Organ fibrosis-related micropeptide ofmp and application thereof
Patent Information
- Application Number
- CN202480065581.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-10-13
- Filing Date
- 2024-10-11
- Publication Date
- 2026-06-26
Smart Images

Figure CN122295355A_ABST
Abstract
Description
Organ fibrosis-related micropeptide OFMP and its application Technical Field
[0001] The present application belongs to the field of biomedicine, and specifically relates to organ fibrosis-related micropeptide OFMP and its application. Background Art
[0002] Long noncoding RNA (lncRNA) refers to functional RNA molecules consisting of a stretch greater than 200 nucleotides that are not thought to be translated into proteins. Previous studies have shown that lncRNAs play important roles in epigenetic regulation, cell cycle regulation, and differentiation regulation, and are implicated in major human health disorders, including cancer and degenerative neurological diseases. With the rapid advancement of molecular biology, computational biology, and deep sequencing technologies, a large number of previously unannotated, non-canonical short open reading frames (ORFs) hidden within long noncoding RNAs have been shown to encode functional proteins. Micropeptides are a type of translation product encoded by short open reading frames (sORFs) and ranging in length from 2 to 100 codons.
[0003] Organ fibrosis refers to a fibrotic disease that can occur in multiple organs. The main pathological changes are an increase in fibrous connective tissue and a decrease in parenchymal cells within the organ tissue. Persistent fibrotic lesions in organs can destroy organ structure and function, further leading to organ failure and malignant tumors. It is considered to be a tumor-like lesion between benign and malignant, and a serious threat to human health and life.
[0004] The discovery and study of organ fibrosis-related micropeptides is of great significance for developing novel and effective disease diagnosis and treatment, and can provide important reference and development value for exploring new application areas. However, there are currently no reports on micropeptides in the field of organ fibrosis research. Summary of the Invention
[0005] The first object of the present invention is to provide a micropeptide related to organ fibrosis, wherein the amino acid sequence of the micropeptide is any one of the following:
[0006] (a) the amino acid sequence shown in any one of SEQ ID NOs: 1-3;
[0007] (b) an amino acid sequence having 85% or more identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-3;
[0008] (c) An amino acid sequence with equivalent function formed by replacing, deleting or adding one or more amino acid residues to the amino acid sequence of any one of SEQ ID NOs: 1-3.
[0009] The micropeptides of the present invention are translation products encoded by a short open reading frame (ORF) in a long non-coding RNA, which have endogenous biological activity and are stable. In the present invention, these micropeptides are uniformly named as organ fibrosis-related micropeptides (OFMP) based on their discovered functions. hereinafter, the micropeptides related to SEQ ID NOs: 1-3 are named OFMP3178, OFMP2067 and OFMP1080, respectively.
[0010] The second object of the present invention is to provide a nucleotide sequence encoding the above-mentioned micropeptide. The nucleotide sequence can be a lncRNA molecule encoding the above-mentioned polypeptide or an ORF contained therein, or other nucleotide sequences that can encode the same amino acid sequence.
[0011] The third object of the present invention is to provide the use of the above-mentioned micropeptide in the preparation of an organ fibrosis detection or treatment reagent or drug. The micropeptide is used in the form of amino acids or nucleotides.
[0012] The fourth object of the present invention is to provide a use of a long non-coding RNA in the preparation of an organ fibrosis detection or treatment reagent or drug, wherein the long non-coding RNA has an ID number in the Ensembl database: ENSG00000224023, ENSG00000263126 or ENSG00000265666.
[0013] As a preferred embodiment, the organ fibrosis includes one or more of liver fibrosis, kidney fibrosis, lung fibrosis, cardiac fibrosis, and skin fibrosis.
[0014] As a preferred embodiment, the organ fibrosis detection is achieved by using a specific primer pair designed for the nucleotide sequence encoding the micropeptide or the nucleotide sequence of the long non-coding RNA.
[0015] A fifth object of the present invention is to provide a recombinant vector containing a nucleotide sequence encoding the micropeptide or the long non-coding RNA. The recombinant vector may be a plasmid, a viral vector, or the like.
[0016] A sixth object of the present invention is to provide a pharmaceutical composition comprising the aforementioned micropeptide, a nucleotide sequence encoding the micropeptide, or a nucleotide sequence of the aforementioned long non-coding RNA, and a pharmaceutically acceptable carrier thereof. The pharmaceutical composition can be used to prevent or treat organ fibrosis.
[0017] The seventh object of the present invention is to provide an organ fibrosis detection kit, which contains specific primer pairs and / or antibodies designed for the nucleotide sequence encoding the above-mentioned micropeptide or the nucleotide sequence of the above-mentioned long non-coding RNA.
[0018] As a preferred embodiment, the nucleotide sequence of the specific primer pair is selected from any one of the following groups:
[0019] (a) F: AGTGCCCGGACTTTTGTTCT; R: TGGGACTTTCACTCGGGGTA;
[0020] (b) F: ACCACATGGGCTCCGTTATG; R: GCTGCTTTGCCAAGTGAGTT;
[0021] (c) F: AGACACCGGCTTGTGTCATT; R: TCTGCCTGTGTTTGTGCCA.
