Application of Lactobacillus plantarum AY01 in the preparation of products inhibiting colorectal cancer liver metastasis

The product for inhibiting liver metastasis of colorectal cancer, prepared using Lactobacillus plantarum AY01, solves the problems of high recurrence rate and significant side effects of existing treatments, and achieves effective inhibition of liver metastasis of colorectal cancer and improvement of liver tissue.

CN122297535APending Publication Date: 2026-06-30KUNMING UNIV OF SCI & TECH
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
KUNMING UNIV OF SCI & TECH
Filing Date
2026-04-02
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Current treatments for colorectal cancer liver metastases have high recurrence rates and significant side effects, and the application of probiotics in inhibiting colorectal cancer liver metastases varies significantly, resulting in a lack of effective treatment options.

Method used

A product for inhibiting liver metastasis of colorectal cancer was prepared using Lactobacillus plantarum AY01. By inhibiting the survival rate, colony formation and migration of colorectal cancer cells CT26.WT, the number of liver metastases and inflammatory cell infiltration were reduced, and the pathological state of liver tissue was improved. The product was prepared into a pharmaceutically acceptable formulation.

Benefits of technology

Lactobacillus plantarum AY01 significantly reduces the number and size of colorectal cancer liver metastases, decreases the proportion of Ki-67 and PCNA positive cells, improves liver tissue pathology, and provides a safe probiotic adjuvant therapy option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122297535A_ABST
    Figure CN122297535A_ABST
Patent Text Reader

Abstract

This invention discloses Lactobacillus plantarum ( Lactobacillus plants The application of Lactobacillus plantarum AY01 in the preparation of products inhibiting colorectal cancer liver metastasis is described. The Lactobacillus plantarum AY01 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M 20221517. The advantages of this invention are: Lactobacillus plantarum AY01 has the characteristics of inhibiting CT26.WT cell viability, suppressing CT26.WT cell clone formation, inhibiting CT26.WT cell scratch repair, reducing its migration ability, and thus reducing tumor metastatic potential. Mouse experiments with colorectal cancer liver metastasis show that the bacterial suspension of this strain can significantly reduce the number of tumors at metastatic sites in the liver, inhibit liver tumor colonization and proliferation, reduce inflammatory cell infiltration, reduce the proportion of Ki-67 and PCNA positive cells in the liver, alleviate liver tissue damage caused by colorectal cancer liver metastasis, promote the restoration of normal liver structure, protect the liver, and exert an anti-colorectal cancer liver metastasis effect, providing theoretical support for probiotic adjuvant therapy for colorectal cancer liver metastasis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to the application of Lactobacillus plantarum AY01 in the preparation of products that inhibit liver metastasis of colorectal cancer. Background Technology

[0002] Colorectal cancer is the third leading cause of cancer incidence and the second leading cause of cancer death worldwide, posing a serious threat to human health. The incidence of this disease in my country is showing an increasing trend year by year. Liver metastasis is one of the leading causes of death in colorectal cancer patients; 15% of patients are diagnosed with liver metastasis at initial diagnosis, and another 50% develop liver metastasis during the course of colorectal cancer development. Currently, the main treatments for colorectal cancer liver metastasis are surgery, chemotherapy, and radiotherapy, which have problems such as high recurrence rates and significant side effects. Probiotics and their metabolites, due to their high safety and wide availability, show great promise in the prevention and adjuvant treatment of cancer and its complications. Although some studies have shown that *Lactobacillus plantarum* has the properties of blocking the cell cycle of HT-29 cells, inducing HT-29 cell apoptosis, and inhibiting HT-29 cell proliferation, the pathological mechanisms, cell models, and target sites of colorectal cancer liver metastasis differ significantly from those of primary colorectal cancer. Therefore, research on the role of microorganisms in inhibiting colorectal cancer liver metastasis is of great significance.

[0003] The pathogenesis of colorectal cancer and its liver metastasis is closely related to gut microbiota dysbiosis, especially the enrichment of pathogenic bacteria such as PKS and Escherichia coli, which can damage the intestinal barrier, promote the formation of the pre-metastatic microenvironment, and accelerate the liver metastasis of colorectal cancer. Probiotics, on the other hand, possess the potential for safe and non-toxic anti-tumor applications. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide the application of Lactobacillus plantarum AY01 in the preparation of products that inhibit liver metastasis of colorectal cancer.

[0005] To solve the above-mentioned technical problems, the technical solution of the present invention is *Lactobacillus plantarum* (…). Lactobacillus plantarum The application of AY01 in the preparation of products that inhibit liver metastasis of colorectal cancer. The Lactobacillus plantarum AY01 is deposited at the China Center for Type Culture Collection, with accession number CCTCC M 20221517.

[0006] Furthermore, the application is to inhibit the survival rate of colorectal cancer cells CT26.WT.

[0007] Furthermore, the application is to inhibit the clonogenic formation of colorectal cancer cells CT26.WT.

[0008] Furthermore, the application is to inhibit the migration and scratch repair of colorectal cancer cells CT26.WT.

[0009] Furthermore, the application is to reduce the number and volume of colorectal cancer liver metastases and to reduce inflammatory cell infiltration.

[0010] Furthermore, the application aims to reduce the proportion of Ki-67 and PCNA-positive cells in colorectal cancer liver metastases and improve the pathological state of liver tissue.

[0011] Furthermore, the product exhibits time- and dose-dependent safety in normal human colonic epithelial cells CCD 841 CoN.

[0012] Furthermore, the product is a pharmaceutically acceptable pharmaceutical preparation.

[0013] This invention also provides Lactobacillus plantarum ( Lactobacillus plantarum The application of bacterial suspension and fermentation supernatant of AY01 in the preparation of products inhibiting liver metastasis of colorectal cancer. The Lactobacillus plantarum AY01 is deposited at the China Center for Type Culture Collection, with accession number CCTCC M 20221517.

[0014] Furthermore, the application involves inhibiting the survival rate of colorectal cancer cells CT26.WT, inhibiting the colony formation of colorectal cancer cells CT26.WT, inhibiting the migration and scratch repair of colorectal cancer cells CT26.WT, reducing the number and volume of colorectal cancer liver metastases, reducing inflammatory cell infiltration, reducing the proportion of Ki-67 and PCNA positive cells in colorectal cancer liver metastases, and improving the pathological state of liver tissue.

[0015] Furthermore, the product exhibits time- and dose-dependent safety in normal human colonic epithelial cells CCD 841 CoN.

[0016] Furthermore, the product is a pharmaceutically acceptable pharmaceutical preparation.

