V for 30 minutes. The results were observed using a gel imaging system to determine the detection limit of the standard PCR.

[0083] Agarose gel electrophoresis results are as follows Figure 18 The results showed that a clear 256bp specific band could be observed using conventional PCR when the template concentration was ≥100 copies / μL. Sequencing of the specific PCR amplification samples revealed that the product's base sequence matched the Toxoplasma gondii SAG1 gene sequence. However, the band completely disappeared when the template concentration was reduced to 10 copies / μL, indicating that the detection limit of conventional PCR is 100 copies / μL.

[0084] In stark contrast, digital PCR remained stable in detecting pathogens at template concentrations as low as 1 copy / μL. A comparison of the sensitivity of the two methods clearly showed that digital PCR's detection sensitivity was two orders of magnitude higher than that of conventional PCR. This significant difference highlights the unique advantages of digital PCR technology in detecting low-abundance pathogens, particularly its important application value in the diagnosis of early or latent infections.

[0085] Example 7: Comparison of the specificity of the digital PCR detection method of the present invention with conventional PCR To verify the specificity of the conventional PCR method, the same pathogen DNA samples used in the digital PCR specificity experiment were selected for testing. These included Toxoplasma gondii DNA, Brucella ovis DNA, Plasmodium malariae DNA, Campylobacter jejuni DNA, Yersinia enterocolitica DNA, Shigella flexneri DNA, Shigella dysenteriae DNA, Salmonella DNA, enterotoxigenic Escherichia coli DNA, enteroaggregative Escherichia coli DNA, enterohemorrhagic Escherichia coli DNA, and a negative control.

[0086] A standard PCR reaction system of 20 μL was used: 10 μL of 2×PCR Mix, 1.2 μL each of TG-SAG2 primers (10 μM), and 2 μL of template. The amplification program was: 95℃ for 3 minutes; 95℃ for 10 seconds, 58℃ for 20 seconds, for 42 cycles. 5 μL of the amplified product was subjected to 1% agarose gel electrophoresis, using DL2000 as the DNA molecular weight standard. Electrophoresis was performed at 140V for 30 minutes, followed by gel imaging to analyze amplification specificity.

[0087] Agarose gel electrophoresis results are as follows Figure 19 The results showed that a clear 256bp specific band was observed only in *Toxoplasma gondii* DNA and positive plasmid samples, with a size completely consistent with the expected amplified fragment. No specific amplified bands were observed in DNA samples from the remaining 11 non-target pathogens, including *Brucella sheep*, *Plasmodium*, and *Campylobacter jejuni*, and their electrophoresis results were identical to the negative control. This result is completely consistent with the aforementioned digital PCR specificity experiment results, jointly confirming that the primer and probe set used in this study has high specificity for the *Toxoplasma gondii* SAG1 gene. No cross-reactivity was observed in any of the non-target pathogens, indicating that this method can accurately distinguish *Toxoplasma gondii* infection from other common pathogens, providing dual technical validation for the specific diagnosis of *Toxoplasma gondii* in monkeys.

[0088] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A droplet-type digital PCR primer and probe set for detecting Toxoplasma gondii, characterized in that, The primer-probe set includes a forward primer, a reverse primer, and a probe; the nucleotide sequence of the forward primer is shown in SEQ ID NO: 1; the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 2; and the nucleotide sequence of the probe is shown in SEQ ID NO:

3.

2. The droplet-type digital PCR primer and probe set according to claim 1, characterized in that, The working concentrations of the forward primer, reverse primer, and probe are all 10 μM.

3. A droplet-based digital PCR kit for detecting Toxoplasma gondii in monkeys, characterized in that, The kit contains the primer and probe set as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes digital PCR reaction premix, positive control, negative control, nuclease-free water, digital PCR biochip, and chip sealing oil.

5. A detection system for Toxoplasma gondii using droplet digital PCR, characterized in that, The detection system comprises the primer and probe set as described in claim 1 or 2.

6. The detection system according to claim 5, characterized in that, The total volume of the detection system is 15-25 μL, which includes: 8-12 μL of 2×PCR premix, 0.6-2.0 μL of 10 μM forward primer, 0.6-2.0 μL of 10 μM reverse primer, 0.6-1.8 μL of 10 μM probe, 1-5 μL of template nucleic acid, and the remainder is nuclease-free water.

7. A droplet-based digital PCR detection method for Toxoplasma gondii, characterized in that, Includes the following steps: Nucleic acid is extracted from the sample to be tested; using the extracted nucleic acid as a template, a digital PCR detection system is constructed using the primer and probe set described in claim 1 or 2; the detection system is microdropletized or loaded onto a digital PCR chip for digital PCR amplification; after amplification, the fluorescence signal is read, and absolute quantitative analysis is performed based on the number of positive droplets or positive microreaction units according to the Poisson distribution.

8. The detection method according to claim 7, characterized in that, The digital PCR amplification program is as follows: 95℃ pre-denaturation for 2-5 min; 95℃ denaturation for 5-15 s; 56-61℃ annealing and extension for 10-50 s; for a total of 35-45 cycles.

9. The detection method according to claim 8, characterized in that, The digital PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s; 58℃ annealing extension for 20 s; for a total of 42 cycles.

10. The application of the primer and probe set of claim 1 or 2, the kit of claim 3 or 4, the detection system of claim 5 or 6, or the detection method of any one of claims 7-9 in the preparation of products for detecting Toxoplasma gondii.

Images