[0022] The present invention has the following beneficial effects:
[0023] (1) By analyzing sequencing data of multiple organ fibrosis, the present invention discovered for the first time that multiple lncRNA molecules have an important relationship with organ fibrosis, including ENSG00000224023, ENSG00000263126 and ENSG00000265666. Specifically, they are lowly expressed in fibrotic cells and / or tissues of multiple organs and can be used for diagnosis or auxiliary diagnosis, treatment or auxiliary treatment of organ fibrosis, or for the preparation of drugs or reagents for diagnosis or auxiliary diagnosis, treatment or auxiliary treatment of organ fibrosis.
[0024] (2) The present invention discovered that the above-mentioned lncRNA has an open reading frame (ORF) that can encode a micropeptide. The applicant analyzed the translation characteristics of the open reading frames of the above-mentioned multiple lncRNA molecules and found that they have the potential to encode functional proteins. By using methods including gene editing, immunoprecipitation and LC-MS / MS to verify the endogenous coding, it was confirmed that the above-mentioned lncRNA molecules have a coding sequence (ORF), and the sequence has not been reported anywhere. The present invention is based on the nucleotide sequence of the open reading frames of ENSG00000224023, ENSG00000263126 and ENSG00000265666 (as shown in SEQ ID NO: 4-6) to encode a series of novel micropeptides OFMP3178, OFMP2067 and OFMP1080. After searching the database (BLAST, UniProt) and literature, no protein or polypeptide fragment with a homologous sequence to the above-mentioned micropeptides was found, that is, the micropeptides are brand-new endogenous human polypeptides discovered for the first time. The nucleotide sequence encoding the micropeptide can be used for diagnosis or auxiliary diagnosis, treatment or auxiliary treatment of organ fibrosis, or for preparing diagnostic or auxiliary diagnosis, treatment or auxiliary treatment reagents for organ fibrosis.
[0025] (3) The present invention provides novel micropeptides OFMP3178, OFMP2067 and OFMP1080 with novel amino acid sequences. These micropeptides are endogenously bioactive and stably expressed translation products encoded by open reading frames (ORFs) in long non-coding RNAs. The synthetic peptides of these novel micropeptides have a significant inhibitory effect on key indicators of human liver fibrosis, renal fibrosis and pulmonary fibrosis in vitro, including type I collagen α1 chain gene (Col1a1), α-smooth muscle actin (α-SMA), transforming growth factor β1 (TGFβ1) and connective tissue growth factor (CTGF). The novel micropeptides can also be used as therapeutic drugs for fibrosis of other organs, greatly expanding the therapeutic spectrum of micropeptides and providing new ideas for the development of drugs for organ fibrosis.
[0026] (4) The present invention obtains a synthetic peptide of the micropeptide by solid-phase synthesis based on the amino acid sequence of the novel micropeptide; by constructing three organ fibrosis cell models, for example, 10 nmol of recombinant human TGFβ1 stimulator and different concentrations of synthetic peptides were added to human hepatic stellate cells LX-2, human non-small cell lung cancer cell line A549 and human renal proximal tubule cells HK2, respectively. After incubation for 24 hours, the total RNA of the collected cell samples was extracted using TRIzol reagent, and then the extracted total RNA was reverse transcribed using a reverse transcription reagent. The mRNA expression of genes Col1a1 and α-SMA in the three organ fibrosis cell models was detected by real-time fluorescence quantitative PCR. The results showed that the synthetic peptides of the micropeptides OFMP3178, OFMP2067 and OFMP1080 had significant inhibitory effects on the three organ fibrosis cell models. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 is a volcano plot of lncRNA low expression in organ fibrosis analyzed using differential analysis method.
[0028] Figure 2 shows the Sanger sequencing of monoclonal cells in which the micropeptide OFMP3178 was inserted into the Flag tag using the gene editing method.
[0029] Figure 3 shows the Sanger sequencing of monoclonal cells in which the micropeptide OFMP2067 was inserted into a Flag tag using a gene editing method.
[0030] Figure 4 shows the Sanger sequencing of monoclonal cells in which the micropeptide OFMP1080 was inserted with a Flag tag using a gene editing method.
[0031] FIG5 shows the expression of the target band of the micropeptide OFMP3178 detected by immunoprecipitation method.
[0032] FIG6 shows the expression of the target band of micropeptide OFMP2067 detected by immunoprecipitation method.
[0033] FIG7 shows the expression of the target band of the micropeptide OFMP1080 detected by immunoprecipitation method.
[0034] FIG8 is a protein spectrum of the micropeptide OFMP3178 detected using the LC-MS / MS method.
[0035] FIG9 is a protein spectrum of the micropeptide OFMP2067 detected using the LC-MS / MS method.
[0036] FIG10 is a protein spectrum of the micropeptide OFMP1080 detected using the LC-MS / MS method.
[0037] FIG11 shows the melting curves of primers for detecting the specificity of four organ fibrosis genes using the qPCR method.
[0038] FIG12 shows the detection of gene indicators in the human liver fibrosis cell model constructed using the qPCR method.
[0039] FIG13 shows the detection of gene indicators in the human renal fibrosis cell model constructed using the qPCR method.