[0017] Beneficial effects of this invention: The *Lactobacillus plantarum* AY01 strain of this invention exhibits properties that inhibit CT26.WT cell survival, suppress CT26.WT cell clone formation, inhibit CT26.WT cell scratch repair, and reduce their migration ability, thereby reducing tumor metastatic potential. Mouse experiments with colorectal cancer liver metastases show that the bacterial suspension of this strain can significantly reduce the number of tumors at metastatic liver sites, inhibit liver tumor colonization and proliferation, reduce inflammatory cell infiltration, decrease the proportion of Ki-67 and PCNA positive cells in the liver, alleviate liver tissue damage caused by colorectal cancer liver metastases, promote the restoration of normal liver structure, protect the liver, and exert an anti-colorectal cancer liver metastasis effect, providing theoretical support for probiotic adjuvant therapy for colorectal cancer liver metastases. Studies of mouse gut microbiota show that *Lactobacillus plantarum* AY01 can alter gut microbiota composition and affect liver metabolism and energy homeostasis in mice. Furthermore, *Lactobacillus plantarum* AY01 has good safety against normal human colonic epithelial cells CCD 841 CoN and can be used to prepare drugs that inhibit colorectal cancer liver metastases. Attached Figure Description

[0018] Figure 1 Line graphs showing the survival rates of three cell types after treatment with different concentrations of Lactobacillus plantarum AY01 suspension, PKS+Escherichia coli CRC2-6 suspension, and 2'-deoxyinosine dilution. Figure 2 Schematic diagram showing the effects of different concentrations of *Lactobacillus plantarum* AY01 bacterial suspension, *pks* + *Escherichia coli* CRC2-6 bacterial suspension, and 2'-deoxyinosine dilution on cell clone formation in three cell types: normal human colonic epithelial cells CCD 841 CoN, human colorectal adenocarcinoma cells HT-29, and mouse colonic cancer cells CT26.WT. Figure 3 Schematic diagram of cell scratch repair of three cell types: normal human colonic epithelial cells CCD 841 CoN, human colorectal adenocarcinoma cells HT-29, and mouse colonic cancer cells CT26.WT, respectively, using 100-fold concentration of Bacillus plantarum AY01 bacterial suspension and pks+ Escherichia coli CRC2-6 bacterial suspension. Figure 4 The bar chart shows the amount of bacteria adhering to and invading three cell types (human normal colonic epithelial cells CCD 841 CoN, human colorectal adenocarcinoma cells HT-29, and mouse colon cancer cells CT26.WT) in 100-fold concentration of *Lactobacillus plantarum* AY01 bacterial suspension and pks+ *Escherichia coli* CRC2-6 bacterial suspension. Figure 5 A bar chart showing the number of liver tumors in mice of each group at 28 days. Figure 6 A graph showing the change in liver metastatic tumor size over time in mice of each group; Figure 7HE staining images of the liver tissue of mice in each group; Figure 8 Immunohistochemical staining images of the liver region in mice of each group; Figure 9 Bar chart showing the PCNA cell positivity rate and Ki-67 cell positivity rate in the liver of mice in each group; Figure 10 Volcano plot of differentially expressed genes in the eukaryotic transcriptome of liver tissue from mice in each group; Figure 11 Map of KEGG enrichment pathways in the liver transcriptome of mice in each group; Figure 12 Bar chart showing the α-diversity of the gut microbiota structure in mice of each group; Figure 13 β-diversity among different groups was calculated based on PCA and PcoA. Figure 14 The composition of gut microbiota at the phylum level in different groups; Figure 15 This represents the gut microbiota composition at the genus level for different groups. Detailed Implementation

[0019] The specific embodiments of the present invention will be further described below with reference to the accompanying drawings. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0020] Example 1 Lactobacillus plantarum AY01 is a known strain, and it is the same strain claimed in the invention patent application number 202211438725.X, entitled "A strain of Lactobacillus plantarum AY01 and its applications." The isolation, screening, identification, and preservation information of this strain are as follows: Isolation, screening, identification and preservation of Lactobacillus plantarum strain AY01 1. The *Lactobacillus plantarum* was isolated and screened from fermented goat milk in Shilin, Yunnan Province. The specific procedure was as follows: 1 mL of goat milk sample was added to 5 mL of sterile physiological saline, shaken to mix, and 20 μL was inoculated into MRS liquid medium. The culture was incubated at 37°C for 48 h. The bacterial suspension was diluted with physiological saline in a gradient, and 100 μL was directly plated onto MRS plates. After incubation at 37°C for 48 h, single colonies with different morphologies were selected and inoculated into MRS liquid medium. After incubation at 37°C for 48 h, the culture was preserved in 50% glycerol. Keep in an 80℃ refrigerator for later use.

[0021] 2. Morphological identification of the strain: The selected strain was Gram stained and the morphology and color of the bacteria were observed under an oil immersion microscope. The strain was Gram positive, short rod-shaped, smooth, dense, and white.

[0022] 3. Molecular biological identification of the strain: The strain was inoculated into MRS liquid medium and placed in a 37°C incubator for activation culture. Then, genomic DNA was extracted from the strain (DNA extraction was performed using the QIAamp genomic DNA kit). (and RNA kits), using the bacterial 16S rRNA gene universal primer 27F (5') AGAGTTTGATCCTGGCTCAG 3') and 1492R(5') TACGACTTAACCCCAATCGC 3') The 16S rRNA gene of this isolated strain was amplified by PCR. Reaction system: 12.5 μL 2×TaqPCR Master Mix, 1 μL each of forward and reverse primers, 1 μL DNA template, 9.5 μL ddH2O; Reaction program: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s, 30 cycles; 72℃ for 5 min; The PCR product was sent to a sequencing company for gene sequencing (see sequence listing). The sequenced 16S rRNA gene was then BLAST-aligned in GenBank using the NCBI database, and a phylogenetic tree was constructed using MEGA 7.0 software.