[0040] FIG14 shows the detection of gene indicators in a human pulmonary fibrosis cell model constructed using the qPCR method.
[0041] FIG15 is a liquid phase result diagram of the synthetic peptide of micropeptide OFMP3178.
[0042] FIG16 is a liquid phase result diagram of the synthetic peptide of micropeptide OFMP2067.
[0043] FIG17 is a liquid phase result diagram of the synthetic peptide of micropeptide OFMP1080.
[0044] FIG18 is a diagram showing the mass spectrometry results of the synthetic peptide of micropeptide OFMP3178.
[0045] FIG19 is a diagram showing the mass spectrometry results of the synthetic peptide of micropeptide OFMP2067.
[0046] FIG20 is a diagram showing the mass spectrometry results of the synthetic peptide of micropeptide OFMP1080.
[0047] FIG21 shows the inhibitory effect of the micropeptide OFMP3178 in a human liver fibrosis cell model detected by qPCR.
[0048] FIG22 shows the inhibitory effect of the micropeptide OFMP2067 in a human liver fibrosis cell model detected by qPCR.
[0049] FIG23 shows the inhibitory effect of the micropeptide OFMP1080 in a human liver fibrosis cell model detected by qPCR.
[0050] FIG24 shows the inhibitory effect of the micropeptide OFMP3178 in a human renal fibrosis cell model detected by qPCR.
[0051] FIG25 shows the inhibitory effect of the micropeptide OFMP2067 in a human renal fibrosis cell model detected by qPCR.
[0052] FIG26 shows the inhibitory effect of the micropeptide OFMP1080 in a human renal fibrosis cell model detected by qPCR.
[0053] FIG27 shows the inhibitory effect of the micropeptide OFMP3178 in a human pulmonary fibrosis cell model detected by qPCR.
[0054] FIG28 shows the inhibitory effect of the micropeptide OFMP2067 in a human pulmonary fibrosis cell model detected by qPCR.
[0055] FIG29 shows the inhibitory effect of the micropeptide OFMP1080 in a human pulmonary fibrosis cell model detected by qPCR. DETAILED DESCRIPTION
[0056] The present application is further described below with reference to specific embodiments.
[0057] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs; the term "and / or" used herein includes any and all combinations of one or more of the associated listed items.
[0058] If the specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or those provided by the manufacturers. The reagents or instruments used, if the manufacturers are not specified, are all conventional products that can be purchased commercially.
[0059] As used herein, the term "about" is used to provide flexibility and imprecision associated with a given term, measurement, or value. One skilled in the art can readily determine the degree of flexibility for a particular variable.
[0060] As used herein, the term "at least one of" is intended to be synonymous with "one or more of." For example, "at least one of A, B, and C" explicitly includes only A, only B, only C, and combinations of each thereof.
[0061] Concentration, amount and other numerical data can be presented in range format herein.It should be understood that such range format is used only for convenience and brevity, and should be flexibly interpreted as not only including the numerical value clearly stated as the range limit, but also including all individual numerical values or sub-ranges encompassed within the range, just as each numerical value and sub-range is clearly stated.For example, a numerical range of about 1 to about 4.5 should be interpreted as including not only the clearly stated limit value of 1 to about 4.5, but also including individual numbers (such as 2, 3, 4) and sub-ranges (such as 1 to 3, 2 to 4, etc.).The same principle applies to the range of only narrating a numerical value, such as "less than about 4.5", which should be interpreted as including all the above-mentioned values and ranges.In addition, no matter how the breadth of the described range or feature is, this interpretation should be applied.
[0062] In an embodiment, the method for validating endogenous encoding of the micropeptide OFMP includes gene editing, immunoprecipitation, and LC-MS / MS, specifically including:
[0063] A Flag tag was correctly inserted into the genomic location of the micropeptide OFMP using gene editing methods;
[0064] Immunoprecipitation combined with chemiluminescence was used to observe the generation of target bands;
[0065] The protein spectrum of the micropeptide OFMP was detected using the LC-MS / MS method.
[0066] In the embodiment, the real-time fluorescence quantitative PCR method is used to detect gene indicators in the organ fibrosis cell model, specifically including:
[0067] Human hepatic stellate cells LX-2, human non-small cell lung cancer cell line A549 and human renal proximal tubule cells HK2 were plated and different concentrations of recombinant human TGFβ1 stimulatory factor were added;
[0068] After continuous stimulation for 24 h and 48 h, respectively, the mRNA expression of genes Col1a1 and α-SMA was detected by real-time fluorescence quantitative PCR to determine whether the cell model was successfully constructed.
[0069] In the embodiment, a novel micropeptide OFMP is obtained by solid phase synthesis, and the quality inspection of the synthesized peptide is carried out, specifically including:
[0070] The peptide resin synthesis includes decapping with hexahydropyridine / N,N-dimethylformamide (DMF) decapping solution, washing the resin with DMF, then adding a condensing agent to fully react in a reactor, and finally washing the resin with DMF to remove by-products;
[0071] Add lysis buffer to fully cleave the peptide, and use a sand core funnel to separate the resin and the peptide;
[0072] Anhydrous ether was added to precipitate the polypeptide, the supernatant was discarded by centrifugation, the polypeptide was washed with anhydrous ether, and the crude polypeptide was obtained by drying;
[0073] The crude peptide was dissolved in deionized water, filtered, and purified by semi-preparative HPLC;
[0074] Peptide purity was tested by analytical RP-HPLC.
[0075] In an embodiment, the method of using real-time fluorescence quantitative PCR to detect the inhibitory effect of the micropeptide OFMP in a fibrosis cell model includes:
[0076] Human hepatic stellate cells LX-2, human non-small cell lung cancer cell line A549, or human renal proximal tubule cells HK2 were counted and plated;
[0077] Except for the blank group, 10 nmol of recombinant human TGFβ1 stimulator was added and the stimulation lasted for 24 h;
[0078] Total RNA from cell samples was extracted using TRIzol reagent, reverse transcribed using reverse transcription reagent, and then qPCR reaction was performed using qPCR premix solution;
[0079] Real-time fluorescence quantitative PCR instrument was used to detect the mRNA expression of genes Col1a1 and α-SMA.
[0080] Example 1
[0081] In this example, the expression levels of genes ENSG00000224023, ENSG00000263126, and ENSG00000265666 in fibrosis of various organs were analyzed.
[0082] (1) Analysis of OFMP expression levels
[0083] Using "fibrosis" and "Homo sapiens" as keywords, we searched the NCBI database and downloaded high-throughput sequencing data related to fibrosis in multiple organs in batches, including human liver fibrosis and normal cell data (accession number: PRJNA638727), human liver fibrosis patient and healthy tissue data (accession number: PRJEB27201), human kidney fibrosis and normal cell data (accession number: GSE23338), and human lung fibrosis patient and healthy tissue data (accession number: PRJNA878759). The downloaded sequencing data were then processed and analyzed, and the number of reads with a successful alignment rate greater than 90% was used as the subsequent analysis data. Differential gene expression analysis was then performed using the DESeq2 software package (v1.38.3). The results showed that the significance padj of genes ENSG00000224023, ENSG00000263126, and ENSG00000265666 was < 0.05 and the difference fold (log2FoldChange) was < -1, indicating that these genes are underexpressed in fibrosis of multiple organs. The expression differences are shown in Figure 1, with green indicating low expression.
[0084] (2) Detection of OFMP expression levels
[0085] First, the total RNA of the organ fibrosis samples was extracted using the RNA extraction reagent TRIzol, and the purity and concentration of the extracted RNA were quantified using the NanoDrop 2000 ultra-micro spectrophotometer, and the integrity of the extracted RNA was checked using agarose gel. ®Total RNA extracted from fibrosis samples was reverse transcribed and quantified using III RT SuperMix and 2 × ChamQ SYBR qPCR Master Mix to detect the expression level of OFMP. The reaction system is shown in Table 1:
[0086] Table 1 Reaction system for detecting OFMP expression level
[0087]
[0088] Mix the above components thoroughly and follow the following protocol: pre-denaturation at 95°C for 30 seconds, followed by 50 cycles of 95°C for 10 seconds and 60°C for 30 seconds. After the qPCR reaction, collect the Cq values for each sample well. The maximum error between the Cq values of the three replicate wells should be ≤ 0.5 to ensure data accuracy. Observe the melting curves of the designed primers for single peaks to determine reaction specificity. The Primer F and Primer R involved in this reaction system are shown below:
[0089] (a) F: AGTGCCCGGACTTTTGTTCT; R: TGGGACTTTCACTCGGGGTA;
[0090] (b) F: ACCACATGGGCTCCGTTATG; R: GCTGCTTTGCCAAGTGAGTT;
[0091] (c) F: AGACACCGGCTTGTGTCATT; R: TCTGCCTGTGTTTGTGCCA.
[0092] (a)-(c) are primer pairs designed for the detection of ENSG00000224023, ENSG00000263126, ENSG00000265666, or their ORFs or corresponding micropeptides. For example, (a) can be used to detect ENSG00000224023, ENSG00000224023 ORFs, or the corresponding micropeptide OFMP3178.
[0093] Example 2
[0094] In this example, the coding capacity of the micropeptide OFMP was endogenously detected, including gene editing, immunoprecipitation, and LC-MS / MS.
[0095] The gene sequences of ENSG00000224023, ENSG00000263126, and ENSG00000265666 were downloaded from the Ensembl database, and the corresponding gene-editing vectors were designed and constructed. These gene-editing vectors were then introduced into 293T cells. The cells were harvested by trypsinization, centrifuged, and resuspended for single-clone plating and sequencing. Monoclonal cells with the correct Flag tag insertion were identified, as shown in Figures 2-4.