[0023] The 16S rRNA gene sequence of strain AY01 was determined, as shown below: cacggggggc ctgcctatac atgcaagtcg aacgaactct ggtattgattggtgcttgca 60 tcatgattta catttgagtg agtggcgaac tggtgagtaa cacgtgggaaacctgcccag 120 aagcggggga taacacctgg aaacagatgc taataccgca taacaacttggaccgcatgg 180 tccgagcttg aaagatggct tcggctatca cttttggatg gtcccgcggcgtattagcta 240 gatggtgggg taacggctca ccatggcaat gatacgtagc cgacctgagagggtaatcgg 300 ccacattggg actgagacac ggcccaaact cctacgggag gcagcagtagggaatcttcc 360 acaatggacg aaagtctgat ggagcaacgc cgcgtgagtg aagaagggtttcggctcgta 420 aaactctgtt gttaaagaag aacatatctg agagtaactg ttcaggtattgacggtattt 480 aaccagaaag ccacggctaa ctacgtgcca gcagccgcgg tatacgtaggtggcaagcg 540 ttgtccggat ttattgggcg taagcgagc gcaggcggtt ttttaagtctgatgtgaaag 600 ccttcggctc aaccgaagaa gtgcatcgga aactgggaaa cttgagtgcagaagaggaca 660 gtggaactcc atgtgtagcg gtgaaatgcg tagatatatg gaagaacaccagtggcgaag 720 gcggctgtct ggtctgtaac tgacgctgag gctcgaaagt atgggtagcaaacaggatta 780 gataccctgg tagtccatac cgtaaacgat gaatgctaag tgttggagggtttccgccct 840 tcagtgctgc agctaacgca ttaagcattc cgcctgggga gtacggccgcaaggctgaaa 900 ctcaaaggaa ttgacggggc ccgcacaagc ggtggagcat gtggtttaattcgaagctac 960 gcgaagaacc ttaccagtct tgacatacta tgcaaatcta agagattagacgttcccttc 1020 ggggacatgg atacagtggg tgcatggttg tcgtcagctc gtgtcgtgagatgttgggta 1080 gtcccgcacg gagcgcaccc ttattatcag ttgccagcat tagttgggccactctggtga 1140 gactgccgtg acaaaccgga ggaaa 1165 Experimental Results: The strain AY01, screened from fermented goat milk in Shilin, Yunnan Province, was identified as *Lactobacillus plantarum* through morphological observation, phylogenetic tree construction, and 16S rRNA gene sequence alignment. When inoculated into sterile MRS liquid medium and cultured at 37℃ for 24 hours, the strain grew well, forming spherical, grayish-white colonies. This strain was deposited on September 27, 2022, at the China Center for Type Culture Collection (CCTCC, address: No. 17, Luojia Mountain, Bayi Road, Wuchang District, Wuhan, Hubei Province), and classified as *Lactobacillus plantarum*, with accession number CCTCC M 20221517.

[0024] Preparation of *Lactobacillus plantarum* AY01 bacterial suspension: *Lactobacillus plantarum* AY01 strain stored at -80℃ was removed, thawed at room temperature, and inoculated into autoclaved MRS liquid medium at an inoculation rate of 4‰. The medium was incubated at 37℃ for 24 h and passaged three times. 1 mL of the bacterial suspension was diluted and plated for counting; plates with a colony count between 30 and 300 were included in the calculation. The CFU per mL of *Lactobacillus plantarum* AY01 bacterial suspension was calculated as (average colony count / volume of diluent used for plating) x dilution factor. The concentration of the *Lactobacillus plantarum* AY01 dilution used to treat colorectal cells was 10... 5 10 6 10 7 10 8 10 9 10 10 CFU / mL was serially diluted using cell culture medium without triple antibodies to achieve final concentrations of 0.1, 1, 10, 100, 1000, and 10000 times that of colorectal cells.

[0025] Preparation of PKS+ *E. coli* CRC2-6 bacterial suspension: PKS+ *E. coli* CRC2-6 is an anaerobic-facultative anaerobic strain with a PKS gene island isolated from the cancer site of a colorectal cancer patient. The PKS+ *E. coli* CRC2-6 strain, stored at -80℃, was removed, thawed at room temperature, and inoculated at a 2% inoculum into autoclaved LB broth. The culture was incubated at 37℃ for 12 h, and subcultured three times. The counting and dilution methods were the same as above.

[0026] Preparation of 2'-deoxyinosine diluent: Weigh 1 g of 2'-deoxyinosine powder. Since 2'-deoxyinosine has poor water solubility, dissolve it in 1 mL of DMSO solution first. After complete dissolution, dilute with complete cell culture medium containing three antibiotics. Use the two-fold dilution method to make the final concentrations: 200, 100, 50, 25, 12.5, and 6.25 μmol / mL.

[0027] Resuscitation and Culture of Three Cell Lines Cell resuscitation: Human normal colonic epithelial cells CCD 841 CoN, human colorectal adenocarcinoma cells HT-29, and mouse colon cancer cells CT26.WT were removed from a -80℃ freezer. Following the principle of "slow freeze, rapid thaw," the cells were quickly placed in a 37℃ water bath for 2 minutes, followed by centrifugation at 1000 rpm for 5 minutes. The supernatant was carefully removed, retaining the lower cell pellet. The cells were resuspended in 1 mL of freshly prepared complete cell culture medium. Human normal colonic epithelial cells CCD 841 CoN were cultured in DMEM complete medium (DMEM medium + 10% fetal bovine serum + 1% triple antibody), while human colorectal adenocarcinoma cells HT-29 and mouse colon cancer cells CT26.WT were cultured in RPMI 1640 complete medium (RPMI 1640 medium + 10% fetal bovine serum + 1% triple antibody). After thorough resuscitation, the cells were transferred to T25 cell culture flasks, and 5 mL of complete culture medium was added. The cells were then incubated statically in a 37℃, 5% CO2 cell culture incubator. Recovery complete.

[0028] Cell passage culture: After 48 h of cell culture, observe cell growth using an inverted microscope. When the cell surface area reaches 80%-90% of the cell culture flask surface, passage is performed. Discard the old culture medium, add PBS, gently wash 3 times, and then add 1 mL of trypsin. Place the culture flask horizontally and incubate at 37°C for 2 min. Gently tap the flask wall; if cells are observed to fall like quicksand, add 1 mL of complete culture medium to stop digestion. Repeatedly pipette the cells until a single-cell suspension is formed. Centrifuge at 1000 rpm for 5 min and discard the supernatant. Resuspend the cells in complete culture medium, then divide them equally into two cell culture flasks, add fresh culture medium to each, and incubate at 37°C in a 5% CO2 cell culture incubator.

[0029] Example 2 Co-culture experiment of *Lactobacillus plantarum* AY01 on the survival rate of colorectal cancer CT26.WT cells and normal human colonic epithelial cells CCD 841 CoN cells. 100 μL of 1 × 10 5 Three cell types (human normal colonic epithelial cells CCD 841CoN, human colorectal adenocarcinoma cells HT-29, and mouse colon cancer cells CT26.WT) were added to 96-well plates at a concentration of [number] cells / mL. Complete cell culture medium was added, and the cells were cultured overnight to allow adherence. The old medium was removed, and bacterial dilutions (Lactobacillus plantarum AY01 suspension, PKS+Escherichia coli CRC2-6 suspension, and 2'-deoxyinosine dilution) were added at different concentrations. Cells were cultured for 2, 6, 12, 24, 48, and 72 h, and cell viability was assessed. The procedures were performed according to the Cell Counting Kit-8, C0038 instructions. Treatment times ranged from 30 min to 4 h, with the standard being a bright orange color change. The cells were then placed in a microplate reader, and absorbance was read at OD490. Cell viability was calculated according to the consensus statement in the instructions. Cell viability = (absorbance of experimental group - absorbance of blank control group) / (absorbance of positive control group - absorbance of blank control group), with 6 replicates for each treatment.

[0030] Linear plots were drawn showing the survival rates of three cell types after treatment with different concentrations of *Lactobacillus plantarum* AY01 suspension, *pks* + *Escherichia coli* CRC2-6 suspension, and 2'-deoxyinosine dilution. Figure 1 As shown. Figure 1 In the figure, A, B, and C represent the survival rates of different concentrations of 2'-deoxyinosine on three cell types: normal human colonic epithelial cells CCD 841 CoN, human colorectal adenocarcinoma cells HT-29, and mouse colonic cancer cells CT26.WT. Figure 1 D, E, and F represent the survival rates of different concentrations of Lactobacillus plantarum AY01 bacterial suspension on three cell lines: normal human colonic epithelial cells CCD 841 CoN, human colorectal adenocarcinoma cells HT-29, and mouse colonic cancer cells CT26.WT. Figure 1 G, H, and I represent the survival rates of different concentrations of PKS+ Escherichia coli CRC2-6 bacterial suspension on three cell lines: normal human colonic epithelial cells CCD 841 CoN, human colorectal adenocarcinoma cells HT-29, and mouse colonic cancer cells CT26.WT.

[0031] Figure 1A showed that low concentrations of 2'-deoxyinosine (6.25 μmol / mL, 12.5 μmol / mL) promoted the proliferation of normal human colonic epithelial cells CCD 841 CoN, while medium concentrations had no significant effect. High concentrations of 2'-deoxyinosine (100 μmol / mL, 200 μmol / mL) reduced the survival rate of normal cells within 24 hours.

[0032] Figure 1 B indicates that, for HT-29 cells, the survival rate gradually increased from 2 to 12 hours, and gradually decreased after 12 hours. The results suggest that 2'-deoxyinosine has no significant inhibitory effect on HT-29 cells.

[0033] Figure 1 C indicates that 2'-deoxyinosine maintained the cell viability of CT26.WT cells in the range of 75%-90%, suggesting that CT26.WT cells are not sensitive to the concentration and treatment time of 2'-deoxyinosine.

[0034] Figure 1 The results showed that, for CCD 841 CoN cells, treatment with *Lactobacillus plantarum* AY01 promoted the proliferation of normal human colonic epithelial cells (CCD 841 CoN) in a dose-dependent manner from 2 to 6 hours, with higher concentrations of *Lactobacillus plantarum* AY01 resulting in higher cell proliferation. However, from 6 to 12 hours, the cell survival rate of CCD 841 CoN cells decreased, and after 12 hours, the cell survival rate showed a trend of first increasing and then decreasing again. These results indicate that *Lactobacillus plantarum* AY01 suspension, especially low-concentration suspension, has a time- and dose-dependent safe effect on normal human colonic epithelial cells (CCD 841 CoN).

[0035] Figure 1 E indicates that, against human colorectal adenocarcinoma cells HT-29, high concentrations of *Lactobacillus plantarum* AY01 bacterial suspension (V bacterial suspension concentration / V cell concentration > 1000) significantly reduced HT-29 cell survival within 6–12 h. With prolonged exposure, medium concentrations of *Lactobacillus plantarum* AY01 bacterial suspension reduced HT-29 cell survival by approximately 60% at 72 h.

[0036] Figure 1 F indicates that the effect of *Lactobacillus plantarum* AY01 bacterial suspension on the viability of CT26.WT cells was concentration- and time-dependent. Prolonged treatment time and increased suspension concentration both led to a decrease in cell viability. The results show that *Lactobacillus plantarum* AY01 bacterial suspension can significantly inhibit the viability of CT26.WT cells.

[0037] Figure 1 G indicates that pks+ The survival rate of normal CCD 841 CoN cells decreased at 6 h and 72 h after Escherichia coli CRC2-6 treatment. Figure 1 H and I indicate that pks + E. coli CRC2-6 induces rapid growth of two colorectal cancer cells, HT-29 and CT26.WT, within a short period of about 2 hours. However, between 6 and 24 hours, neither concentration nor duration of exposure significantly affects the growth rate of either cancer cell type. At 48 hours, high concentrations of PKS... + E. coli treatment reduced the survival rate of both cancer cell types. After 72 hours, the survival rate of CT26.WT cells increased again, possibly due to the significant death of CT26.WT cells. + The presence of E. coli as a growth predominant factor can lead to false positive results.

[0038] Example 3 Effects of Lactobacillus plantarum AY01 on colony formation and proliferation of colorectal cancer CT26.WT cells Three cell lines were selected: human normal colonic epithelial cells CCD 841 CoN in logarithmic growth phase, human colorectal adenocarcinoma cells HT-29, and mouse colon cancer cells CT26.WT. After resuspending and counting, the cells were added to 6-well plates at a density of 500 cells / mL and incubated in a CO2 incubator for 12 hours. Then, 100 μL of different concentrations (10T) were added to the incubator for each cell type. 5 10 6 10 7 10 8 10 9 The culture medium consisted of *Lactobacillus plantarum* AY01 suspension (CFU / mL) and *pks+* *Escherichia coli* CRC2-6 suspension (at final concentrations of 0.1, 1, 10, 100, and 1000 times the cell count), as well as different concentrations of 2'-deoxyinosine dilution (200, 100, 50, 25, 12.5, and 6.25 μmol / mL). The medium was changed every 3 days for 10 days. At the end of the experiment, the old culture medium was aspirated, and the cells were gently rinsed twice with 2 mL of phosphate buffer. Then, 2 mL of methanol solution was added for fixation for 15–30 min, the methanol was discarded, and 2 mL of crystal violet was added for fixation in the dark for 15–30 min. After discarding the crystal violet, the wells were washed twice with PBS, air-dried, and photographed. The control group (CK group) was a blank treatment without the addition of *Lactobacillus plantarum* AY01 suspension, *pks+* *Escherichia coli* CRC2-6 suspension, and 2'-deoxyinosine dilution to the cell culture incubator.