[0096] The cells were rinsed with PBS and harvested by trypsinization. The supernatant was discarded after centrifugation and the cell pellet was resuspended in RIPA lysis buffer. After lysis on ice for 30 minutes, the supernatant was collected by centrifugation at 12,000 g for 15 minutes and added to 10 μl of antibody gel to form a protein-antibody-gel complex for incubation. After centrifugation at 6,000 g for 5 minutes, 1× SDS loading buffer was added, mixed, and denatured by boiling for 10 minutes. Total proteins were separated by 12% SDS-PAGE and transferred to a PVDF membrane. The membrane was then blocked with 5% skim milk powder for 1 hour at room temperature and washed five times with TBST (5 minutes each). After incubation with the primary Flag antibody at 4°C overnight, the membrane was washed five times with TBST (5 minutes each). The secondary antibody was incubated for 1 hour at room temperature and washed five times with TBST (5 minutes each). The membrane was developed with ECL ultrasensitive chemiluminescence solution and the presence of target bands was detected using a Tannon imaging system. The results are shown in Figures 5-7.
[0097] To further demonstrate the encoding ability of the micropeptide OFMP, the SDS-PAGE gel containing the target protein in the above step was stained with Coomassie Brilliant Blue and detected by LC-MS / MS (liquid chromatography tandem quadrupole mass spectrometry) to obtain the mass spectrometry results of the target micropeptide, as shown in Figures 8-10.
[0098] After gene editing, immunoprecipitation and mass spectrometry detection, it was found that after the Flag tag was inserted into the genomic sequence of the target micropeptide, the target band and mass spectrometry peptide fragment of the micropeptide OFMP appeared, which fully proved that the new micropeptide OFMP has the ability of endogenous encoding. ENSG00000224023, ENSG00000263126 and ENSG00000265666 encode micropeptides OFMP3178, OFMP2067 and OFMP1080, respectively. The amino acid sequences of the micropeptides are shown in SEQ ID NO: 1-3, respectively.
[0099] Example 3
[0100] In this example, real-time fluorescence quantitative PCR was used to detect gene indicators in three organ fibrosis cell models.
[0101] (1) Primer design
[0102] Key indicators of the organ fibrosis cell model include type I collagen α1 chain gene (Col1a1), transforming growth factor β1 (TGFβ1), connective tissue growth factor (CTGF), and α-smooth muscle actin (α-SMA). The corresponding primers were designed using Primer Premier 5.0 as follows:
[0103] Col1a1 upstream and downstream primer pairs:
[0104] F: ACTGGTGAGACCTGCGTGTA, R: AATCCATCGGTCATGCTCTC;
[0105] α-SMA upstream and downstream primer pairs:
[0106] F: ACGAGACCACCTACAACAGCAT, R: CTCGTCGTACTCCTGCTTGGT;
[0107] TGFβ1 upstream and downstream primer pairs:
[0108] F: AAGTGGACATCAACGGGTTC, R: GGTCCTTGCGGAAGTCAATG;
[0109] CTGF upstream and downstream primer pairs:
[0110] F: GGAAGGAACATTAAGAAGGGCAA, R: CTCGGTATGTCTTCATGCTGGTG.
[0111] According to the instructions of Life Invitrogen's TRIzol reagent, total RNA of the collected cell samples was extracted, and the purity and concentration of the extracted RNA were quantified using a NanoDrop 2000 ultra-micro spectrophotometer. Agarose gel quality control was performed to ensure the integrity of the extracted RNA. ® After reverse transcription of the extracted total RNA using III RT SuperMix for qPCR (+gDNA wiper), qPCR reaction was performed using qPCR premix ChamQ SYBR qPCR Master Mix. The reaction system is shown in Table 2:
[0112] Table 2 qPCR reaction system
[0113]
[0114] After mixing the above components, the following protocol was followed: pre-denaturation at 95°C for 30 seconds, followed by 50 cycles of 95°C for 10 seconds and 60°C for 30 seconds. After the qPCR reaction, the Cq values of each sample well were collected. The maximum error in Cq values between the three replicate wells was ≤0.5 to ensure data accuracy. The melting curves of the designed primers were observed to confirm a single peak to determine reaction specificity, as shown in Figure 11.
[0115] (2) Model construction
[0116] Human hepatic stellate cells LX-2, human non-small cell lung cancer cell line A549, and human renal proximal tubule cells HK2 were cultured in a cell culture incubator at 37°C and 5% CO2 until the cell density exceeded 80%. The cells were then harvested with trypsin, centrifuged, and the supernatant discarded. The cells were counted using a cell counter and seeded into six-well cell culture plates. The plates were then cultured in a cell culture incubator at 37°C and 5% CO2. After 24 hours of culture, the culture medium was aspirated and various concentrations of recombinant human TGFβ1 stimulator were added. After 24 and 48 hours of stimulation, the mRNA expression of Col1a1 and α-SMA was measured using qPCR, as shown in Figures 12, 13, and 14, respectively.
[0117] Example 4
[0118] In this example, the micropeptide OFMP was obtained by solid phase synthesis, and the quality of the synthesized micropeptide was tested.