[0039] This embodiment measured different concentrations of *Lactobacillus plantarum* AY01 bacterial suspensions, pks +The effects of *Escherichia coli* CRC2-6 bacterial suspension and 2'-deoxyinosine dilution on cell colony formation in three cell lines: normal human colonic epithelial cells (CCD 841 CoN), human colorectal adenocarcinoma cells (HT-29), and mouse colonic cancer cells (CT26.WT). Results are as follows: Figure 2 As shown. Among them. Figure 2 Figure A shows the effects of different concentrations of 2'-deoxyinosine dilution on cell clone formation in three cell types: normal human colonic epithelial cells (CCD 841 CoN), human colorectal adenocarcinoma cells (HT-29), and mouse colonic cancer cells (CT26.WT). Figure 2 B shows the effects of treating human normal colonic epithelial cells (CCD 841 CoN), human colorectal adenocarcinoma cells (HT-29), and mouse colonic cancer cells (CT26.WT) with different concentrations of Lactobacillus plantarum AY01 bacterial suspension on cell clone formation. Figure 2 C represents the effect of different concentrations of pks+ Escherichia coli CRC2-6 bacterial suspension on cell clone formation in three types of cells: normal human colonic epithelial cells CCD 841 CoN, human colorectal adenocarcinoma cells HT-29, and mouse colonic cancer cells CT26.WT. from Figure 2 As shown in Figure A, treatment with diluted 2'-deoxyinosine reduced the colony formation of human normal colonic epithelial cells (CCD 841 CoN). However, human colorectal adenocarcinoma cells HT-29 and mouse colon cancer cells CT26.WT showed virtually no colony formation. These results indicate that 2'-deoxyinosine significantly inhibited colony formation and reduced proliferation in human colorectal adenocarcinoma cells HT-29 and mouse colon cancer cells CT26.WT, thus promoting tumor growth in vivo.

[0040] from Figure 2 As shown in Figure B, treatment with *Lactobacillus plantarum* AY01 suspension resulted in virtually no cell clone formation in normal human colonic epithelial cells (CCD 841CoN). In contrast, human colorectal adenocarcinoma cells (HT-29) showed reduced cell clone formation. The control group of mouse colon cancer cells (CT26.WT) exhibited poor clone formation due to prolonged culture time and the inherent tendency for apoptosis during in vitro culture, essentially failing to form cell clones. These results indicate that *Lactobacillus plantarum* AY01 can inhibit the clone formation of mouse colon cancer cells (CT26.WT), but it also simultaneously hinders the clone formation of normal cells.

[0041] from Figure 2 C shows that pks + After treatment with Escherichia coli CRC2-6 suspension, the cell colony formation of normal cells and HT-29 cells was basically unaffected, but the colony formation ability of CT26.WT was difficult to observe.

[0042] Example 4 Scratch and repair assay of Lactobacillus plantarum AY01 on colorectal cancer CT26.WT cells Draw five parallel straight lines on the back of each 6-well plate using a marker, then sterilize and set aside. Take 1×10⁻⁶ of each well plate. 5 Three cell lines—CT26.WT cells, CCD 841 CoN cells, and HT-29 cells—were seeded into sterile 6-well plates. After cell attachment, 10 μL pipette tips were used to make incisions perpendicular to the horizontal lines of a marker pen. The cells were washed three times with PBS to form incisions. The control group was cultured in serum-free and antibiotic-free medium, while the experimental groups were cultured with 100-fold concentrations of *Lactobacillus plantarum* AY01 suspension and PKS+ *Escherichia coli* and CRC2-6 suspensions, respectively. Photos were taken at 0, 2, 6, 12, 24, 48, and 72 h.

[0043] This embodiment measured the concentration of 100-fold *Lactobacillus plantarum* AY01 suspension and pks. + The effects of Escherichia coli CRC2-6 bacterial suspension on scratch repair in three cell lines: normal human colonic epithelial cells (CCD 841 CoN), human colorectal adenocarcinoma cells (HT-29), and mouse colonic cancer cells (CT26.WT). The results are as follows: Figure 3 As shown. Among them. Figure 3 Figure A shows the effect of the control group and experimental group on the cell scratch repair of normal human colonic epithelial cells using CCD 841 CoN. Figure 3 B shows the effect of the control group and experimental group on the repair of scratches in human colorectal adenocarcinoma cells HT-29. Figure 3 Figure C shows the effect of the control group and experimental group on the cell scratch repair of mouse colon cancer cells CT26.WT.

[0044] from Figure 3 As shown in Figure A, for CCD 841 CoN cells, treatment with 100-fold concentration of *Lactobacillus plantarum* AY01 for 48 h and 72 h resulted in the enlargement of cell scratches. Simultaneously, the monolayer cell morphology on both sides of the scratches became loose, and the coverage decreased. Meanwhile, 100-fold concentration of PKS... + After 24 hours of treatment with E. coli, the monolayer cell structure of normal cells disappeared, and the scratches disappeared. from Figure 3 B shows that treatment with *Lactobacillus plantarum* AY01 on HT-29 cells has virtually no effect on scratch repair or enlargement, but pks + After 12 hours of treatment with E. coli, the structure of HT-29 cells was destroyed and the scratches disappeared. from Figure 3 As can be seen from C, treatment with *Lactobacillus plantarum* AY01 on CT26.WT cells enlarged the scratches after 72 h, and reduced the cell coverage on both sides of the scratches.+ After 6 hours of treatment with E. coli, the structure of cells on both sides of the scratch began to be destroyed, and the cells were completely lysed after 12 hours.

[0045] The above results indicate that *Lactobacillus plantarum* AY01 can disrupt scratches on normal human colonic epithelial cells CCD 841 CoN and mouse colon cancer cells CT26.WT, reducing their migration ability, but has no significant effect on scratches on HT-29 cells. + Escherichia coli can cause scratches on three types of cells to enlarge or even destroy the cell structures on both sides of the scratch.

[0046] Example 5 Experiments on bacterial adhesion and invasion of cells Bacterial adhesion: For three cell types (human normal colonic epithelial cells CCD 841 CoN, human colorectal adenocarcinoma cells HT-29, and mouse colon cancer cells CT26.WT), 10 μL of each cell type was seeded in each well of a 6-well plate. 5 Cells were cultured in 2 mL of cell culture medium for 24 h until they adhered to the plate. For each cell type, after adhesion, a 100-fold concentration of *Lactobacillus plantarum* AY01 suspension and a *PKS* + *Escherichia coli* CRC2-6 suspension were added to each well. Bacteria and cells were co-cultured for 2 h to complete adhesion. Adhering bacteria were counted: the co-culture plate was washed three times with PBS to remove unadhered bacteria. Cells were lysed with cell lysis buffer (trypsin + Triton X-100) and collected. The collected cell suspension was serially diluted and plated for counting. Bacterial invasion: After the adhesion experiment and washing, 200 μmol / mL gentamicin was added to interact with the bacteria adhering to the cell surface for 2 h. After washing with PBS, the cells were lysed, diluted, and plated for counting.