[0119] In this embodiment, the peptide solid phase synthesis method was used to synthesize the micropeptide OFMP, the synthesized micropeptide OFMP was separated and purified by preparative HPLC, and the purity of the micropeptide OFMP was determined by analytical RP-HPLC. The peptide solid phase synthesis method uses Fmoc-Thr-wang-resin as the starting material, and then uses protected amino acids to couple to the last amino acid of the target sequence in sequence. After the coupling work is completed, the crude peptide is fully washed, cracked, and post-treated to obtain a crude peptide. After the crude product is dissolved, it is purified, concentrated, and freeze-dried using preparative high-performance liquid chromatography to obtain a pure peptide. The specific reaction steps are as follows:
[0120] (1) Peptide resin synthesis
[0121] Weigh 1 mmol of Fmoc-Thr-wang-resin, pour it into a glass sand core reaction column, and add 20 mL of CH2Cl2 to fully swell the resin.
[0122] a. Decapping: Add 20% hexahydropyridine / N, N-dimethylformamide (DMF) decapping solution 20mL, react for a period of time and drain the decapping solution, wash once with DMF, and then add 20mL of decapping solution to remove the Fmoc protecting group;
[0123] b. Washing: Drain the decapping solution and wash the resin with DMF to fully remove the by-products;
[0124] c. Condensation: The protected amino acid and activator for coupling are dissolved in DMF and a condensing agent and allowed to react fully in a reactor;
[0125] d. Washing: Drain the reaction solution and thoroughly wash the resin with DMF to remove by-products.
[0126] (2) Cracking
[0127] The drained resin was placed in a conical flask, and a lysis solution was added to fully lyse the combined polypeptide. The resin and polypeptide were separated using a sand core funnel. The composition of the lysis solution and the volume composition of each component were: trifluoroacetic acid: phenol: water: thioanisole: EDT = 90:3:3:2:2.
[0128] (3) Post-processing
[0129] The lysate was added to anhydrous ether after ice bath, and slowly stirred to precipitate the polypeptide. After centrifugation and discarding the supernatant, the polypeptide was washed with anhydrous ether and dried to obtain the crude polypeptide.
[0130] (4) Purification
[0131] a. Dissolution: Dissolve the crude peptide in deionized water and filter through a 0.45 μm pore size filter membrane.
[0132] b. Preparation: Purification was performed by semi-preparative HPLC. Mobile phases A and B were 0.1% TFA (acetonitrile) and 0.1% TFA (water). The purification system is shown in Table 3.
[0133] Table 3 Peptide purification system
[0134]
[0135] The solution at an ultraviolet wavelength of 220 nm was collected, and the molecular weight was confirmed to be consistent with the theoretical value by MS. The purity of the solution was greater than 95% by HPLC analysis. The qualified solution was concentrated under reduced pressure at 37°C using a rotary evaporator to remove the organic solvent, placed in a freeze-drying plate and frozen at -80°C, and then freeze-dried using a freeze dryer to obtain the pure polypeptide.
[0136] (5) Purity testing
[0137] The purified product was collected after lyophilization and the peptide purity was tested by analytical RP-HPLC. The analysis conditions were: mobile phase: 0.1% TFA (acetonitrile), 0.1% TFA (water); sample volume: 10 μL. The specific reaction system is shown in Table 4:
[0138] Table 4 Purity detection system
[0139]
[0140] Note: The order in the table is the experimental parameters of OFMP3178, OFMP2067, and OFMP1080.
[0141] The synthesized polypeptides were analyzed by reversed-phase liquid chromatography for purity identification. The purity test results are shown in Table 5, indicating that the purity of the prepared micropeptide OFMP was greater than 95%, as shown in Figures 15-20, which met the requirements of subsequent experiments.
[0142] Table 5 Purity test results
[0143]
[0144] Example 5
[0145] In this example, the inhibitory effect of the micropeptide OFMP on a human liver fibrosis cell model was detected.
[0146] Human hepatic stellate cells LX-2 were cultured in a cell culture incubator at 37°C and 5% CO2 until the cell density reached above 80%. The cells were then collected by trypsin digestion, centrifuged and the supernatant discarded. The cells were counted using a cell counter and seeded into six-well cell culture plates. The plates were then placed in a cell culture incubator at 37°C and 5% CO2 for further culture. After 24 h of cell culture, the culture medium was removed and 2‰ DMSO solvent was added as a negative control and 20 μmol of hydroxynidone was added as a positive control. The other groups were treated with 40 μmol, 10 μmol, 2.5 μmol, 625 nmol and 156 nmol of synthetic peptide OFMP at equal proportions. Half an hour later, 10 nmol of recombinant human TGFβ1 stimulator was added to the other groups except the blank control. After 24 h of continuous stimulation, the mRNA expressions of genes Col1a1, TGFβ1 and CTGF were detected in OFMP3178, and the mRNA expressions of genes Col1a1 and α-SMA were detected in OFMP2067 and OFMP1080, respectively.
[0147] The results are shown in Figures 21-23. Compared with the model group, the expression levels of genes Col1a1 and CTGF in liver fibrosis cells were significantly decreased after administration of different concentrations of synthetic peptide OFMP3178. Among them, under the treatment condition of 40 μmol-24h, the downward trend of gene Col1a1 and CTGF expression levels in liver fibrosis cells was the most significant, and there was a significant difference compared with the positive drug Hydronidone group. The results showed that synthetic peptide OFMP3178 has a good therapeutic effect on liver fibrosis.