[0047] This experiment determined the adhesion and invasion of three cell types (human normal colonic epithelial cells CCD 841 CoN, human colorectal adenocarcinoma cells HT-29, and mouse colonic cancer cells CT26.WT) by 100-fold concentrations of *Lactobacillus plantarum* AY01 bacterial suspension and PKS+ *Escherichia coli* CRC2-6 bacterial suspension, respectively. The statistical results are as follows: Figure 4 As shown. Figure 4 A represents the adhesion amount of the three types of cells in the treatment with pks+ Escherichia coli CRC2-6 suspension; Figure 4 B represents the adhesion amount of the three types of cells in the treatment with Lactobacillus plantarum AY01 suspension; Figure 4 C represents the invasion amount of the three cell types in the treatment of pks+ Escherichia coli CRC2-6 suspension; Figure 4 D represents the invasion amount of the three cell types in the treatment of *Lactobacillus plantarum* AY01 suspension.

[0048] from Figure 4As can be seen from A and 4C, pks+ E. coli CRC2-6 specifically adheres to normal human colonic epithelial cells CCD841 CoN and invades normal human colonic epithelial cells CCD841 CoN and mouse colon cancer cells CT26.WT; from Figure 4 As can be seen from B and 4D, *Lactobacillus plantarum* AY01 specifically adheres to and invades human colorectal adenocarcinoma cells HT-29 and mouse colon cancer cells CT26.WT.

[0049] Example 6 Effects of Lactobacillus plantarum AY01 on a mouse model of colorectal cancer liver metastasis The male Kunming mice used in the experiment were purchased from Yunnan University and housed in the Kunming University of Science and Technology animal room with filtered air. All mice were randomly divided into cages of five. The animal room operated on a 12-hour day-night cycle, with the temperature controlled at 25 ± 2°C and the relative humidity maintained at 50-70%. The room was kept quiet, and the mice were allowed free access to food and water. They were fed sterile feed that had been treated with radiation and drinking water that had been sterilized by high-pressure steam. The mice were isolated from other ongoing animal experiments.

[0050] Fifty mice were randomly divided into five groups: The first group is the normal control group (number of mice n=10), which is fed only sterile saline and is denoted as "CG"; The second group was the normal model group, i.e., the negative control group (n=10). Each morning, mice were injected with 10 mg of CT26.WT cells into their liver. 5 10 pks + E. coli 5 Individuals that induce liver metastasis of colorectal cancer are denoted as "MG". The third group was the *Lactobacillus plantarum* AY01 suspension gavage treatment group (n=10), which received 10 doses of the suspension daily in addition to the treatment given to the model group. 8 One mL of a CFU / mL suspension of *Lactobacillus plantarum* AY01 is designated as “AY01”. The fourth group is the 2'-deoxyinosine group (Yuanye Biotechnology, S18104). Based on the model group, 0.1 mL of 10 mg / mL 2'-deoxyinosine solution (dissolved in DMSO and then diluted with physiological saline) was injected intraperitoneally every night. This group is designated as the "DI" group. The fifth group was the positive control group. In addition to the model group, they received an intraperitoneal injection of 0.1 mL of 10 mg / mL 5-fluorouracil (5-FU) every evening, denoted as "PG".

[0051] All solutions were dissolved in physiological saline. The entire experiment lasted 4 weeks. One mouse was euthanized by cervical dislocation every 7 days to observe the growth of liver metastases and collect feces. The euthanized mice were dissected, the colon and rectum were removed, and their length was measured. The liver was removed to observe its condition and lesions. At the end of the experiment, all mice were euthanized, and the livers were sectioned pathologically and subjected to immunohistochemical analysis based on Ki-67 and PCNA.

[0052] Example 7 Analyze the changes in the number and volume of liver tumors in mice of different groups. The number of liver tumors in mice of each group at 28 days is as follows: Figure 5 As shown in the figure, the MG model group mice had the highest number of liver tumors, followed by the PG group, while the AY01 and DI groups had significantly fewer tumors than the MG model group. The following figure illustrates the change in liver metastatic tumor size over time in each group of mice. Figure 6 As shown, except for the CG group, mice in the MG model group developed multiple white lesions of varying sizes at 21 days. As time progressed, by 28 days, all groups showed relatively obvious lesions, but the tumor size and number in the AY01 group were significantly smaller than those in the MG model group.

[0053] The results showed that treatment with *Lactobacillus plantarum* AY01 reduced the number and volume of tumors in the liver of mice with colorectal cancer liver metastases, providing a theoretical basis for the use of *Lactobacillus plantarum* AY01 in the preparation of drugs to inhibit colorectal cancer liver metastases.

[0054] Example 8 HE staining and immunohistochemical staining of liver tissue pathological sections Mouse liver tissue was embedded in paraffin, cut into thin sections, and spread out in a room temperature water bath. The sections were then adsorbed onto glass slides and laid flat. The slides were dried and stored at room temperature for later use. The liver tissue pathological sections were then subjected to HE staining and immunohistochemical staining. The basic steps for HE staining are: dewaxing of paraffin sections; hematoxylin-eosin staining; and image acquisition under a microscope. The basic steps for immunohistochemical staining are: dewaxing of paraffin sections; antigen retrieval; blocking of endogenous peroxidase; serum blocking; addition of primary antibody; addition of secondary antibody; DAB staining; dehydration and mounting; and image acquisition under a microscope.

[0055] HE staining images of the liver of mice in each group are shown below. Figure 7 As shown, the differences in pathological morphology of liver tissue under different intervention conditions are visually demonstrated: Control group (CG): Under 1.5x panoramic view, the liver tissue outline was intact, cells were evenly distributed, and there was no obvious structural damage or lesion formation. Under 10x high magnification, hepatocytes were arranged in a radial plate-like pattern with the central vein as the center, the liver lobule structure was clear, the cell morphology was regular, the cytoplasm was abundant, the nuclei were round and centrally located, the blood vessels and sinusoidal space structure were normal, and no obvious inflammatory cell infiltration or necrosis was observed, indicating that the liver of the control group was in a normal physiological state; Model group (MG): Under 1.5x panoramic view, tissue integrity is reduced, cell density is uneven in local areas, and pale staining areas and areas of structural disorder are visible. Under 10x high magnification, the liver lobule structure is destroyed, hepatocytes are arranged in a disordered and crowded manner, cell atypia is increased, and cell swelling or vacuolar degeneration is visible in some areas, accompanied by a small amount of inflammatory cell infiltration, indicating that the colorectal cancer liver metastasis model has been successfully constructed; In the *Lactobacillus plantarum* AY01 group: under 1.5x panoramic view, the liver tissue outline was relatively intact, the cells were evenly distributed, and there were no obvious lesions or necrotic areas. Under 10x high magnification, the hepatocytes were clearly arranged in a plate-like pattern, the liver lobule structure was restored, and the cell morphology was regular, close to the level of the control group. Only a few scattered inflammatory cells were observed, suggesting that *Lactobacillus plantarum* AY01 intervention can significantly improve liver tissue damage in the model group and exert a hepatoprotective effect. Positive drug control group (PG): Under 1.5x panoramic view, the tissue morphology was relatively regular, and local vascular dilation was visible. Under 10x high magnification, the hepatocytes were neatly arranged, the lobular structure of the liver was basically preserved, vascular dilation and congestion were obvious, the cell density was moderate, and there was no obvious necrosis or large-area inflammatory infiltration. Compared with the model group, the damage was significantly relieved, which verified the liver protective effect of the positive drug 5-FU. 2'-Deoxyinosine group (DI): Under 1.5x panoramic view, well-defined nodular lesions were visible locally. Under 10x high magnification, the hepatocyte structure in the lesion area was destroyed, with a large number of inflammatory cells such as lymphocytes and neutrophils infiltrating, and vasodilation and congestion, suggesting that DI intervention may induce local inflammatory response in the liver and has poor effect on the prevention and treatment of colorectal cancer liver metastasis.

[0056] Immunohistochemical staining images of the liver region of mice in each group are shown below. Figure 8 As shown. The percentage of immunohistochemically positive cells in the liver of mice in each group is as follows. Figure 9 As shown in the figure. Immunohistochemical analysis of liver tissue based on Ki-67 and PCNA was performed. The Ki-67 and PCNA positive cell rates were measured using ImageJ. The results are shown in the figure. Figure 8 As shown. Figure 8As shown in Figure A, the average PCNA-positive cell rates were 13.92% in the CG group, 22.01% in the MG group, 16.00% in the Lactobacillus plantarum AY01 group, 14.60% in the PG group, and 16.75% in the DI group. This indicates that the PCNA-positive percentage in the MG group was significantly higher than that in the AY01, CG, and PG groups. Figure 8 As shown in Figure B, the average Ki-67 cell positivity rates were 14.28% in the CG group, 16.78% in the MG group, 13.68% in the *Lactobacillus plantarum* AY01 group, 14.52% in the PG group, and 13.93% in the DI group. The *Lactobacillus plantarum* AY01 treatment group had the lowest Ki-67 cell positivity rate. The results indicate that *Lactobacillus plantarum* AY01 suspension can significantly reduce the percentage of PCNA cells and Ki-67 cells positive in mouse colorectal cancer liver metastases.

[0057] Example 9 Transcriptomics of liver tissue After the experiment, half of the liver tissue from each mouse was taken, placed in an EP tube, flash-frozen in liquid nitrogen for 20 min, and then stored at -80℃ for later use. Each group had 3 replicates.

[0058] Eukaryotic transcriptomics analysis was performed on liver tissues from each group of mice to obtain differential gene volcano maps, such as... Figure 10 The number of differentially expressed genes is shown in Table 1. The number of differentially expressed genes between MG and CG was 1865, with 1072 genes upregulated and 793 genes downregulated. The number of differentially expressed genes between *Lactobacillus plantarum* AY01 and CG was 4751, with 2525 genes upregulated and 2226 genes downregulated. The number of differentially expressed genes between PG and CG was 2965, with 1336 genes upregulated and 1629 genes downregulated. The number of differentially expressed genes between DI and CG was 5634, with 2532 genes upregulated and 3102 genes downregulated.

[0059] Table 1. Number of differentially expressed genes in the liver transcriptome of mice in each group

[0060] KEGG enrichment pathway maps of the liver transcriptome of each group of mice are shown below. Figure 11 As shown: Figure 10The most significantly enriched pathways in group A (MGvsCG) were malaria, FcγR-mediated phagocytosis, and inflammatory bowel disease. Their core functions were clustered together: immune and inflammatory responses, signaling pathways (JAK-STAT, cell adhesion molecules), and infection-related pathways, suggesting that the liver immune regulation and expression of inflammation-related genes in MG mice were significantly altered. Figure 10 The most significantly enriched pathways in group B (Lactobacillus plantarum AY01 vs. CG) were thermogenesis, retinol metabolism, and non-alcoholic fatty liver disease, which were the most significantly different pathways in this group. The core functions focused on metabolic and energy regulation (thermogenesis, retinol metabolism, and lipid metabolism), while also involving pathways related to cell adhesion and angiogenesis, suggesting that changes in liver metabolic reprogramming and energy homeostasis after Lactobacillus plantarum AY01 treatment in mice were the core differences.

[0061] Figure 10 The most significantly enriched pathways in group C (PG vs CG) were protein digestion and absorption, chemical carcinogenesis-reactive oxygen species, and steroid hormone biosynthesis. The core functions emphasized metabolism and oxidative stress (protein metabolism, steroid hormone synthesis, and oxidative phosphorylation), suggesting that PG mice treated with 5-FU exhibited increased liver metabolic disorders and oxidative stress levels compared to normal mice. Figure 10 The most significantly enriched pathways in group D (DIvsCG group) were fat digestion and absorption, lysine degradation, and purine metabolism. The core functions were highly concentrated in substance metabolism (fat, amino acid, carbohydrate, and nucleotide metabolism), suggesting that the overall metabolic network of the liver in the DI group mice was severely disturbed and the metabolism of nutrients was imbalanced.

[0062] The above results indicate that the differentially enriched gene pathways in the four groups are significantly differentiated: MG vsCG: mainly immune inflammation and infection-related pathways; Lactobacillus plantarum AY01 vsCG: mainly energy metabolism and lipid metabolism pathways; PG vsCG: mainly protein / steroid metabolism and oxidative stress pathways; DI vsCG: mainly disorders of broad-spectrum metabolism (fat, amino acids, carbohydrates, etc.).

[0063] Example 10 Gut microbiota study in mice with colorectal cancer liver metastases On the last day of the experiment, mice were housed individually in clean cages. Fresh feces were collected from the cages 20 minutes later, with 4 to 5 feces collected from each ER tube. The feces were then flash-frozen in liquid nitrogen and stored. Five replicates were set for each group. Following the instructions of the fecal genome extraction kit, the genome was extracted, and the V3-V4 region of the bacterial 16S rRNA gene was amplified using primers 515F and 909R. The PCR system (50 μL) consisted of 100 ng DNA template, 2 μL each of forward and reverse primers (10 μmol / L), and 25 μL of 2x TaqMaster Mix. PCR reaction conditions were: pre-denaturation 95℃, 3 min; denaturation 95℃, 15 s; annealing 55℃, 15 s; extension 72℃, 30 s; 30 cycles; final extension 72℃, 10 min. A second PCR was performed using this PCR product as a template, with 5 cycles to minimize the influence of non-specific amplification products. The second PCR product was sent to Shanghai Yuanxu Biotechnology Co., Ltd. for Illumina next-generation sequencing.