[0148] Compared with the model group, the expression levels of genes Col1a1 and α-SMA in liver fibrosis cells decreased significantly after administration of different concentrations of synthetic peptide OFMP2067. Among them, under the treatment condition of 40μmol-24h, the downward trend of gene expression levels of genes Col1a1 and α-SMA in liver fibrosis cells was the most significant, and there were significant differences compared with the positive drug Hydronidone group. The results showed that synthetic peptide OFMP2067 has a good therapeutic effect on liver fibrosis.
[0149] Compared with the model group, the expression level of gene Col1a1 in liver fibrosis cells decreased significantly after administration of different concentrations of synthetic peptide OFMP1080. Among them, under the treatment condition of 40μmol-24h, the downward trend of gene Col1a1 and α-SMA expression levels in liver fibrosis cells was the most significant, and there was no significant difference compared with the positive drug Hydronidone group. The results showed that synthetic peptide OFMP1080 has a good therapeutic effect on liver fibrosis.
[0150] Example 6
[0151] In this example, the inhibitory effect of the micropeptide OFMP on a human renal fibrosis cell model was detected.
[0152] Human renal proximal tubular HK2 cells were cultured in a cell culture incubator at 37°C and 5% CO2 until the cell density reached above 80%. The cells were then collected by trypsin digestion, centrifuged and the supernatant discarded. The cells were counted using a cell counter and seeded into six-well cell culture plates, which were then placed in a cell culture incubator at 37°C and 5% CO2 for further culture. After 24 h of cell culture, the culture medium was removed and 2‰ DMSO solvent was added as a negative control and 20 μmol of hydroxynidone was added as a positive control. The other groups were treated with 40 μmol, 10 μmol, 2.5 μmol, 625 nmol and 156 nmol of synthetic peptide OFMP at equal proportions. Half an hour later, 10 nmol of recombinant human TGFβ1 stimulator was added to the other groups except the blank control. After 24 h of continuous stimulation, the mRNA expressions of genes Col1a1, TGFβ1 and CTGF were detected in OFMP3178, and the mRNA expressions of genes Col1a1 and α-SMA were detected in OFMP2067 and OFMP1080, respectively.
[0153] The results are shown in Figures 24-26. Compared with the model group, the expression levels of genes Col1a1, CTGF and TGFβ1 in renal fibrosis cells were significantly decreased after administration of different concentrations of synthetic peptide OFMP3178. Among them, under the treatment condition of 40 μmol-24h, the downward trend of gene Col1a1, CTGF and TGFβ1 expression levels in renal fibrosis cells was the most significant, and there were significant differences compared with the positive drug Hydronidone group. The results showed that synthetic peptide OFMP3178 has a good therapeutic effect on renal fibrosis.
[0154] Compared with the model group, the expression levels of genes Col1a1 and α-SMA in renal fibrosis cells decreased significantly after administration of different concentrations of synthetic peptide OFMP2067. Among them, under the treatment condition of 40μmol-24h, the downward trend of gene expression levels of Col1a1 and α-SMA in renal fibrosis cells was the most significant, and there were significant differences compared with the positive drug Hydronidone group. The results showed that synthetic peptide OFMP2067 has a good therapeutic effect on renal fibrosis.
[0155] Compared with the model group, the expression level of gene Col1a1 in renal fibrosis cells decreased significantly after administration of different concentrations of synthetic peptide OFMP1080. Among them, the downward trend of gene Col1a1 expression level in renal fibrosis cells was most significant under the treatment condition of 40 μmol-24h. The results showed that synthetic peptide OFMP1080 has a good therapeutic effect on renal fibrosis.
[0156] Example 7
[0157] In this example, the inhibitory effect of the micropeptide OFMP on a human pulmonary fibrosis cell model was detected.
[0158] Human non-small cell lung cancer cell line A549 was cultured in a cell culture incubator at 37°C and 5% CO2 until the cell density reached above 80%. The cells were then harvested by trypsin digestion, centrifuged and the supernatant discarded. The cells were counted using a cell counter and seeded into six-well cell culture plates. The plates were then placed in a cell culture incubator at 37°C and 5% CO2 for further culture. After 24 h of cell culture, the culture medium was removed and 2‰ DMSO solvent was added as a negative control and 2 μmol of nintedanib was added as a positive control. The other groups were treated with 40 μmol, 10 μmol, 2.5 μmol, 625 nmol and 156 nmol of synthetic peptide OFMP at equal proportions. Half an hour later, 10 nmol of recombinant human TGFβ1 stimulator was added to the other groups except the blank control. After 24 h of continuous stimulation, the mRNA expressions of genes Col1a1, TGFβ1 and CTGF were detected in OFMP3178, and the mRNA expressions of genes Col1a1 and α-SMA were detected in OFMP2067 and OFMP1080, respectively.
[0159] The results are shown in Figures 27-29. Compared with the model group, the expression levels of genes Col1a1, CTGF and TGFβ1 in pulmonary fibrosis cells were significantly decreased after administration of different concentrations of synthetic peptide OFMP3178. Among them, under the treatment condition of 40μmol-24h, the downward trend of gene expression levels of Col1a1, CTGF and TGFβ1 in pulmonary fibrosis cells was the most significant, and there were significant differences compared with the positive drug Nintedanib group. The results showed that synthetic peptide OFMP3178 has a good therapeutic effect on pulmonary fibrosis.
[0160] Compared with the model group, the expression levels of genes Col1a1 and α-SMA in pulmonary fibrosis cells decreased significantly after administration of different concentrations of synthetic peptide OFMP2067. Among them, under the treatment conditions of 40μmol-24h, the downward trend of gene expression levels of Col1a1 and α-SMA in pulmonary fibrosis cells was the most significant, and there were significant differences compared with the positive drug Nintedanib group. The results showed that synthetic peptide OFMP2067 has a good therapeutic effect on pulmonary fibrosis.
[0161] Compared with the model group, the expression level of gene Col1a1 in pulmonary fibrosis cells decreased significantly after administration of different concentrations of synthetic peptide OFMP1080. Among them, under the treatment condition of 10μmol-24h, the downward trend of gene Col1a1 expression level in pulmonary fibrosis cells was the most significant. The results showed that synthetic peptide OFMP1080 has a good therapeutic effect on pulmonary fibrosis.
[0162] Example 8
[0163] In this example, the monoclonal antibody against the micropeptide OFMP was subjected to antigen design, animal immunization, subcloning, and quality control Elisa testing.
[0164] Based on the sequences of the micropeptides OFMP3178, OFMP2067, and OFMP1080, corresponding antigen sequences were designed, synthesized, and conjugated. Four healthy female BALB / c mice (8-12 weeks of age) were immunized with these antigens for four routine immunizations. After the final immunization, blood was collected for ELISA titer analysis of the antiserum (on a peptide antigen plate). Mice with antiserum titers exceeding 8K were selected for fusion. After fusion, cells were diluted and plated in 384-well plates, cultured for 14 days, and supernatants from the plates were collected for ELISA analysis of antigen reactivity. High-affinity strains were selected for subcloning.
[0165] After screening, cells were plated in 96-well plates and the supernatant was assayed for antigen reactivity using an ELISA. Antibodies with high affinity were selected for the next round of subcloning. Repeat the above steps until the plate-positive cell line yielded 100% positive results, indicating that a monoclonal antibody had been obtained and a cell line had been successfully established. For ELISA testing of the corresponding antigen, a maximum coating amount of 10 ng of protein antigen was used, which was serially diluted to a minimum coating amount of 0.02 ng. Blocking was performed with 5% milk in PBST. The primary antibody was diluted 1:1000 and incubated at 37°C for 1 hour. The secondary antibody was incubated at 37°C for 45 minutes. The reaction was terminated with a colorimetric solution at 37°C for 15 minutes before reading. The results are shown in Table 6.
[0166] Table 6 Elisa sensitivity test of monoclonal antibodies against OFMP
[0167]
[0168] This example illustrates that the monoclonal antibody against OFMP can be used to detect the micropeptide OFMP.
Claims
1. A micropeptide related to organ fibrosis, characterized in that: The amino acid sequence of the micropeptide is any of the following: (a) the amino acid sequence shown in any one of SEQ ID NOs: 1-3; (b) an amino acid sequence having 85% or more homology with the amino acid sequence shown in any one of SEQ ID NOs: 1-3; (c) An amino acid sequence with equivalent function formed by replacing, deleting or adding one or more amino acid residues to the amino acid sequence shown in any one of SEQ ID NOs: 1-3.
2. A nucleotide sequence encoding the micropeptide according to claim 1.
3. Use of the micropeptide according to any one of claims 1 to 2 in the preparation of an organ fibrosis detection or treatment reagent or drug.
4. Use of long non-coding RNA in the preparation of an organ fibrosis detection or treatment reagent or drug, characterized in that: The ID number of the long non-coding RNA in the Ensembl database is: ENSG00000224023, ENSG00000263126 or ENSG00000265666.
5. The use according to claim 3 or 4, characterized in that: The organ fibrosis includes one or more of liver fibrosis, kidney fibrosis, lung fibrosis, heart fibrosis, and skin fibrosis.
6. The use according to claim 3 or 4, characterized in that: The organ fibrosis detection is achieved by using a specific primer pair designed for the nucleotide sequence described in claim 2 or claim 4.
7. A recombinant vector containing the nucleotide sequence of claim 2 or 4.
8. A pharmaceutical composition, characterized in that The pharmaceutical composition contains the micropeptide according to claim 1, the nucleotide sequence according to claim 2 or the nucleotide sequence according to claim 4, and a pharmaceutically acceptable carrier thereof.
9. An organ fibrosis detection kit, characterized in that: The kit contains specific primer pairs and / or antibodies designed for the nucleotide sequence according to claim 2 or claim 4.
10. The organ fibrosis detection kit according to claim 9, characterized in that: The nucleotide sequence of the specific primer pair is selected from any one of the following groups: (a) F: AGTGCCCGGACTTTTGTTCT; R: TGGGACTTTCACTCGGGGTA; (b) F: ACCACATGGGCTCCGTTATG; R: GCTGCTTTGCCAAGTGAGTT; (c) F: AGACACCGGCTTGTGTCATT; R: TCTGCCTGTGTTTGTGCCA.