[0064] All data are expressed as mean ± SD. SPSS 20.0 statistical software was used for data processing. For data conforming to a normal distribution, paired t-tests were used to analyze within-group differences, and independent samples t-tests were used to analyze between-group differences; for data not conforming to a normal distribution, rank-sum tests were used. A significance level was set at p < 0.05. GraphPad Prism 10.1 was used for plotting. Mothur software was used for sequence processing. The SILVA (V138) database was downloaded from the Mothur website for sequence alignment and classification. OTUs were clustered based on the lowest homology threshold (97%). α-diversity, including the ACE index, Chao1 index, Shannon index, and Simpsion index, was calculated at the OTU level using Mothur. Statistical analysis was performed using GraphPad, with a p-value set at 0.05. β-diversity between samples was calculated using Mothur's Bray Curtis difference measure. Finally, linear discriminant analysis (LEfSe) was performed at the OTU level to calculate differentially expressed microorganisms between groups.

[0065] Comparison of gut microbiota structure among different groups of mice α-diversity of gut microbiota structure in mice of different groups, such as Figure 12 As shown, there were no significant differences in ACE, Chao1, Shannon, and Simpson indices among the groups. This indicates that the community diversity and microbial richness were similar among the groups.

[0066] β-diversity among different groups was assessed based on PCA and PcoA. Figure 13 As shown, the main microbial communities in each group are similar and their taxa largely overlap in the PCA diagram; in the PcoA diagram, the samples are close to each other and their microbial composition is similar.

[0067] Gut microbiota composition at the phylum level in different groups, such as Figure 14 As shown. The gut microbiota composition at the genus level for different groups is as follows: Figure 15 As shown, at the phylum level, the abundance of Firmicutes in the model group (MG group) was significantly increased, accounting for approximately 55%. Except for the model group, the phylum-level community structure was similar in the other groups. The *Lactobacillus plantarum* AY01 treatment group alleviated the abnormal increase in Firmicutes abundance after modeling. At the genus level, the intestinal flora of mice in each group exhibited a complex community structure, including unclassified *Muscarinae* species. unidentified_Muribaculacea e Ligilactobacillu s. Trichophyceae Lachnospiraceae_ NK4A136_group Alternaria Alistipes With Lactobacillus LactobacillusThe dominant bacterial genera were common to all groups, but the distribution characteristics of the bacterial communities differed among the different treatment groups. In the control group (CG), unclassified *Muscarinae* species were present. unidentified_ Muribaculaceae It is the absolutely dominant genus, followed by Ligilactobacillus Unclassified Prevotaceae unidentified_Prevotellaceae With Bacteroides Bacteroides The gut microbiota distribution was relatively balanced. Compared with the CG group, the gut microbiota structure of the model group (MG) mice was significantly disordered, with unclassified Sarcobacteriaceae appearing. unidentified_ Muribaculaceae The relative abundance of Trichophyceae decreased significantly, while the relative abundance of Trichophyceae decreased significantly. Lachnospiraceae_NK4A136_group Lactobacillus Lactobacillus With the genus *Alternaria* Alistipes The relative abundance of [a specific species] increased, suggesting that modeling can induce an imbalance in the abundance of dominant gut bacteria genera; after intervention with *Lactobacillus plantarum* AY01, the gut microbiota structure of mice was restored to some extent: unclassified *Muscarinae* species [were observed]. unidentified_Muribaculaceae The relative abundance rebounded, and at the same time Ligilactobacillus , Alistipes The relative abundance of these bacteria remained at a high level, and the composition of the bacterial community tended to resemble that of the control group; in the positive control group (PG), unclassified Sarcobacteriaceae were present. unidentified_Muribaculaceae The relative abundance of *Desulfovibrio* in this group is closer to that of the CG group, and the abundance of *Desulfovibrio* in this group is closer to that of the CG group. Desulfovibrio and Metamycoplasma The relative abundance of [unspecified species] increased, exhibiting bacterial community characteristics different from other treatment groups; in the DI group, unclassified Sarcobacteriaceae [were present]. unidentified_Muribaculaceae The relative abundance of was the highest among all groups, but Ligilactobacillus With the family Trichophyceae Lachnospiraceae_NK4A136_group The relative abundance of the bacteria decreased, and the bacterial community structure exhibited a unique pattern of change.

[0068] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. Lactobacillus plantarum ( Lactobacillus plantarum The application of AY01 in the preparation of products that inhibit liver metastasis of colorectal cancer. The Lactobacillus plantarum AY01 is deposited at the China Center for Type Culture Collection, with accession number CCTCC M20221517.

2. The application according to claim 1, characterized in that: The application is to inhibit the survival rate of colorectal cancer cells CT26.WT.

3. The application according to claim 1, characterized in that: The application is to inhibit the clonal formation of colorectal cancer cells CT26.WT.

4. The application according to claim 1, characterized in that: The application is to inhibit the migration and scratch repair of colorectal cancer cells CT26.WT.

5. The application according to claim 1, characterized in that: The application aims to reduce the number and size of liver metastases from colorectal cancer and to reduce inflammatory cell infiltration.

6. The application according to claim 1, characterized in that: The application aims to reduce the proportion of Ki-67 and PCNA-positive cells in colorectal cancer liver metastases and improve the pathological condition of liver tissue.

7. The application according to any one of claims 1-6, characterized in that: The product has a time- and dose-dependent safety profile for normal human colonic epithelial cells CCD 841 CoN.

8. The application according to any one of claims 1-6, characterized in that: The product is a pharmaceutically acceptable preparation.

9. Lactobacillus plantarum ( Lactobacillus plantarum The application of bacterial suspension and fermentation supernatant of AY01 in the preparation of products inhibiting liver metastasis of colorectal cancer. The Lactobacillus plantarum AY01 is deposited at the China Center for Type Culture Collection, with accession number CCTCC M 20221517.

10. The application according to claim 9, characterized in that: The application is to inhibit the survival rate of colorectal cancer cells CT26.WT, inhibit the colony formation of colorectal cancer cells CT26.WT, and inhibit the migration and scratch repair of colorectal cancer cells CT26.WT.

Citation Information

Patent Citations

  • A strain of Lactobacillus plantarum AY01 and its application

    CN116144530B